Phenotypic Mutation 'cerulean' (pdf version)
List |< first << previous [record 58 of 132] next >> last >|
Allelecerulean
Mutation Type nonsense
Chromosome16
Coordinate19,957,218 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Klhl6
Gene Name kelch-like 6
Chromosomal Location 19,946,496-19,983,037 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_183390; MGI:2686922

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000053023] [ENSMUSP00000130755]
SMART Domains Protein: ENSMUSP00000053023
Gene: ENSMUSG00000043008
AA Change: Q197*

DomainStartEndE-ValueType
BTB 70 167 1.43e-25 SMART
BACK 172 274 1.68e-35 SMART
Kelch 376 419 3.05e-1 SMART
Kelch 420 466 6.82e-11 SMART
Kelch 467 514 4.27e-3 SMART
Kelch 515 556 3.06e-4 SMART
Kelch 557 604 3.47e-3 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000130755
Gene: ENSMUSG00000043008

DomainStartEndE-ValueType
Pfam:BTB 60 98 1.2e-9 PFAM
Predicted Effect noncoding transcript
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased 16166635
FACS B:T cells - decreased
FACS B1 cells - increased
FACS B220 MFI - decreased
FACS CD4:CD8 - increased
FACS CD4+ T cells - increased
FACS CD4+ T cells in CD3+ T cells - increased
FACS CD44+ CD4 MFI - decreased
FACS CD8+ T cells - increased
FACS CD8+ T cells in CD3+ T cells - decreased
FACS central memory CD4 T cells in CD4 T cells - decreased
FACS IgM+ B cells - decreased 16166635
FACS T cells - increased
total IgE level - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (ENU)(1) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Klhl6 APN 16 19957062 missense probably benign 0.00
IGL01465:Klhl6 APN 16 19982822 missense probably damaging 0.98
IGL01831:Klhl6 APN 16 19953485 missense probably damaging 1.00
IGL01971:Klhl6 APN 16 19949526 missense probably damaging 0.99
IGL02532:Klhl6 APN 16 19957082 missense possibly damaging 0.84
IGL03113:Klhl6 APN 16 19957251 missense possibly damaging 0.68
IGL03290:Klhl6 APN 16 19947137 missense probably benign 0.44
blossom UTSW 16 19957139 missense probably damaging 1.00
Parula UTSW 16 19957043 missense
IGL03046:Klhl6 UTSW 16 19982889 missense probably benign
R0265:Klhl6 UTSW 16 19948234 missense probably benign 0.43
R0496:Klhl6 UTSW 16 19956966 frame shift probably null
R0497:Klhl6 UTSW 16 19956966 frame shift probably null
R0540:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0541:Klhl6 UTSW 16 19949447 splice site probably null
R0554:Klhl6 UTSW 16 19953593 missense probably damaging 0.96
R0607:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0636:Klhl6 UTSW 16 19948073 splice site probably benign
R0670:Klhl6 UTSW 16 19949559 missense possibly damaging 0.92
R1477:Klhl6 UTSW 16 19965977 missense probably benign 0.00
R1510:Klhl6 UTSW 16 19947098 missense probably damaging 1.00
R1547:Klhl6 UTSW 16 19966082 missense probably benign
R1747:Klhl6 UTSW 16 19947028 missense probably benign 0.40
R1871:Klhl6 UTSW 16 19957043 missense possibly damaging 0.56
R1966:Klhl6 UTSW 16 19982822 missense probably damaging 0.98
R2058:Klhl6 UTSW 16 19982931 missense probably benign
R4466:Klhl6 UTSW 16 19957268 missense probably damaging 0.99
R4645:Klhl6 UTSW 16 19947147 missense probably damaging 1.00
R4690:Klhl6 UTSW 16 19957284 missense probably benign 0.44
R4824:Klhl6 UTSW 16 19957028 missense probably damaging 0.98
R4833:Klhl6 UTSW 16 19957139 missense probably damaging 1.00
R4835:Klhl6 UTSW 16 19957033 missense probably benign 0.07
R5001:Klhl6 UTSW 16 19946991 makesense probably null
R5475:Klhl6 UTSW 16 19948127 missense probably damaging 1.00
R5700:Klhl6 UTSW 16 19957218 nonsense probably null
R5867:Klhl6 UTSW 16 19982820 missense probably benign 0.37
R5910:Klhl6 UTSW 16 19957094 missense probably benign 0.04
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2018-07-20 9:54 AM by Anne Murray
Record Created 2018-01-19 7:22 AM by Xue Zhong
Record Posted 2018-07-20
Phenotypic Description
Figure 1. Cerulean mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Cerulean mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Cerulean mice exhibit reduced frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Cerulean mice exhibit reduced frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Cerulean mice exhibit increased CD4+ to CD8+ T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Cerulean mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Cerulean mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Cerulean mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Cerulean mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Cerulean mice exhibit reduced frequencies of peripheral central memory CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Cerulean mice exhibit reduced frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Cerulean mice exhibit reduced expression of CD44 on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Cerulean mice exhibit reduced expression of B220 on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The cerulean phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5700, some of which showed a decrease in the B to T cell ratio (Figure 1) caused by an increase in the T cell frequency (Figure 2) coupled with reduced frequencies of B cells (Figure 3) and IgM+ B cells (Figure 4). Some mice also showed an increase in the CD4+ to CD8+ T cell ratio (Figure 5), increased frequencies of CD4+ T cells (Figure 6), CD4+ T cells in CD3+ T cells (Figure 7), CD8+ T cells (Figure 8), and B1 cells (Figure 9) coupled with reduced frequencies of central memory CD4+ T cells in CD4+ T cells (Figure 10) and CD8+ T cells in CD3+ T cells (Figure 11), all in the peripheral blood. The CD44 mean fluorescence intensity on peripheral blood CD4+ T cells was reduced (Figure 12). The B220 mean fluorescence intensity on peripheral blood B cells was reduced (Figure 13)

