Phenotypic Mutation 'flybase' (pdf version)
Alleleflybase
Mutation Type start codon destroyed
Chromosome15
Coordinate78,491,848 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Il2rb
Gene Name interleukin 2 receptor, beta chain
Synonym(s) IL-15 receptor beta chain, CD122, IL-15Rbeta, IL15Rbeta, IL-2/15Rbeta, Il-2Rbeta
Chromosomal Location 78,479,256-78,495,271 bp (-)
MGI Phenotype FUNCTION: The interleukin 2 receptor is composed of alpha and beta subunits. The beta subunit encoded by this gene is very homologous to the human beta subunit and also shows structural similarity to other cytokine receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous activation of T cells and differentiation of B cells, elevated immunoglobulins including autoantibodies causing hemolytic anemia, granulocytopoiesis, and death after 3 months of age. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008368; MGI:96550

Mapped Yes 
Amino Acid Change Methionine changed to Threonine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000086820] [ENSMUSP00000127006]
SMART Domains Protein: ENSMUSP00000086820
Gene: ENSMUSG00000068227
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Predicted Effect probably null

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
(Using ENSMUST00000089398)
SMART Domains Protein: ENSMUSP00000127006
Gene: ENSMUSG00000068227
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Predicted Effect probably null

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
(Using ENSMUST00000163494)
Meta Mutation Damage Score 0.9612 question?
Is this an essential gene? Probably nonessential (E-score: 0.078) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight (DSS Female) - decreased 7770771
Body Weight (DSS) - decreased 7770771
Body Weight (DSS, z-score) - decreased
FACS B cells - decreased 7770771
FACS B:T cells - decreased
FACS B220 MFI - increased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD4 T cells - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T cells - increased
FACS CD44+ T MFI - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgM+ B cells - decreased 7770771
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
NK cell response - decreased
NK killing - decreased
OVA-specific IgE - increased 7770771
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 7770771
total IgE level - increased 7770771
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.936; ML prob: 0.902; human score: -0.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(15) : Chemically induced (other)(1) Radiation induced(2) Targeted(8) Transgenic(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Il2rb APN 15 78481697 missense probably benign 0.00
Bonnerhall UTSW 15 78485004 missense probably benign
diptera UTSW 15 78485806 missense probably damaging 1.00
Moonpie UTSW 15 78481834 frame shift probably null
Whistles UTSW 15 78481936 missense possibly damaging 0.72
R0581:Il2rb UTSW 15 78481936 missense possibly damaging 0.72
R1795:Il2rb UTSW 15 78483987 missense probably damaging 1.00
R1932:Il2rb UTSW 15 78491777 missense possibly damaging 0.93
R2924:Il2rb UTSW 15 78491849 start codon destroyed probably null 0.27
R4706:Il2rb UTSW 15 78486400 missense possibly damaging 0.81
R5713:Il2rb UTSW 15 78491848 start codon destroyed probably null 0.66
R5953:Il2rb UTSW 15 78484982 nonsense probably null
R6018:Il2rb UTSW 15 78482066 missense possibly damaging 0.54
R6279:Il2rb UTSW 15 78481538 missense possibly damaging 0.72
R6666:Il2rb UTSW 15 78481834 frame shift probably null
R6961:Il2rb UTSW 15 78485824 missense probably damaging 1.00
R8020:Il2rb UTSW 15 78485004 missense probably benign
R8477:Il2rb UTSW 15 78485806 missense probably damaging 1.00
X0018:Il2rb UTSW 15 78485765 missense probably damaging 1.00
X0066:Il2rb UTSW 15 78484956 missense probably benign 0.04
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-09-04 9:38 PM by Diantha La Vine
Record Created 2018-01-10 11:05 PM by Xue Zhong
Record Posted 2018-12-18
Phenotypic Description
Figure 1. Flybase mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Flybase mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Flybase mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Flybase mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Flybase mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Flybase mice exhibit reduced frequencies of peripheral naïve CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Flybase mice exhibit reduced frequencies of peripheral naïve CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Flybase mice exhibit increased expression of CD44 on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Flybase mice exhibit increased expression of CD44 on peripheral CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Flybase mice exhibit increased expression of CD44 on peripheral CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The flybase phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5713, some of which showed reduced B to T cell ratios (Figure 1) due to reduced frequencies of B cells (Figure 2) and IgM+ B cells (Figure 3) with concomitant increased frequencies of effector memory CD4 T cells in CD4 T cells (Figure 4) and effector memory CD8 T cells in CD8 T cells (Figure 5) as well as reduced frequencies of naïve CD4 T cells in CD4 T cells (Figure 6), and naïve CD8 T cells in CD8 T cells (Figure 7), all in the peripheral blood. The expression of CD44 on peripheral T cells (Figure 8), including CD4 (Figure 9) and CD8 (Figure 10) T cells was increased.

