Phenotypic Mutation 'cerulean'

• Allele: cerulean
• Mutation Type: nonsense
• Chromosome: 16
• Coordinate: 19,957,218 bp (GRCm38)
• Base Change: G ⇒ A (forward strand)
• Gene: Klhl6
• Gene Name: kelch-like 6
• Chromosomal Location: 19,946,496-19,983,037 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000053023] [ENSMUSP00000130755]
• AlphaFold: Q6V595
• SMART Domains: Protein: ENSMUSP00000053023; Gene: ENSMUSG00000043008; AA Change: Q197*

Domain	Start	End	E-Value	Type
BTB	70	167	1.43e-25	SMART
BACK	172	274	1.68e-35	SMART
Kelch	376	419	3.05e-1	SMART
Kelch	420	466	6.82e-11	SMART
Kelch	467	514	4.27e-3	SMART
Kelch	515	556	3.06e-4	SMART
Kelch	557	604	3.47e-3	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000130755; Gene: ENSMUSG00000043008

Domain	Start	End	E-Value	Type
Pfam:BTB	60	98	1.2e-9	PFAM

• Predicted Effect: noncoding transcript
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Probably nonessential (E-score: 0.070)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-10-25 12:16 PM by Bruce Beutler
• Record Created: 2018-01-19 7:22 AM by Xue Zhong
• Record Posted: 2018-07-20
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, Evan Nair-Gill, Jianhui Wang, Bruce Beutler

Accession Number

NCBI RefSeq: NM_183390; MGI:2686922

Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (ENU)(1) Targeted(5)

Phenotypic Description

Figure 1. Cerulean mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Cerulean mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Cerulean mice exhibit reduced frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Cerulean mice exhibit reduced frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Cerulean mice exhibit increased CD4+ to CD8+ T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Cerulean mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Cerulean mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Cerulean mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Cerulean mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Cerulean mice exhibit reduced frequencies of peripheral central memory CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Cerulean mice exhibit reduced frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Cerulean mice exhibit reduced expression of CD44 on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Cerulean mice exhibit reduced expression of B220 on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The cerulean phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5700, some of which showed a decrease in the B to T cell ratio (Figure 1) caused by an increase in the T cell frequency (Figure 2) coupled with reduced frequencies of B cells (Figure 3) and IgM+ B cells (Figure 4). Some mice also showed an increase in the CD4⁺ to CD8⁺ T cell ratio (Figure 5), increased frequencies of CD4⁺ T cells (Figure 6), CD4+ T cells in CD3+ T cells (Figure 7), CD8⁺ T cells (Figure 8), and B1 cells (Figure 9) coupled with reduced frequencies of central memory CD4+ T cells in CD4+ T cells (Figure 10) and CD8+ T cells in CD3+ T cells (Figure 11), all in the peripheral blood. The CD44 mean fluorescence intensity on peripheral blood CD4⁺ T cells was reduced (Figure 12). The B220 mean fluorescence intensity on peripheral blood B cells was reduced (Figure 13)

Nature of Mutation

Figure 14. Linkage mapping of the CD4+ T cell frequency phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 51 mutations (X-axis) identified in the G1 male of pedigree R5700. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 51 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Klhl6:  a C to T transition at base pair 19,957,218 (v38) on chromosome 16, or base pair 25,832 in the GenBank genomic region NC_000082 encoding Klhl6. The strongest association was found with a recessive model of inheritance to the normalized frequency of CD4+ T cells, wherein 12 variant homozygotes departed phenotypically from 29 homozygous reference mice and 37 heterozygous mice with a P value of 8.965 x 10^-20 (Figure 14).  A substantial semidominant effect was observed in several assays, but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

The mutation corresponds to residue 635 in the mRNA sequence NM_183390 within exon 3 of 7 total exons.

620 CAAAGTTACATCATTCAAAACTTTGTTCAGATT 192 -Q--S--Y--I--I--Q--N--F--V--Q--I-

The mutated nucleotide is indicated in red. The mutation results in substitution of glutamine 197 for a premature stop codon (Q197*) in the KLHL6 protein.

Protein Prediction

Figure 15. Domain structure of the KLHL6 protein. KLHL6 is a member of the Kelch-like family. The cerulean mutation (Q197*) is indicated. Please see the text for more details about these domains. BTB, Broad-complex, Tramtrack and Bric à brac domain; BACK, BTB and C-terminal kelch domain. The image is interactive. Additional mutations found in KLHL6 are noted. Click each mutation to view more information. Domain information is from SMART and UniProt.

