Phenotypic Mutation 'two-tone'

• Allele: two-tone
• Mutation Type: missense
• Chromosome: 10
• Coordinate: 58,439,001 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Edar
• Gene Name: ectodysplasin-A receptor
• Chromosomal Location: 58,436,611-58,511,476 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor family. The encoded transmembrane protein is a receptor for the soluble ligand ectodysplasin A, and can activate the nuclear factor-kappaB, JNK, and caspase-independent cell death pathways. It is required for the development of hair, teeth, and other ectodermal derivatives. Mutations in this gene result in autosomal dominant and recessive forms of hypohidrotic ectodermal dysplasia. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mutations in this gene produce abnormalities of the hair,teeth and some exocrine glands. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000003312]
• AlphaFold: Q9R187
• SMART Domains: Protein: ENSMUSP00000003312; Gene: ENSMUSG00000003227; AA Change: S344C

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Blast:TNFR	31	71	2e-16	BLAST
SCOP:d1jmab1	31	91	2e-3	SMART
Blast:TNFR	74	113	5e-20	BLAST
low complexity region	149	169	N/A	INTRINSIC
transmembrane domain	188	210	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
SCOP:d1ngr__	348	430	2e-4	SMART
low complexity region	439	448	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000003312)
• Meta Mutation Damage Score: 0.3015
• Is this an essential gene?: Probably nonessential (E-score: 0.187)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:38 PM by Anne Murray
• Record Created: 2018-02-09 2:20 PM by Jamie Russell
• Record Posted: 2018-08-27
• Science Writers: Anne Murray
• Authors: Jami Keef, Lauren Prince, Jamie Russell, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010100; MGI: 1343498

Alleles Listed at MGI

All Mutations and Alleles(14) : Chemically induced (ENU)(2) Chemically induced (other)(1) Radiation induced(1) Spontaneous(4) Targeted(4) Transgenic(2)

Phenotypic Description

Figure 1. The two-tone mice showed tan specs on the back and collar area.

Figure 2. The two-tone mice showed hair loss around their ears.

The two-tone phenotype was identified among G3 mice of the pedigree R5847, some of which showed tan specs on the back and collar area (Figure 1). The mice also show hair loss around their ears (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the pigmentation/hair loss phenotypes using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 55 mutations (X-axis) identified in the G1 male of pedigree R5847. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 55 mutations. Both of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 10: Edar and Pbld1. The mutation in Edar was presumed causative because the hair loss and pigmentation phenotypes are similar to that of other Edar mutant alleles (see MGI for a list of Edar alleles). The mutation Edar is an A to T transversion at base pair 58,603,179 (v38) on chromosome 10, or base pair 72,518 in the GenBank genomic region NC_000076.6. Linkage was found with a recessive model of inheritance (P = 3.294 x 10^-8), wherein seven affected mice were homozygous for the variant allele, and 39 unaffected mice were either heterozygous (N = 19) or homozygous for the reference allele (N = 17) (Figure 3); genotyping failed for three unaffected mice.  

The mutation corresponds to residue 1,289 in the mRNA sequence NM_010100 within exon 12 of 12 total exons.

1274 GTTGTTGAAGGTCTCAGCCCCACCGAGTTGCCG 339  -V--V--E--G--L--S--P--T--E--L--P-

The mutated nucleotide is indicated in red. The mutation results in a serine to cysteine substitution at position 344 (S344C) in the EDAR protein, and is strongly predicted by Polyphen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 4. Domain structure of EDAR. Following the cleavable signal peptide (SP), the 159 amino acid extracellular domain contains 14 cysteine residues (blue lines) in a sequence with similarity to the extracellular domain of TNFR. The transmembrane domain (TM) is followed by a 237 amino acid intracellular region containing a death domain (DD). The two-tone mutation results in a serine to cysteine substitution at position 344 in the EDAR protein. Other mutations found in EDAR are also noted. Click on the mutation to view more information.