Nature of Mutation

Figure 11. Linkage mapping of the increased frequency of effector memory CD8 T cells in CD8 T cells phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 51 mutations (X-axis) identified in the G1 male of pedigree R5713. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 51 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 15: Phf20l1 and Il2rb. The mutation in Il2rb was presumed causative as the immune cell phenotypes mimic those of other Il2rb alleles (see MGI). The Il2rb mutation is a T to C transition at base pair 78,491,848 (v38) on chromosome 15, or base pair 19,774 in the GenBank genomic region NC_000081 encoding Il2rb. The strongest association was found with a recessive model of inheritance to the normalized effector memory CD4 T cell frequency phenotype, wherein 2 variant homozygotes departed phenotypically from 22 homozygous reference mice and 27 heterozygous mice with a P value of 4.415 x 10-22 (Figure 11).   

 

The mutation corresponds to residue 151 in the mRNA sequence NM_008368 within exon 2 of 10 total exons.


 

135 CTCCTCTCAGCTGTGATGGCTACCATAGCTCTT

1                  -M--A--T--I--A--L-

 

The mutated nucleotide is indicated in red. The mutation results in a methionine to threonine substitution at position 1 (M1T) in the IL2RB protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.663). The next putative initiator methionine is at position 47.

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 12. Quaternary structure of interleukin-2 with its α, β (CD122), and γc receptors. UCSF Chimera model is based on PDB 2B5I, Wang et al. Science 310, 1159-1163 (2005). Click on the 3D structure to view it rotate.
Figure 13. Domain organization of CD122. The flybase mutation results in a methionine to threonine substitution at position 1. Abbreviations: SP, signal peptide; FN3, fibronectin type-III; TM, transmembrane domain; SS, sorting signal. This image is interactive. Other mutations found in CD122 are noted in red. Click on each muation for more information.

Il2rb encodes CD122 (alternatively, IL2Rβ), the beta chain of the IL-2 and IL-15 receptors (1). The IL-2 receptor has three subunits: c subunits together form an intermediate affinity receptor (3). Upon co-expression of the α subunit, the receptor is converted to a high affinity receptor [Figure 12; PDB:2B5I; (4;5)].

 

CD122 is a single-pass transmembrane protein, with an extracellular N-terminus and a cytoplasmic C-terminus (Figure 13). Amino acids 1 to 26 are a signal peptide. IL2RB has a single fibronectin type-III domain (FN3; amino acids 135 to 235), a WSXWS motif (amino acids 221 to 225), and a box 1 motif (amino acids 281 to 289). The FN3 domain mediates interactions between CD122 and the γc IL-2/-15 receptor subunit [(4). The FN3 domain folds into a β-sandwich sheet consisting of seven antiparallel strands arranged in a three-on-four topology (4). The WSXWS motif promotes proper folding and subsequent intracellular transport of CD122. The box 1 motif mediates interaction with and/or activation of JAK3 (see the record for mount_tai; see the Background section for more information about CD122 and JAK3) (6;7).

 

Ser132, His133, and Tyr134 are required for IL-2 binding (8). The C-terminal 147 amino acids are required for STAT5 activation, but not for IL-2-induced cell proliferation (9). A sorting signal motif in the CD122 cytosolic tail (amino acids 289 to 296) targets CD122 to degradation compartments (10;11). Upon binding of IL-2 to the IL-2R, the receptor is internalized (12;13). Once endocytosed, the receptor subunits are sorted: the α chain recycles to the plasma membrane, whereas the β and γ chains are targeted to late endosomes/lysosomes (14). The ubiquitin proteasome system promotes the sorting of CD122 to late endosomes/lysosomes (15).

 

CD122 is phosphorylated by LCK (see the record for iconoclast) at Tyr355, Tyr358, Tyr361, Tyr392, and Tyr510 (16). CD122 phosphorylation of Tyr338, Tyr392, and Tyr510 promotes IL-2-induced proliferation, while Tyr392 and Tyr510 phosphorylation is required for IL-2-induced receptor activation and downstream signaling (17). CD122 can also be phosphorylated at Thr450 (18). Thr450 phosphorylation regulates IL-2 receptor complex formation, recruitment of JAK3, and downstream signaling. CIS interacts with CD122 at the “A region” (amino acids 313 to 382). CIS binding inhibits IL-2-associated signaling by preventing binding of CD122 with LCK and JAK3, subsequently preventing LCK-mediated phosphorylation of CD122 and JAK3-mediated activation of STAT5 (19;20).

 

CD122 is cleaved, which generates a 37-kDa fragment (termed 37βic) containing the C-terminal tail and transmembrane domains (21). The CD122 fragment is functional and associates with STAT5 to promote cell proliferation.