KLHL6 is a member of the Kelch-like family of proteins (see the record for teeny for information about KBTBD2, another Kelch-like family member). Similar to other Kelch-like family members, KLHL6 has a Bric-a-brac, Tramtrack, Broad-complex (BTB) domain at the N-terminus, a BACK domain, and a kelch repeat region at the C-terminus (KLHL6 has five or six kelch repeats) (1).

BTB domains are often associated with other domains including C₂H₂ zinc finger (for information about a member of the BTB-zinc finger (BTB-ZF) family, ZBTB1, please see the record for scanT) and kelch domains. The BTB domain promotes protein-protein interactions including homodimerization and heterodimerization with non-BTB proteins (e.g., transcriptional corepressors and the E3 ligase Cullin 3 (Cul3)) [(2;3); reviewed in (4)]. The ~120-amino acid BTB domains have a common 95-amino acid region, the BTB fold, that consists of a cluster of five α-helices (A1–A5) made up, in part, of two α-helical hairpins (A1/A2 and A4/A5), and capped at one end by a short solvent-exposed three stranded β-sheet (B1/B2/B3) (2). Another hairpin-like motif comprised of A3 and an extended region links the B1/B2/A1/A2/B3 and A4/A5 segments of the fold (2). Although the overall structure of the BTB fold is shared among the BTB-containing proteins, the oligomerization or protein-protein interaction states of the proteins involve different surface-exposed residues (2).

Most of the BTB-kelch proteins also contain a highly conserved BACK domain (2;5). The BACK domain is ~130 amino acids, with highest conservation within the first 70 residues immediately following the BTB domain (5). The BACK domains contain a conserved N-terminal Asn-Cys-Leu-Gly-Ile sequence, a Val-Arg-[Leu/Met/Phe]-Pro-Leu-Leu sequence, two arginine residues and four glutamic acids; most of the conserved amino acids are non-polar, indicating that the BACK domain contains a hydrophobic core (5). The functional role of the BACK domain is unknown (5).  

Kelch motifs are 44 to 56 amino acids in length. Kelch motifs have conserved motifs including four hydrophobic residues followed by a double glycine element separated from two aromatic residues (6). Each kelch motif is a four-stranded β-sheet that, along with the other Kelch motifs, folds into a conserved β-propeller structure to mediate protein-protein interactions with structural proteins, transcription factors, and viral proteins (6;7). Intra- and inter-blade loops protruding from above, below, or at the sides of the β-sheets contribute to the variability in the binding properties of the β-propellers (6;8). The structure is closed and stabilized by interactions between the first and last blades (9;10).

The cerulean mutation results in substitution of glutamine 197 for a premature stop codon (Q197*) in the KLHL6 protein; amino acid 197 is within the BACK domain.

Expression/Localization

KLHL6 is highly expressed in the spleen, with lower expression levels in the heart, brain, and pancreas. Little to no expression was detected in skeletal muscle and testis (11). A second study found that KLHL6 is highly expressed in germinal center B cells, with lower expression levels in the tonsil and thymus (1). KLHL6 is also expressed in germinal center-derived B-cell lymphomas; KLHL6 was not expressed in lymphomas of non-germinal center derivation (12).

Background

Figure 16. B cell ontogeny. Conventional B cell differentiation occurs in the bone marrow and spleen. In the bone marrow, development progresses from stem cells through the pro-B cell, pre-B cell and immature pre-B cell stages. Steps upstream of the pro-B stage are not shown for simplicity. Pre-BCR signaling is necessary for proliferation and further differentiation resulting in expression of a muture BCR that is capable of binding antigen. Cells successfully completing ths checkpoint leave the bone marrow and proceed through two transitional (T) stages before becoming mature follicular B cells or marginal-zone B cells. Loss of KLHL6 expression results in impaired transitional B cell survival and differentiation.

BTB-mediated protein-protein interactions promote several functions including transcription repression (13;14), cellular signaling, cell cycle regulation, regulation of skeletal muscle gene expression, cytoskeleton regulation (15;16), tetramerization and gating of ion channels (17), cell morphology, and protein ubiquitination/degradation [(6;18); reviewed in (2)]. BTB proteins are members of the Cul3 Skp1-Cullin-F-box (SCF)-like E3 ubiquitin ligase complex; the BTB proteins facilitate the recruitment of the substrate to Cul3 (19) Exogenous KLHL6 coimmunoprecipitates with Cul3 (20).

