Phenotypic Mutation 'stitch' (pdf version)
Allelestitch
Mutation Type nonsense
Chromosome18
Coordinate77,948,299 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Epg5
Gene Name ectopic P-granules autophagy protein 5 homolog (C. elegans)
Chromosomal Location 77,938,467-78,035,027 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001195633; MGI:1918673

Mapped Yes 
Amino Acid Change Cysteine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000038681]
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: C70*

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Predicted Effect probably null
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Probably essential (E-score: 0.937) question?
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological 23479740
FACS CD44+ CD4 MFI - decreased
Candidate Explorer Status CE: excellent candidate; human score: 0.5; ML prob: 0.66
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(8) : Gene trapped(6) Targeted(1) Transposon induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78023990 missense probably damaging 0.99
R1801:Epg5 UTSW 18 77983490 missense possibly damaging 0.63
R1864:Epg5 UTSW 18 77975031 missense probably damaging 0.99
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R1986:Epg5 UTSW 18 77982306 critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4612:Epg5 UTSW 18 77982414 missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5773:Epg5 UTSW 18 77960825 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R5914:Epg5 UTSW 18 77959632 critical splice donor site probably null
R6124:Epg5 UTSW 18 78030045 missense probably benign
R6228:Epg5 UTSW 18 77948462 missense possibly damaging 0.90
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6320:Epg5 UTSW 18 77962398 missense probably damaging 1.00
R6328:Epg5 UTSW 18 78028964 missense possibly damaging 0.88
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense probably damaging 1.00
R7207:Epg5 UTSW 18 77948955 missense probably damaging 1.00
R7225:Epg5 UTSW 18 78012702 missense probably benign 0.45
R7358:Epg5 UTSW 18 77959037 missense possibly damaging 0.78
R7414:Epg5 UTSW 18 77983532 missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78023278 missense probably benign 0.01
R7535:Epg5 UTSW 18 78032926 missense probably benign 0.18
R7586:Epg5 UTSW 18 78030060 missense probably benign
R7651:Epg5 UTSW 18 77981400 nonsense probably null
R7715:Epg5 UTSW 18 77968586 missense probably damaging 1.00
R7753:Epg5 UTSW 18 77948345 missense possibly damaging 0.92
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Mode of Inheritance Unknown
Local Stock Live Mice
Repository
Last Updated 2019-09-04 9:38 PM by Anne Murray
Record Created 2018-01-10 8:14 AM by Jamie Russell
Record Posted 2019-03-21
Phenotypic Description
Figure 1. The stitch phenotype.

The stitch phenotype was identified among G3 mice of the pedigree R5858, some of which showed circling as well as abnormal front limb movement (i.e., some of their front limbs are very jerky with more frequent movement and others appear to constantly vibrate).

Nature of Mutation

Figure 2. Linkage mapping of the neurological phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 52 mutations (X-axis) identified in the G1 male of pedigree R5858. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 52 mutations. The neurological phenotype was linked by continuous variable mapping to a mutation in Epg5:  a T to A transversion at base pair 77,948,299 (v38) on chromosome 18, or base pair 9,892 in the GenBank genomic region NC_000084. Linkage was found with an additive model of inheritance (2.737 x 10-5; Figure 2). Nine affected mice were either homozygous for the variant allele (N = 4), heterozygous (N = 4), or homozygous for the reference allele (N = 1); 42 unaffected mice were either heterozygous (N = 19) or homozygous for the reference allele (N = 23).   

 

The mutation corresponds to residue 243 in the mRNA sequence NM_001195633 within exon 2 of 44 total exons.

 

226 CTCCACAGTGATGTGTGTGGATGGAATGAAAGT

65  -L--H--S--D--V--C--G--W--N--E--S-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of cysteine 70 for a premature stop codon (C70*) in the EPG5 protein.

Protein Prediction
Figure 3. Domain organization of EPG5. EPG5 has no defined domains, but has a predicted coiled-coil (CC). The stitch mutation results in substitution of cysteine 70 for a premature stop codon.

Epg5 encodes ectopic P granules protein 5 (EPG5). EPG5 has no defined functional domains, but the predicted structure of EPG5 includes a membrane remodeling domain, a karyopherin-like domain, and a coiled-coil region (Figure 3(1). If present, the karyopherin-like domain putatively promotes interactions with molecules that are transported between the cytoplasm and nucleus.

 

The Stitch mutation results in substitution of cysteine 70 for a premature stop codon (C70*).

Expression/Localization

EPG5 is ubiquitously expressed, with highest expression in the brain, central nervous system, heart, skeletal muscle, immune cells, thymus, lungs, liver, kidneys, and ovary (1;2). Human EPG5 localizes in the cytoplasm and on late endosomes/lysosomes (3). Upon autophagy induction, EPG5 localizes with amphisomes/autolysosomes (3).

Background
Figure 4. EPG5 function in autophagy. EPG5 directly interacts with Rab7 and the late endosomal/lysosomal R-SNARE VAMP7/8, which recruits EPG5 to the late endosomes/lysosomes. EPG5 also binds to LC3 and to assembled STX17-SNAP29 Qabc SNARE complexes on autophagosomes. EPG5 mediates fusion of autophagosomes with late endosomes/lysosomes. See text for details. This image is interactive. Other mutations found in the pathway are noted in red. Click on each mutation for more information.