Nature of Mutation

Figure 14. Linkage mapping of the CD4+ T cell frequency phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 51 mutations (X-axis) identified in the G1 male of pedigree R5700. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 51 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Klhl6:  a C to T transition at base pair 19,957,218 (v38) on chromosome 16, or base pair 25,832 in the GenBank genomic region NC_000082 encoding Klhl6. The strongest association was found with a recessive model of inheritance to the normalized frequency of CD4+ T cells, wherein 12 variant homozygotes departed phenotypically from 29 homozygous reference mice and 37 heterozygous mice with a P value of 8.965 x 10-20 (Figure 14).  A substantial semidominant effect was observed in several assays, but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 635 in the mRNA sequence NM_183390 within exon 3 of 7 total exons.


 

620 CAAAGTTACATCATTCAAAACTTTGTTCAGATT

192 -Q--S--Y--I--I--Q--N--F--V--Q--I-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of glutamine 197 for a premature stop codon (Q197*) in the KLHL6 protein.

Protein Prediction
Figure 15. Domain structure of the KLHL6 protein. KLHL6 is a member of the Kelch-like family. The cerulean mutation (Q197*) is indicated. Please see the text for more details about these domains. BTB, Broad-complex, Tramtrack and Bric à brac domain; BACK, BTB and C-terminal kelch domain. The image is interactive. Additional mutations found in KLHL6 are noted. Click each mutation to view more information. Domain information is from SMART and UniProt.

KLHL6 is a member of the Kelch-like family of proteins (see the record for teeny for information about KBTBD2, another Kelch-like family member). Similar to other Kelch-like family members, KLHL6 has a Bric-a-brac, Tramtrack, Broad-complex (BTB) domain at the N-terminus, a BACK domain, and a kelch repeat region at the C-terminus (KLHL6 has five or six kelch repeats) (1).

 

BTB domains are often associated with other domains including C2H2 zinc finger (for information about a member of the BTB-zinc finger (BTB-ZF) family, ZBTB1, please see the record for scanT) and kelch domains. The BTB domain promotes protein-protein interactions including homodimerization and heterodimerization with non-BTB proteins (e.g., transcriptional corepressors and the E3 ligase Cullin 3 (Cul3)) [(2;3); reviewed in (4)]. The ~120-amino acid BTB domains have a common 95-amino acid region, the BTB fold, that consists of a cluster of five α-helices (A1–A5) made up, in part, of two α-helical hairpins (A1/A2 and A4/A5), and capped at one end by a short solvent-exposed three stranded β-sheet (B1/B2/B3) (2). Another hairpin-like motif comprised of A3 and an extended region links the B1/B2/A1/A2/B3 and A4/A5 segments of the fold (2). Although the overall structure of the BTB fold is shared among the BTB-containing proteins, the oligomerization or protein-protein interaction states of the proteins involve different surface-exposed residues (2).

 

Most of the BTB-kelch proteins also contain a highly conserved BACK domain (2;5). The BACK domain is ~130 amino acids, with highest conservation within the first 70 residues immediately following the BTB domain (5). The BACK domains contain a conserved N-terminal Asn-Cys-Leu-Gly-Ile sequence, a Val-Arg-[Leu/Met/Phe]-Pro-Leu-Leu sequence, two arginine residues and four glutamic acids; most of the conserved amino acids are non-polar, indicating that the BACK domain contains a hydrophobic core (5). The functional role of the BACK domain is unknown (5).  