KLHL6 interacted with HBXIP in a yeast two-hybrid assay (20). HBXIP is a ubiquitously expressed protein that functions in cell proliferation, cytokinesis, cell survival, and mTORC1 activation. The functional significance of the KLHL6-HBXIP association is unknown, but the association does not promote HBXIP degradation (20).

KLHL6 has putative functions in B cell differentiation, BAFF (see the record for Frozen)-induced transitional B cell survival, B cell receptor-associated signal transduction, and germinal center responses [Figure 16; (1;20;21)]. Loss of KLHL6 expression results in impaired transitional B cell survival and differentiation (20). Klhl6-deficient (Klhl6^-/-) mice exhibited impaired B cell development past the immature stage, reduced numbers of B220+ and CD3- B cells in the spllen and peripheral blood, reduced numbers of follicular B cells in the lymph nodes, reduced spleen weight, spleen hypoplasia, impaired germinal center formation, and impaired memory IgG responses (21). Mice homozygous for an ENU-induced Klhl6 mutation (W267*) exhibited increased numbers of immature B cells, but reduced numbers of mature B cells (MGI).

Putative Mechanism

The phenotypes observed in the cerulean mice indicate loss of KLHL6^cerulean function. Although KLHL6 is known to have putative functions in B cell survival, B cell receptor-associated signal transduction, and germinal center responses (1;20;21), putative functions in T cells have not been noted. The role of KLHL6 in B cells is unknown, but it may contribute to cell proliferation and cell survival through interactions with proteins (e.g., HBXIP and Cul3).

Primers

PCR Primer
cerulean_pcr_F: ATCTCCACGAAGTACCACGG
cerulean_pcr_R: GGATGATCACTTTCTGGTCTGAC

Sequencing Primer
cerulean_seq_F: GTGGTAAACGCACATTCTCG
cerulean_seq_R: GATCACTTTCTGGTCTGACTTTCTTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 404 nucleotides is amplified (chromosome 16, - strand):

1   ggatgatcac tttctggtct gactttcttc ccttttgtta agtttttaca gctggtggat
61  gcctgtgcca gctttctcac agaagcattg aacccggaaa attgtattgg aatactgagg
121 ctggcagaca cacattcttt ggacagttta aagatgcaag tccaaagtta catcattcaa
181 aactttgttc agattctgaa ttccgaggag ttccttgaac ttcctgtgga cactttgtac
241 cacatcttga ggagtgacga cctgtgtgtg actgaagagg ctcaggtgtt tgagactgtg
301 atgagctggg tccggcacaa acaatcagaa cgactctgcc tgctcccttg tgtcctcgag
361 aatgtgcgtt taccacttct ggatccgtgg tacttcgtgg agat

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Gupta-Rossi, N., Storck, S., Griebel, P. J., Reynaud, C. A., Weill, J. C., and Dahan, A. (2003) Specific Over-Expression of Deltex and a New Kelch-Like Protein in Human Germinal Center B Cells. Mol Immunol. 39, 791-799.

  2. Stogios, P. J., Downs, G. S., Jauhal, J. J., Nandra, S. K., and Prive, G. G. (2005) Sequence and Structural Analysis of BTB Domain Proteins. Genome Biol. 6, R82.

  3. Perez-Torrado, R., Yamada, D., and Defossez, P. A. (2006) Born to Bind: The BTB Protein-Protein Interaction Domain. Bioessays. 28, 1194-1202.

  4. Siggs, O. M., and Beutler, B. (2012) The BTB-ZF Transcription Factors. Cell Cycle. 11, 3358-3369.

  5. Stogios, P. J., and Prive, G. G. (2004) The BACK Domain in BTB-Kelch Proteins. Trends Biochem Sci. 29, 634-637.

  6. Adams, J., Kelso, R., and Cooley, L. (2000) The Kelch Repeat Superfamily of Proteins: Propellers of Cell Function. Trends Cell Biol. 10, 17-24.

  7. Prag, S., and Adams, J. C. (2003) Molecular Phylogeny of the Kelch-Repeat Superfamily Reveals an Expansion of BTB/kelch Proteins in Animals. BMC Bioinformatics. 4, 42.

  8. Fulop, V., and Jones, D. T. (1999) Beta Propellers: Structural Rigidity and Functional Diversity. Curr Opin Struct Biol. 9, 715-721.

  9. Faber, H. R., Groom, C. R., Baker, H. M., Morgan, W. T., Smith, A., and Baker, E. N. (1995) 1.8 A Crystal Structure of the C-Terminal Domain of Rabbit Serum Haemopexin. Structure. 3, 551-559.