Autophagy is a method of degradation that is involved in cellular maintenance and development. In canonical autophagy, a portion of the cytoplasm is sequestered within double-membrane vesicles known as autophagosomes and delivered to the lysosome whereby the contents are degraded. Studies showed that EPG5 is a Rab7 effector that determines the fusion specificity of autophagosomes with late endosomes/lysosomes during autophagy (Figure 4(3). EPG5 directly interacts with Rab7 and the late endosomal/lysosomal R-SNARE VAMP7/8, which recruits EPG5 to the late endosomes/lysosomes. EPG5 also binds to LC3 and to assembled STX17-SNAP29 Qabc SNARE complexes on autophagosomes. EPG5 stabilizes and facilitates the assembly of STX17-SNAP29-VAMP7/8 trans-SNARE complexes, and promotes STX17-SNAP29-VAMP7-mediated fusion of reconstituted proteoliposomes. Loss of EPG5 function in C. elegans, mice, and humans results in blockade of autophagosome maturation into degradative autolysosomes (4-6). Loss of EPG5 function also results in impaired endosomal trafficking (5). Reduced EPG5 expression resulted in slowed endocytic degradation and delayed endocytic recycling (5).

 

EPG5 is essential for the transport of the TLR9 (see the record CpG1) ligand CpG to the late endosomal/lysosomal compartment as well as for TLR9-associated signaling (1). CpG is internalized by immune cells and interacts with TLR9 proteins within endosomes. For information about TLR9-associated signaling, see the record for CpG1. TLR9-associated signaling promotes the expression of several genes, including those that encode IL-6, IL-1, tumor necrosis factor (TNF), IL-12p40, and type I interferon (IFN), cytokines required for the inflammatory response. Together with ligands on antigen-presenting cells (APCs) that bind to activating receptors on lymphocytes, these cytokines mediate adaptive immune activation.

 

Mutations in EPG5 are associated with Vici syndrome (OMIM: #242840) (7-11). Patients with Vici syndrome can exhibit psychomotor retardation, developmental delays, agenesis of the corpus callosum, hypopigmentation, cataracts, progressive cardiomyopathy, myopathy, progressive microcephaly, sensorineural deafness, skeletal muscle myopathy, failure to thrive, and variable immunodeficiency (e.g., loss of B cells) due to defects in autophagy (e.g., accumulation of autophagic cargo and the impaired fusion with lysosomes). Due to the progressive nature of Vici syndrome, it often leads to lethality with a mean survival of 24 months of age. Patients commonly die due to respiratory failure due to airway infections secondary to immunodeficiency as wel las due to the progressive cardiomyopathy and neurological phenotypes.

 

Epg5-deficient (Epg5-/-) mice exhibited progressive neurological defects (e.g., severe muscle atrophy and muscle denervation), limb grasping, impaired coordination, and hind limb paralysis at 10 months of age (4;5). The Epg5-/- mice died at 10 to 12 months. The mice also showed thin corpus callosum and muscle atrophy. The Epg5-/- mice showed postnatal growth retardation, reduced body weights (females show later phenotype compared to male mice), kyphosis, and rough coat. Epg5-/- mice also showed features of retinitis pigmentosa, including impaired retina function along with progressive loss of retina photoreceptor cells and increased numbers of apoptotic cells in the outer nuclear layer (12). Autophagic flux was also impaired in the Epg5-/- retina (12).

Putative Mechanism

Epg5 deficiency impaired autophagic flux by blocking the maturation of autophagosomes into degradative autolysosomes, leading to accumulation of p62 aggregates and ubiquitin-positive inclusions in neurons and glial cells (4;5).

Primers PCR Primer
stitch_pcr_F: TCCTCATGCTGAAACCACTAG
stitch_pcr_R: CTTCCGGGAAGTTCTTACAAGG

Sequencing Primer
stitch_seq_F: GCTGAAACCACTAGCTCTTTTATATC
stitch_seq_R: CCGGGAAGTTCTTACAAGGTTCAC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 402 nucleotides is amplified (chromosome 18, + strand):


1   tcctcatgct gaaaccacta gctcttttat atctcctgcc ttgcttgtag gaaaagaaga
61  agcatgaagc ccttcagact tgtgatgcag gtcccctgcc agagacctgt cgcgagcagg
121 agagcccgtg tccagcttct gaactcaaag gagatgacct gaagtcgtct gctgaccccc
181 agctccacag tgatgtgtgt ggatggaatg aaagtgagat gtttgatata ccactcacct
241 ccttgactat aggggatgaa ggtcccccgg tacaggacac agaggaccta aaagaaaggg
301 gagaggtcac agccggtgat ggagatgatg aaatggagtt gaaggtggac cctggggaca
361 acgttatagc taaaggtgaa ccttgtaaga acttcccgga ag


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsLauren Prince, Jamie Russell, and Bruce Beutler