The EDAR protein consists of 448 amino acids, and belongs to the tumor necrosis factor receptor (TNFR) superfamily (1). Mouse EDAR is a type I transmembrane protein (extracellular N terminus), containing a cleavable signal peptide at the N terminus, followed by a 159 amino acid TNFR-like extracellular domain. The extracellular domain, responsible for ligand binding, contains 14 cysteine residues residing in three cysteine-rich domains (CRDs) similar to those of TNFR (1;2). The 237 amino acid intracellular region of EDAR contains a segment near the C-terminus with homology to the death domain of TNFR and other TNFR-like proteins (1;2). The death domain was first identified in proteins involved in cell death induction, but it is now known to function as a protein-protein interaction domain that mediates homotypic interactions with other death domain-containing proteins in order to propagate signaling. In the case of EDAR, it does not seem to connect to the apoptotic machinery.

The two-tone mutation is a serine to cysteine substitution at position 344 (S344C). This residue is located just N terminal to the death domain.

For more information about Edar, see the record for achtung2.

Putative Mechanism

The four mutant mouse phenotypes Tabby (Tb), downless (dl), Sleek (Sl) and crinkled (cr), first reported in the 1950s, are characterized by lack of hair on the tail and behind the ears, lack of or abnormal morphology of incisors, a reduced number of vibrissae, and occasionally a kinked tail tip [(3-5) and reviewed in (6)]. Further study demonstrated that sweat glands (normally on the footpads), lacrimal, Meibomian and submandibular glands, and three of four types of mouse hair, are lacking in these mutants (6). Human patients also develop a similar syndrome, hypohidrotic (or anhidrotic) ectodermal dysplasia (HED), which may be transmitted in an autosomal dominant (OMIM #129490), autosomal recessive (OMIM #224900), or X-linked recessive (OMIM #305100) manner. Humans with HED typically have missing or sparse hair, missing or misshapen teeth, and absent or reduced ability to sweat. The reduced ability to sweat can cause hyperthermia, and results in a 30% mortality rate in children up to age 2 if the condition is not recognized (7). HED patients also have dry skin, eyes, airways and mucous membranes. Recently, ocular surface abnormalities (corneal lesions, inflammation) likely due to a lack of Meibomian glands were reported in both human HED patients and in Tabby mice (8;9).

Mutations in EDA (10), EDAR (2) and EDARADD (11) are now known to cause HED in humans, as well as the Tb (12;13), dl or Sl (1), and cr (11;14) phenotypes, respectively, when the orthologous genes are mutated in mice. Mutations in EDAR account for approximately 25% of cases, and can cause both autosomal dominant or recessive forms of HED (15;16).

EDA (ectodysplasin), EDAR and EDARADD (EDAR-associated death domain) form the ligand, receptor and adaptor proteins, respectively, of a TNF-related signaling pathway specific to the development of so-called skin appendages, ectoderm-derived tissues including hair follicles, nails, teeth and exocrine glands in mammals. Signaling from EDAR is mediated by the TRAF6/TAK1/TAB2 complex, and ultimately activates NF-κB to stimulate gene transcription. EDA binds to EDAR as a trimer, leading to the recruitment of its specific adapter, EDARADD, through receptor/adapter death domain interactions (11). EDARADD recruits a complex containing TRAF6, TAB2, and TAK1. The TRAF6/TAK1/TAB2 complex activates the IKK complex to phosphorylate IκB, which then releases NF-κB for translocation to the nucleus and activation of gene expression (11;17-19). The downstream targets of EDAR signaling are reported to include proteins of the Wnt, Sonic hedgehog (Shh), bone morphogenetic protein (BMP) and lymphotoxin- β (LTβ) pathways, which were identified by comparative gene expression analysis of Tabby and wild type skin [reviewed in (20)]. The specific role of these pathways in skin appendage development and the mechanisms by which they interface with EDAR signaling not well understood.

