Phenotypic Mutation 'angie' (pdf version)
Alleleangie
Mutation Type missense
Chromosome14
Coordinate70,567,833 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Hr
Gene Name hairless
Synonym(s) ALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino
Chromosomal Location 70,552,212-70,573,548 bp (+)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM­_021877; MGI: 96223

Mapped Yes 
Amino Acid Change Aspartic acid changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000022691] [ENSMUSP00000124816] [ENSMUSP00000124042]
SMART Domains Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: D1005G

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
(Using ENSMUST00000022691)
SMART Domains Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: D1005G

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
(Using ENSMUST00000161069)
SMART Domains Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: D1034G

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Blast:JmjC 83 878 N/A BLAST
JmjC 968 1179 5.23e-38 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
(Using ENSMUST00000163060)
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight (DSS Male) - decreased
DSS: sensitive day 10
DSS: sensitive day 7
FACS B cells - decreased
FACS B:T cells - decreased
FACS B1a cells in B1 cells - decreased
FACS B1b cells - increased
FACS B1b cells in B1 cells - increased
FACS B2 cells - decreased
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T cells - decreased
FACS CD44+ T MFI - increased
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS IgD+ B cell percentage - decreased
FACS IgM MFI - increased
FACS IgM+ B cells - decreased
FACS macrophages - increased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - increased
FACS T cells - decreased
skin/coat/nails 10536052 9832313
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(33) : Chemically induced (ENU)(10) Chemically induced (other)(1) Spontaneous(17) Targeted(3) Transgenic(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:Hr APN 14 70565297 splice site probably benign
IGL02020:Hr APN 14 70556437 missense probably benign 0.01
IGL02372:Hr APN 14 70558350 missense possibly damaging 0.94
IGL02380:Hr APN 14 70557761 missense probably damaging 0.98
IGL02554:Hr APN 14 70559866 splice site probably benign
IGL02949:Hr APN 14 70559785 missense possibly damaging 0.87
IGL03406:Hr APN 14 70563420 critical splice donor site probably null
blofeld UTSW 14 70568085 missense probably damaging 1.00
kaburo UTSW 14 unclassified
mister_clean UTSW 14 70560065 critical splice donor site probably benign
mushroom UTSW 14 70568085 missense probably damaging 1.00
prune UTSW 14 70571429 missense probably damaging 1.00
ren UTSW 14 70568085 missense probably damaging 1.00
subclinical UTSW 14 70561836 missense possibly damaging 0.89
yuanxiao UTSW 14 70571448 missense probably damaging 1.00
R0018:Hr UTSW 14 70558277 missense probably benign
R0038:Hr UTSW 14 70568085 missense probably damaging 1.00
R0374:Hr UTSW 14 70556476 missense probably benign 0.01
R0511:Hr UTSW 14 70561912 nonsense probably null
R0609:Hr UTSW 14 70559657 missense probably benign
R1828:Hr UTSW 14 70572037 critical splice donor site probably null
R2030:Hr UTSW 14 70571448 missense probably damaging 1.00
R2266:Hr UTSW 14 70558107 missense probably benign
R2267:Hr UTSW 14 70558107 missense probably benign
R2268:Hr UTSW 14 70558107 missense probably benign
R2377:Hr UTSW 14 70557878 missense probably damaging 1.00
R3686:Hr UTSW 14 70557796 missense probably damaging 0.98
R3687:Hr UTSW 14 70557796 missense probably damaging 0.98
R3754:Hr UTSW 14 70567824 missense probably damaging 1.00
R3803:Hr UTSW 14 70557893 missense probably benign 0.01
R3846:Hr UTSW 14 70571453 missense probably damaging 1.00
R3977:Hr UTSW 14 70563584 missense probably benign 0.01
R3978:Hr UTSW 14 70563584 missense probably benign 0.01
R3979:Hr UTSW 14 70563584 missense probably benign 0.01
R4528:Hr UTSW 14 70566383 missense probably damaging 1.00
R4654:Hr UTSW 14 70563573 missense probably damaging 0.99
R4834:Hr UTSW 14 70559922 missense probably damaging 0.98
R4847:Hr UTSW 14 70556476 missense probably benign 0.04
R4863:Hr UTSW 14 70571972 missense probably damaging 1.00
R5292:Hr UTSW 14 70571992 missense probably damaging 1.00
R5452:Hr UTSW 14 70556627 missense probably damaging 1.00
R5717:Hr UTSW 14 70566176 missense probably benign 0.34
R5902:Hr UTSW 14 70557791 missense probably benign 0.02
R6000:Hr UTSW 14 70567833 missense probably damaging 0.97
R6439:Hr UTSW 14 70561836 missense possibly damaging 0.89
R6823:Hr UTSW 14 70565374 missense probably damaging 0.98
X0025:Hr UTSW 14 70566951 splice site probably null
X0026:Hr UTSW 14 70567841 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2018-09-21 3:05 PM by Anne Murray
Record Created 2018-01-08 7:55 AM by Brittney Roy
Record Posted 2018-03-07
Phenotypic Description
Figure 1. Representative images of angie mice.

Figure 2. Angie mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Angie mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Angie mice exhibit increased CD44 expression on peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The angie phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R6000, some of which showed variable hair loss (Figure 1). Some mice also showed reduced frequencies of B cells (Figure 2) and increased frequencies of central memory CD8 T cells in CD8 T cells (Figure 3) in the peripheral blood. CD44 expression was increased on peripheral blood CD8+ T cells (Figure 4).

