Phenotypic Mutation 'goku' (pdf version)
List |< first << previous [record 41 of 132] next >> last >|
Allelegoku
Mutation Type nonsense
Chromosome15
Coordinate11,000,855 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Slc45a2
Gene Name solute carrier family 45, member 2
Synonym(s) blanc-sale, Oca4, dominant brown, Dbr, bls, Aim1, Aim-1, Matp
Chromosomal Location 11,000,721-11,029,233 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_053077; MGI: 2153040

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000066915] [ENSMUSP00000112408]
SMART Domains Protein: ENSMUSP00000022851
Gene: ENSMUSG00000022243
AA Change: Y13*

DomainStartEndE-ValueType
Pfam:MFS_2 34 262 2.4e-17 PFAM
Pfam:MFS_1 36 363 3e-13 PFAM
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000112408
Gene: ENSMUSG00000022243
AA Change: Y13*

DomainStartEndE-ValueType
Pfam:MFS_2 1 457 2e-22 PFAM
Pfam:MFS_1 2 292 2.6e-12 PFAM
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation
skin/coat/nails
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(21) : Chemically induced (ENU)(11) Spontaneous(7) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Slc45a2 APN 15 11000817 start codon destroyed probably null 0.80
IGL02283:Slc45a2 APN 15 11001182 missense probably damaging 1.00
IGL02634:Slc45a2 APN 15 11023354 missense probably benign 0.21
IGL03039:Slc45a2 APN 15 11012687 missense probably benign
IGL03123:Slc45a2 APN 15 11012655 missense probably benign 0.01
IGL03226:Slc45a2 APN 15 11022192 missense probably damaging 1.00
cardigan UTSW 15 11022172 nonsense
cheng UTSW 15 11025868 missense probably damaging 0.99
Draco2 UTSW 15 11000817 missense probably benign 0.05
galak UTSW 15 11012667 nonsense
grey_goose UTSW 15 11002981 missense probably damaging 1.00
june_gloom UTSW 15 11023443 missense probably damaging 0.96
nilla UTSW 15 splice donor site
Olaf UTSW 15 unclassified
sweater UTSW 15 11012610 missense probably damaging 0.96
voldemort UTSW 15 unclassified
yuki UTSW 15 11001092 missense probably damaging 1.00
zuckerkuss UTSW 15 11025935 critical splice donor site
R0148:Slc45a2 UTSW 15 11025868 missense probably damaging 0.99
R0433:Slc45a2 UTSW 15 11025745 missense probably benign 0.17
R0440:Slc45a2 UTSW 15 11000817 start codon destroyed probably benign 0.05
R0675:Slc45a2 UTSW 15 11025778 missense probably damaging 1.00
R1384:Slc45a2 UTSW 15 11025746 missense probably benign 0.04
R1616:Slc45a2 UTSW 15 11022128 missense probably null 0.00
R1824:Slc45a2 UTSW 15 11022086 missense probably damaging 0.99
R2244:Slc45a2 UTSW 15 11003001 missense probably benign 0.21
R3761:Slc45a2 UTSW 15 11012714 missense probably benign 0.07
R4631:Slc45a2 UTSW 15 11012576 missense probably benign 0.13
R4756:Slc45a2 UTSW 15 11027930 nonsense probably null
R4990:Slc45a2 UTSW 15 11001150 missense probably benign 0.00
R5066:Slc45a2 UTSW 15 11012607 missense probably benign 0.31
R5209:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5210:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5211:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5212:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5213:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5259:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5261:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5390:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5394:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5395:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5422:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5496:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5498:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5499:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5500:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5501:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5649:Slc45a2 UTSW 15 11012607 missense probably benign 0.00
R5662:Slc45a2 UTSW 15 11022083 missense probably benign 0.31
R5696:Slc45a2 UTSW 15 11001133 missense probably damaging 1.00
R5896:Slc45a2 UTSW 15 11000855 nonsense probably null
R6236:Slc45a2 UTSW 15 11022072 missense probably benign 0.00
R6709:Slc45a2 UTSW 15 11001130 missense possibly damaging 0.46
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2018-09-11 10:11 AM by Anne Murray
Record Created 2017-12-04 11:25 AM by Dana Smith
Record Posted 2018-08-02
Phenotypic Description
Figure 1. The goku mice exhibit hypopigmentation of the fur. A wild-type littermate is shown for reference.

The goku phenotype was identified among G3 mice of the pedigree R5896, some of which showed hypopigmentation of the fur (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the hypopigmentation phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 76 mutations (X-axis) identified in the G1 male of pedigree R5896. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 76 mutations. The pigmentation phenotype was linked to a mutation Slc45a2: a T to A transversion at base pair 11,000,855 (v38) on chromosome 15, or base pair 135 in the GenBank genomic region NC_000081 encoding Slc45a2. Linkage was found with a recessive model of inheritance (P = 6.661 x 10-16), wherein 15 affected mice were homozygous for the variant allele, and 68 unaffected mice were either heterozygous (N = 44) or homozygous for the reference allele (N = 24) (Figure 3)

 

The mutation corresponds to residue 135 in the mRNA sequence NM_053077 within exon 1 of 7 total exons.

 

118 ACTGACACCCATACCTATCAATCCTTAGCCGAG

8   -T--D--T--H--T--Y--Q--S--L--A--E-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of tyrosine 13 for a premature stop codon (Y13*) in the SLC45A2 protein.

Protein Prediction
Figure 3. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. The goku mutation (red asterisk) causes substitution of tyrosine 13 for a premature stop codon. This image is interactive. Click on the mutations for more specific information.  

The goku mutation occurs within the N-terminal tail preceding the first transmembrane domain (Figure 3). The function of the N-terminus is unknown. The cytoplasmic N-terminus of SLC45A2 (amino acids 1-45) does not contain any defined domains (UniProt) or post-translational modifications. However, SMART defines a Major Facilitator Superfamily (MFS)_1 Pfam domain, a domain shared by carriers that transport small solutes, consisting of amino acids 36-364. 

 

Please see the record cardigan for information about Slc45a2.

Putative Mechanism

Homozygous mice with Slc45a2 mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and fur (1). In addition, mutations in SLC45A2 can cause oculocutaneous albinism, type IV (OCA4; OMIM: #606574). Mutations at or near the cytoplasmic N-terminus have not been documented in either mouse or human. Expression of SLC45A2goku has not been examined, but the hypopigmentation phenotype resembles that of the proposed null mutant cardigan, indicating loss of SLC45A2 expression in goku

Primers PCR Primer
goku(F):5'- TCTGTCATGCTTCCGAGTG -3'
goku(R):5'- CTGTACAGGCTCTTAGGCAG -3'

Sequencing Primer
goku_seq(F):5'- ATGCTTCCGAGTGCCAAC -3'
goku_seq(R):5'- TCTTAGGCAGGCCCACG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsDana Smith, Brittney Roy, Jamie Russell, and Bruce Beutler
List |< first << previous [record 41 of 132] next >> last >|