The two-tone mutation results in a serine to cysteine substitution at position 344. This residue is located just outside the death domain (aa ~356-431) (1). The two-tone mutation may disrupt folding of the death domain, which could prevent recruitment and subsequent signaling by EDARADD. Several EDAR mutations causing HED in humans or mice disrupt the function of the death domain. For example, the dl mutation is an E to K point mutation of residue 379, within the death domain, and the Sl mutation truncates EDAR just before the death domain (1). It appears that most HED-causing mutations in human EDAR occur within either the death domain or the ligand binding domain (2;15). Two Edar mouse mutants showed aberrant pigmentation, namely darkened and greasy coats (on the C3H3B/FeJ (21) and 101/H* C3H/HeH (MGI) genetic backgrounds). The connection between EDAR signaling and pigmentation was not discussed.

Primers

PCR Primer
two-tone_pcr_F: TGCGGTCAAAGAGCTGCATG
two-tone_pcr_R: GCAGTGTACTAGCTCTGGACTTAAC

Sequencing Primer
two-tone_seq_F: AGCTGCATGCCATCAGTCATG
two-tone_seq_R: CGTTGACTTTTGAATACCGAACCAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 505 nucleotides is amplified (chromosome 10, - strand):

1   gcagtgtact agctctggac ttaacatcaa agtcacgttg acttttgaat accgaaccag
61  aactatacat ccctagaata aatgtcactt gtagtaaata attctctgtt ctattgttca
121 attctatttg ttaatatttt gttaagaata ttgattgttc ttggtctagt tttgatatca
181 gattcggaaa tatttccttc ttttctattt tctggaagag actatttagg acttccatta
241 attctttgag tacttactcg atgtgtacta ttgagctccc attgagcttc catttgtgac
301 atgtaattct gaccaattcc tctcttaggt ctcagcccca ccgagttgcc gtttgactgc
361 cttgagaaga caagccgaat gctcagctct acatacaact ctgagaaggc ggtcgtgaaa
421 acatggcgcc accttgccga gagctttgga ctgaagaggg atgagattgg gggcatgact
481 gatggcatgc agctctttga ccgca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

   1.  Headon, D. J. and Overbeek, P. A. (1999) Involvement of a novel Tnf receptor homologue in hair follicle induction, Nat. Genet. 22, 370-374.

   2.  Monreal, A. W., Ferguson, B. M., Headon, D. J., Street, S. L., Overbeek, P. A., and Zonana, J. (1999) Mutations in the human homologue of mouse dl cause autosomal recessive and dominant hypohidrotic ectodermal dysplasia, Nat. Genet. 22, 366-369.

   3.  Falconer, D. S. (1952) A totally sex-linked gene in the house mouse, Nature 169, 664-665.

 4.  Phillips, R. J. S. (1960) New mutant, Mouse News Lett 23, 29-30.

 5.  Sofaer, J. A. (1969) Aspects of the tabby-crinkled-downless syndrome. II. Observations on the reaction to changes of genetic background, J Embryol. Exp. Morphol. 22, 207-227.

   6.  Mikkola, M. L. and Thesleff, I. (2003) Ectodysplasin signaling in development, Cytokine Growth Factor Rev. 14, 211-224.

 7.  Clarke, A., Phillips, D. I., Brown, R., and Harper, P. S. (1987) Clinical aspects of X-linked hypohidrotic ectodermal dysplasia, Arch. Dis. Child 62, 989-996.

 8.  Kaercher, T. (2004) Ocular symptoms and signs in patients with ectodermal dysplasia syndromes, Graefes Arch. Clin. Exp. Ophthalmol. 242, 495-500.

 9.  Cui, C. Y., Smith, J. A., Schlessinger, D., and Chan, C. C. (2005) X-linked anhidrotic ectodermal dysplasia disruption yields a mouse model for ocular surface disease and resultant blindness, Am. J Pathol. 167, 89-95.

 10.  Kere, J., Srivastava, A. K., Montonen, O., Zonana, J., Thomas, N., Ferguson, B., Munoz, F., Morgan, D., Clarke, A., Baybayan, P., Chen, E. Y., Ezer, S., Saarialho-Kere, U., de la, C. A., and Schlessinger, D. (1996) X-linked anhidrotic (hypohidrotic) ectodermal dysplasia is caused by mutation in a novel transmembrane protein, Nat. Genet. 13, 409-416.