Nature of Mutation

Figure 5. Linkage mapping of increased peripheral central memory CD8 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R0304. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 66 mutations. All of the above anomalies were linked by continuous variable mapping to two mutations on chromosome 14: Gucy1b2 and Hr. The mutation in Hr was presumed to be causative because the angie hair loss phenotype mimics other known alleles of Hr (see MGI for a list of Hr alleles as well as the entries for pruneKaburo, and mister_clean). The Hr mutation is an A to G transition at base pair 70,567,833 (v38) on chromosome 14, or base pair 13,778 in the GenBank genomic region NC_000080 encoding Hr. The mutation corresponds to residue 3,708 in the mRNA sequence NM_021877 within exon 16 of 20 total exons. The strongest association was found with a recessive model of inheritance to the normalized frequency of central memory CD8 T cells in CD8 T cells, wherein three variant homozygotes departed phenotypically from 16 homozygous reference mice and 23 heterozygous mice with a P value of 2.491 x 10-9 (Figure 5).  

 

3692 TGCGTGGAGGTGTCTGACCTAATCAGTATCCTG
1000 -C--V--E--V--S--D--L--I--S--I--L-
 

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to glycine substitution at position 1,005 (D1005G) in the HR protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.973).

 

The causative mutation for the immune phenotypes was validated to be in Hr by CRISPR/Cas9-mediated targeting of Hr (Table 1).

 

Table 1. CRISPR/Cas9 results

Screen p-value
FACS B cells 3.002 x 10-34
FACS CD44+ CD8 MFI 4.32 x 10-8
FACS central memory CD8 T cells in CD8 T cells 2.863 x 10-18
Protein Prediction
Figure 6. HR functional domains. The N-terminal domain varies between the two isoforms of HR; only the longer isoform is shown. The position of the angie mutation is indiated in red and results in an aspartic acid to glycine substitution at position 1,005. NMTS, nuclear matrix targeting signal; RD, repression domain; NLS, nuclear localization signal; ID, interacting domain; ZF, zinc finger domain; ROR, retinoic acid receptor related orphan receptor; TR, thyroid hormone receptor. Click on the image to view other mutations found in HR. Click on each mutation for more specific information.

The mouse HR protein contains 1211 amino acids (a shorter 1182 amino acid isoform differs only at the N-terminus) (Figure 6). The HR protein contains a potential DNA-binding zinc finger domain consisting of a highly conserved six cysteine motif located within a loop region at amino acids 585-620 (for mouse HR). A novel bipartite nuclear localization signal (NLS) was identified at amino acids 409-427 consisting of the sequence KRA(X13)PKR (1). A novel nuclear matrix targeting signal (NMTS) at amino acids 111-156 is also necessary for its nuclear sub-localization (2). Repressive domains (RD) are located at amino acids 210-423 (RD1), 725-839 (RD2), and 839-956 (RD3). The RD2 domain contains regions that interact with the thyroid hormone receptor (TR), the retinoic acid receptor related orphan receptor α (RORα) and the vitamin D receptor (VDR) (3-5).  Domains that have been shown to interact with TR are located at amino acids 792-805 (TR-ID1 for TR interacting domain 1) and amino acids 1001-1013 (TR-ID2) (3). RORα-interacting domains (ROR-ID) are located at amino acids 561-565 and 753-757 (4). HR contains two LXXLL motifs known as nuclear receptor (NR) boxes that are present in nuclear receptor coactivators, and are known to interact with the α-helical AF-2 motif present in the ligand binding domain (LBD) of nuclear receptors (1;6). The HR protein also contains a JmjC domain at amino acids 968-1179. The angie mutation results in an aspartic acid to glycine substitution at position 1,005 (D1005G) in the JmjC domain.

 

Please see the record for prune for more information about hairless.

Putative Mechanism

HR is a nuclear receptor corepressor that is thought to regulate hair cell cycling by interacting with and repressing nuclear hormone receptors to control gene expression. Mutations and deletions at the C-terminus of human HR can cause Alopecia Universalis Congenita [(7); OMIM: #203655], atrichia with popular lesions [(8-10); OMIM: #209500], and/or hypotrichosis 4 (OMIM: #146550). Patients with these conditions are normally born with hair that subsequently falls out resulting in a complete or nearly complete absence of all hair. In the mouse, the classical hairless (hr) and rhino (hrrh) homozygous mutants with mutations in the hr gene develop a normal first coat, but do not reinitiate subsequent hair cycles resulting in alopecia (11-13). Histologically, the skin of hairless and rhino mice are normal until the first hair cycle is nearly complete. Just before the normal loss of the first coat, the hair follicles of these mutants appear altered. As the mutant animals age there is hypertrophy of the sebaceous glands, loss of adipose tissue, and the development of various types of cysts from the hyperkeratotic upper part of the hair canals, and the sheaths of the abnormal follicles stranded in the dermis (13-15). Toward the end of HF morphogenesis, the proximal hair bulb undergoes premature and massive apoptosis associated with a lack of coordination of cell proliferation in defined HF compartments (14). Although the hair follicle defects in both hairless and rhino mutants are similar, animals homozygous for rhino alleles also develop thickened and severely wrinkled skin (12). The angie phenotype mirrored other phenotypes attributed to mutations in Hr (see pruneKaburo, and mister_clean as well as alleles listed at MGI), indicating loss of HR function.

Primers PCR Primer
angie(F):5'- CCTATGGTGAGTGCCTTTCCAC -3'
angie(R):5'- GGAACACATGCCACACAGTG -3'

Sequencing Primer
angie_seq(F):5'- TGTCCACCCCACACCTCTG -3'
angie_seq(R):5'- ATGCCACACAGTGCTGGTC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsBrittney Roy, Jamie Russell, and Bruce Beutler