  10. Li, J., Brick, P., O'Hare, M. C., Skarzynski, T., Lloyd, L. F., Curry, V. A., Clark, I. M., Bigg, H. F., Hazleman, B. L., and Cawston, T. E. (1995) Structure of Full-Length Porcine Synovial Collagenase Reveals a C-Terminal Domain Containing a Calcium-Linked, Four-Bladed Beta-Propeller. Structure. 3, 541-549.

  11. Hattori, A., Okumura, K., Nagase, T., Kikuno, R., Hirosawa, M., and Ohara, O. (2000) Characterization of Long cDNA Clones from Human Adult Spleen. DNA Res. 7, 357-366.

  12. Kunder, C. A., Roncador, G., Advani, R. H., Gualco, G., Bacchi, C. E., Sabile, J. M., Lossos, I. S., Nie, K., Tibshirani, R. J., Green, M. R., Alizadeh, A. A., and Natkunam, Y. (2017) KLHL6 is Preferentially Expressed in Germinal Center-Derived B-Cell Lymphomas. Am J Clin Pathol. 148, 465-476.

  13. Ahmad, K. F., Melnick, A., Lax, S., Bouchard, D., Liu, J., Kiang, C. L., Mayer, S., Takahashi, S., Licht, J. D., and Prive, G. G. (2003) Mechanism of SMRT Corepressor Recruitment by the BCL6 BTB Domain. Mol Cell. 12, 1551-1564.

  14. Melnick, A., Ahmad, K. F., Arai, S., Polinger, A., Ball, H., Borden, K. L., Carlile, G. W., Prive, G. G., and Licht, J. D. (2000) In-Depth Mutational Analysis of the Promyelocytic Leukemia Zinc Finger BTB/POZ Domain Reveals Motifs and Residues Required for Biological and Transcriptional Functions. Mol Cell Biol. 20, 6550-6567.

  15. Kang, M. I., Kobayashi, A., Wakabayashi, N., Kim, S. G., and Yamamoto, M. (2004) Scaffolding of Keap1 to the Actin Cytoskeleton Controls the Function of Nrf2 as Key Regulator of Cytoprotective Phase 2 Genes. Proc Natl Acad Sci U S A. 101, 2046-2051.

  16. Bomont, P., Cavalier, L., Blondeau, F., Ben Hamida, C., Belal, S., Tazir, M., Demir, E., Topaloglu, H., Korinthenberg, R., Tuysuz, B., Landrieu, P., Hentati, F., and Koenig, M. (2000) The Gene Encoding Gigaxonin, a New Member of the Cytoskeletal BTB/kelch Repeat Family, is Mutated in Giant Axonal Neuropathy. Nat Genet. 26, 370-374.

  17. Minor, D. L., Lin, Y. F., Mobley, B. C., Avelar, A., Jan, Y. N., Jan, L. Y., and Berger, J. M. (2000) The Polar T1 Interface is Linked to Conformational Changes that Open the Voltage-Gated Potassium Channel. Cell. 102, 657-670.

  18. Kroll, J., Shi, X., Caprioli, A., Liu, H. H., Waskow, C., Lin, K. M., Miyazaki, T., Rodewald, H. R., and Sato, T. N. (2005) The BTB-Kelch Protein KLHL6 is Involved in B-Lymphocyte Antigen Receptor Signaling and Germinal Center Formation. Mol Cell Biol. 25, 8531-8540.

  19. Krek, W. (2003) BTB Proteins as Henchmen of Cul3-Based Ubiquitin Ligases. Nat Cell Biol. 5, 950-951.

  20. Bertocci, B., Lecoeuche, D., Sterlin, D., Kuhn, J., Gaillard, B., De Smet, A., Lembo, F., Bole-Feysot, C., Cagnard, N., Fadeev, T., Dahan, A., Weill, J. C., and Reynaud, C. A. (2017) Klhl6 Deficiency Impairs Transitional B Cell Survival and Differentiation. J Immunol. 199, 2408-2420.

  21. Kroll, J., Shi, X., Caprioli, A., Liu, H. H., Waskow, C., Lin, K. M., Miyazaki, T., Rodewald, H. R., and Sato, T. N. (2005) The BTB-Kelch Protein KLHL6 is Involved in B-Lymphocyte Antigen Receptor Signaling and Germinal Center Formation. Mol Cell Biol. 25, 8531-8540.