 11.  Headon, D. J., Emmal, S. A., Ferguson, B. M., Tucker, A. S., Justice, M. J., Sharpe, P. T., Zonana, J., and Overbeek, P. A. (2001) Gene defect in ectodermal dysplasia implicates a death domain adapter in development, Nature 414, 913-916.

 12.  Srivastava, A. K., Pispa, J., Hartung, A. J., Du, Y., Ezer, S., Jenks, T., Shimada, T., Pekkanen, M., Mikkola, M. L., Ko, M. S., Thesleff, I., Kere, J., and Schlessinger, D. (1997) The Tabby phenotype is caused by mutation in a mouse homologue of the EDA gene that reveals novel mouse and human exons and encodes a protein (ectodysplasin-A) with collagenous domains, Proc. Natl. Acad. Sci. U. S. A 94, 13069-13074.

 13.  Ferguson, B. M., Brockdorff, N., Formstone, E., Ngyuen, T., Kronmiller, J. E., and Zonana, J. (1997) Cloning of Tabby, the murine homolog of the human EDA gene: evidence for a membrane-associated protein with a short collagenous domain, Hum. Mol. Genet. 6, 1589-1594.

 14.  Yan, M., Zhang, Z., Brady, J. R., Schilbach, S., Fairbrother, W. J., and Dixit, V. M. (2002) Identification of a novel death domain-containing adaptor molecule for ectodysplasin-A receptor that is mutated in crinkled mice, Curr. Biol. 12, 409-413.

 15.  Chassaing, N., Bourthoumieu, S., Cossee, M., Calvas, P., and Vincent, M. C. (2006) Mutations in EDAR account for one-quarter of non-ED1-related hypohidrotic ectodermal dysplasia, Hum. Mutat. 27, 255-259.

 16.  van der Hout, A. H., Oudesluijs, G. G., Venema, A., Verheij, J. B., Mol, B. G., Rump, P., Brunner, H. G., Vos, Y. J., and van Essen, A. J. (2008) Mutation screening of the Ectodysplasin-A receptor gene EDAR in hypohidrotic ectodermal dysplasia, Eur. J Hum. Genet.

 17.  Morlon, A., Munnich, A., and Smahi, A. (2005) TAB2, TRAF6 and TAK1 are involved in NF-kappaB activation induced by the TNF-receptor, Edar and its adaptator Edaradd, Hum. Mol. Genet. 14, 3751-3757.

 18.  Doffinger, R., Smahi, A., Bessia, C., Geissmann, F., Feinberg, J., Durandy, A., Bodemer, C., Kenwrick, S., Dupuis-Girod, S., Blanche, S., Wood, P., Rabia, S. H., Headon, D. J., Overbeek, P. A., Le, D. F., Holland, S. M., Belani, K., Kumararatne, D. S., Fischer, A., Shapiro, R., Conley, M. E., Reimund, E., Kalhoff, H., Abinun, M., Munnich, A., Israel, A., Courtois, G., and Casanova, J. L. (2001) X-linked anhidrotic ectodermal dysplasia with immunodeficiency is caused by impaired NF-kappaB signaling, Nat. Genet. 27, 277-285.

 19.  Schmidt-Ullrich, R., Tobin, D. J., Lenhard, D., Schneider, P., Paus, R., and Scheidereit, C. (2006) NF-kappaB transmits Eda A1/EdaR signalling to activate Shh and cyclin D1 expression, and controls post-initiation hair placode down growth, Development 133, 1045-1057.

   20.  Cui, C. Y. and Schlessinger, D. (2006) EDA signaling and skin appendage development, Cell Cycle 5, 2477-2483.

21. Green, M.C., Durham, D., Mayer, T.C., and Hoppe, P.C. (1977) Evidence from chimaeras for the pattern of proliferation of epidermis in the mouse, Genet. Res. 29, 279-284.