 

The flybase mutation results in a methionine to threonine substitution at position 1 (M1T); Met1 is within the signal peptide.

Expression/Localization

A CD122/γc complex is expressed on NK cells, macrophages, and resting T cells (22). The high-affinity IL-2Rα, CD122, and γc receptor complex is expressed on activated T cells (23).

 

In embryonic day 12 (E12) livers, CD122 is expressed on Sca1+Lin- hematopoietic stem cells and on B220+ cells (24). In the E12 thymus, Sca1+ intrathymic T-cell progenitors expressed CD122 (24).

Background
Figure 14. IL-2Rβ-associated signaling. CD122 mediates both IL-2 and IL-15 signaling. Upon receptor stimulation, JAK proteins phosphorylate the receptor cytoplasmic domains. STAT proteins are recruited to the receptor, tyrosine phosphorylated by JAKs, and dimerize for translocation to the nucleus with the assistance of importin-α5 (associated with importin-β). Once STAT1 binds to its DNA target, importin-α5 is recycled to the cytoplasm by the cellular apoptosis susceptibility protein (CAS) export receptor.

IL-2/IL-15 receptor-associated signaling functions in antigen-driven T cell-expansion, maintains peripheral T cell homeostasis, and promotes the differentiation and function of NK cells and B cells. Stimulation of the IL-2 and IL-15 receptors (containing a γc subunit) results in activation of JAK1 and JAK3 (Figure 14). Activated JAK3 phosphorylates the receptor cytoplasmic domains, creating phosphotyrosine ligands for the SH2 domains of STAT1 and STAT3. Once recruited to the receptor, STAT5 is also tyrosine phosphorylated by JAK3. STAT5 phosphorylation putatively allows formation and/or conformational reorganization of an activated STAT5 dimer, involving reciprocal SH2 domain-phosphotyrosine interactions between STAT5 monomers. Phosphorylated, activated STAT5 enters the nucleus where it accumulates to promote transcription.

 

In the mouse, CD8+CD122+CXCR3+ (CD44high, CD62Lhigh CCR7+) T cells exhibit a central memory phenotype, regulate T cell homeostasis, and function as regulatory T cells by suppressing autoimmune and alloimmune responses [(25;26); reviewed in (27)]. The percentage of CD122+ T cells in CD8+ cells is high in young age and increases with age (25). IL-15 promotes the generation and survival of memory CD8+ T cells (28).

 

In humans, IL2RB is a putative candidate gene for psoriasis susceptibility in a Turkish cohort (29) and inflammatory bowel disease in a Tunisia cohort (30).

 

Il2rb-deficient (Il2rb-/-) mice exhibited reduced numbers of regulatory T cells in the thymus and lymph nodes, enlarged spleens, increased sizes of spleen periarteriolar lymphoid sheaths, aberrant T cell responses to inflammatory cytokines, increased percentages of CD4 and CD8 T cells that express high levels of activation markers, reduced T cell proliferation, enlarged lymph nodes, increased levels of anti-DNA antibodies, and increased susceptibility to autoimmune hemolytic anemia (31;32). In addition, Il2rb-/- mice showed reduced numbers of double-positive T cells, B cells, and memory T cells; increased numbers of plasma cells, CD4+ T cells and CD8+ T cells in the thymus, erythroid progenitors in the blood, and neutrophils in the lymph nodes, and increased levels of IgE and IgG1 in the sera (32). Il2rb-/- mice also showed premature death, weight loss, slow movements, fuzzy hair, and poorly developed genitalia (32).

Putative Mechanism

The expression of CD122flybase has not been examined to determine if the mutant protein is expressed; however, the immune phenotypes observed in the flybase mice indicates aberrant CD122-associated function.

Primers PCR Primer
flybase_pcr_F: ATGGATCTCCTCCCTGAAGCAG
flybase_pcr_R: CCACCAGTTTCTTGTGATGGG

Sequencing Primer
flybase_seq_F: CAGGAATCTGGGATGTGACCTC
flybase_seq_R: GGGTTGGTCATTTATAGTGAAAACAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 248 nucleotides is amplified (chromosome 15, - strand):


1   ggtagagtgg ggtggggttt ctgacttgtt ctttccttct ccacttaggg tttgcatcct
61  cagctcctct cagctgtgat ggctaccata gctcttccct ggagcctgtc cctctacgtc
121 ttcctcctgc tcctggctac accttgggca tctgcagcag tgaaaagtga gcatctggca
181 ttttgatgtc catactttcc ccagtgggag gtcacatccc agattcctgc ttcagggagg
241 agatccat


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, Evan Nair-Gill, Jianhui Wang, Bruce Beutler