 

Kelch motifs are 44 to 56 amino acids in length. Kelch motifs have conserved motifs including four hydrophobic residues followed by a double glycine element separated from two aromatic residues (6). Each kelch motif is a four-stranded β-sheet that, along with the other Kelch motifs, folds into a conserved β-propeller structure to mediate protein-protein interactions with structural proteins, transcription factors, and viral proteins (6;7). Intra- and inter-blade loops protruding from above, below, or at the sides of the β-sheets contribute to the variability in the binding properties of the β-propellers (6;8). The structure is closed and stabilized by interactions between the first and last blades (9;10).

 

The cerulean mutation results in substitution of glutamine 197 for a premature stop codon (Q197*) in the KLHL6 protein; amino acid 197 is within the BACK domain.

Expression/Localization

KLHL6 is highly expressed in the spleen, with lower expression levels in the heart, brain, and pancreas. Little to no expression was detected in skeletal muscle and testis (11). A second study found that KLHL6 is highly expressed in germinal center B cells, with lower expression levels in the tonsil and thymus (1). KLHL6 is also expressed in germinal center-derived B-cell lymphomas; KLHL6 was not expressed in lymphomas of non-germinal center derivation (12).

Background
Figure 16. B cell ontogeny. Conventional B cell differentiation occurs in the bone marrow and spleen. In the bone marrow, development progresses from stem cells through the pro-B cell, pre-B cell and immature pre-B cell stages. Steps upstream of the pro-B stage are not shown for simplicity. Pre-BCR signaling is necessary for proliferation and further differentiation resulting in expression of a muture BCR that is capable of binding antigen. Cells successfully completing ths checkpoint leave the bone marrow and proceed through two transitional (T) stages before becoming mature follicular B cells or marginal-zone B cells. Loss of KLHL6 expression results in impaired transitional B cell survival and differentiation.

BTB-mediated protein-protein interactions promote several functions including transcription repression (13;14), cellular signaling, cell cycle regulation, regulation of skeletal muscle gene expression, cytoskeleton regulation (15;16), tetramerization and gating of ion channels (17), cell morphology, and protein ubiquitination/degradation [(6;18); reviewed in (2)]. BTB proteins are members of the Cul3 Skp1-Cullin-F-box (SCF)-like E3 ubiquitin ligase complex; the BTB proteins facilitate the recruitment of the substrate to Cul3 (19) Exogenous KLHL6 coimmunoprecipitates with Cul3 (20).

 

KLHL6 interacted with HBXIP in a yeast two-hybrid assay (20). HBXIP is a ubiquitously expressed protein that functions in cell proliferation, cytokinesis, cell survival, and mTORC1 activation. The functional significance of the KLHL6-HBXIP association is unknown, but the association does not promote HBXIP degradation (20).

 

KLHL6 has putative functions in B cell differentiation, BAFF (see the record for Frozen)-induced transitional B cell survival, B cell receptor-associated signal transduction, and germinal center responses [Figure 16; (1;20;21)]. Loss of KLHL6 expression results in impaired transitional B cell survival and differentiation (20). Klhl6-deficient (Klhl6-/-) mice exhibited impaired B cell development past the immature stage, reduced numbers of B220+ and CD3- B cells in the spllen and peripheral blood, reduced numbers of follicular B cells in the lymph nodes, reduced spleen weight, spleen hypoplasia, impaired germinal center formation, and impaired memory IgG responses (21). Mice homozygous for an ENU-induced Klhl6 mutation (W267*) exhibited increased numbers of immature B cells, but reduced numbers of mature B cells (MGI).

Putative Mechanism

The phenotypes observed in the cerulean mice indicate loss of KLHL6cerulean function. Although KLHL6 is known to have putative functions in B cell survival, B cell receptor-associated signal transduction, and germinal center responses (1;20;21), putative functions in T cells have not been noted. The role of KLHL6 in B cells is unknown, but it may contribute to cell proliferation and cell survival through interactions with proteins (e.g., HBXIP and Cul3).

Primers PCR Primer
cerulean(F):5'- ATCTCCACGAAGTACCACGG -3'
cerulean(R):5'- GGATGATCACTTTCTGGTCTGAC -3'

Sequencing Primer
cerulean_seq(F):5'- GTGGTAAACGCACATTCTCG -3'
cerulean_seq(R):5'- GATCACTTTCTGGTCTGACTTTCTTC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Xue Zhong, Evan Nair-Gill, Jianhui Wang, Bruce Beutler
List |< first << previous [record 58 of 132] next >> last >|