Phenotypic Mutation 'sunrise2' (pdf version)
List |< first << previous [record 76 of 132] next >> last >|
Allelesunrise2
Mutation Type nonsense
Chromosome7
Coordinate19,809,634 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Bcl3
Gene Name B cell leukemia/lymphoma 3
Synonym(s) Bcl-3
Chromosomal Location 19,808,462-19,822,770 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking functional copies of this gene exhibit defects of the immune system including disruption of the humoral immune response and abnormal spleen and Peyer's patch organogenesis. Mutant mice show increased susceptibility to pathogens. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_033601; MGI:88140

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000113851] [ENSMUSP00000117754]
SMART Domains Protein: ENSMUSP00000113851
Gene: ENSMUSG00000053175
AA Change: Y302*

DomainStartEndE-ValueType
ANK 129 162 4.01e0 SMART
ANK 166 195 4.43e-2 SMART
ANK 199 230 8.99e-3 SMART
ANK 236 265 3.23e-4 SMART
ANK 270 299 5.79e-6 SMART
ANK 303 332 1.4e1 SMART
low complexity region 377 402 N/A INTRINSIC
low complexity region 425 447 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000117754
Gene: ENSMUSG00000053175
AA Change: Y10*

DomainStartEndE-ValueType
Pfam:Ank_5 1 52 7.2e-7 PFAM
low complexity region 85 94 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000116129
Gene: ENSMUSG00000053175

DomainStartEndE-ValueType
ANK 66 99 4.01e0 SMART
ANK 103 132 4.43e-2 SMART
Predicted Effect noncoding transcript
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1 cells - increased
FACS CD4:CD8 - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - increased
FACS IgD MFI - decreased
FACS IgM MFI - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(49) : Gene trapped(38) Targeted(11)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Bcl3 APN 7 19809614 missense probably damaging 1.00
IGL01669:Bcl3 APN 7 19812491 nonsense probably null
IGL03024:Bcl3 APN 7 19809134 splice site probably benign
sunrise UTSW 7 19811580 nonsense probably null
R0124:Bcl3 UTSW 7 19809651 missense probably damaging 1.00
R0136:Bcl3 UTSW 7 19809569 missense probably damaging 1.00
R0554:Bcl3 UTSW 7 19820066 missense probably benign 0.26
R1845:Bcl3 UTSW 7 19809627 missense probably damaging 0.98
R2571:Bcl3 UTSW 7 19809527 missense probably damaging 1.00
R4355:Bcl3 UTSW 7 19811580 nonsense probably null
R4597:Bcl3 UTSW 7 19812503 missense probably damaging 0.97
R4993:Bcl3 UTSW 7 19820177 missense probably benign 0.00
R5587:Bcl3 UTSW 7 19809634 nonsense probably null
R6232:Bcl3 UTSW 7 19812484 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2018-04-04 3:18 PM by Anne Murray
Record Created 2018-03-09 8:27 AM by Anne Murray
Record Posted 2018-04-04
Phenotypic Description

Figure 1. Sunrise2 mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Sunrise2 mice exhibit reduced CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Sunrise2 mice exhibit reduced frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Sunrise2 mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Sunrise2 mice exhibit reduced IgD expression on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Sunrise2 mice exhibit increased IgM expression on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The sunrise2 phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R5587, some of which showed increased frequencies of B1 cells (Figure 1) as well as a reduced CD4 to CD8 T cell ratio (Figure 2) due to reduced frequencies of CD4+ T cells in CD3+ T cells (Figure 3) and increased frequencies of CD8+ T cells in CD3+ T cells (Figure 4), all in the peripheral blood. Expression of IgD (Figure 5) was reduced, and expression of IgM (Figure 1) was increased on peripheral blood B cells.

Nature of Mutation

Figure 7. Linkage mapping of the reduced IgD expression on periperal blood B cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 85 mutations (X-axis) identified in the G1 male of pedigree R5587. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 85 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Bcl3:  a T to A transversion at base pair 19,809,634 (v38) on chromosome 7, or base pair 13,134 in the GenBank genomic region NC_000073. The strongest association was found with a recessive model of inheritance to the normalized IgD expression on peripheral B cells, wherein 2 variant homozygotes departed phenotypically from 11 homozygous reference mice and 21 heterozygous mice with a P value of 1.084 x 10-8 (Figure 7).  

 

The mutation corresponds to residue 984 in the mRNA sequence NM_033601 within exon 7 of 9 total exons.

 

967 GTGAACGCTCAGATGTATTCTGGCAGCTCGGCT
297 -V--N--A--Q--M--Y--S--G--S--S--A-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of tyrosine 302 for a premature stop codon (Y302*) in the Bcl-3 protein.

Protein Prediction
Figure 8. Domain organization of Bcl-3. Bcl-3 has seven ankyrin repeats, a proline-rich N-terminal domain and a serine/proline-rich C-terminal domain. The sunrise2 mutation results in substitution of tyrosine 302 for a premature stop codon (Y302*). Other mutations found in Bcl-3 are noted in red. Click on the mutations to view more information.

Bcl-3 (B cell leukemia-3) is a member of the atypical subfamily of the IκB family. The atypical IκB molecules are not degraded following NF-κB pathway activation and are localized primarily in the nucleus where they interact with NF-κB dimers to regulate transcription. IκB family members share a common feature: multiple ankyrin repeats. Bcl-3 has seven ankyrin repeats, a proline-rich N-terminal domain and a serine/proline-rich C-terminal domain (1). The ankyrin repeats mediate the interaction with the NF-κB subunit, p50 (2;3).

 

The sunrise2 mutation results in substitution of tyrosine 302 for a premature stop codon (Y302*); residue 302 is within an undefined region between the fifth and sixth ankyrin repeat domains.

 

Please see the record sunrise for more information about Bcl3.

Putative Mechanism

The NF-κB family of transcription factors consists of the evolutionary conserved proteins p65/RelA, c-Rel, RelB, p50 and p52 (derived from the p100 precursor; see the record for 4;5); reviewed in (6;7)]. Bcl-3 regulates both classical and non-canonical NF-κB signaling by selectively interacting with p50 and p52 homodimers, but not inhibiting DNA binding (8-11). Bcl-3-mediated suppression of the classical NF-κB signaling pathway is context- and/or stimulus-dependent. In noncanonical NF-κB signaling, Bcl-3 putatively acts as an adaptor that recruits nuclear coactivator and corepressors complexes to the p50/p52 homodimers (12). Bcl-3 enhances p50 homodimer binding to target DNA in thymocytes (13). In bone marrow-derived macrophages, Bcl-3 stabilizes DNA-bound p50 homodimers by inhibiting p50 ubiquitination and degradation (14). During Toll-like receptor and TNF receptor signaling, Bcl-3-stabilized p50 homodimers can block NF-κB target sites in the DNA, subsequently preventing the binding of active dimers to the DNA and gene transcription (14). Please see the records xander and Finlay for additional details about NF-κB signaling.

 

Bcl3−/− mice are overtly normal and were born at the expected Mendelian frequency (15). The Bcl3−/− mice exhibited a reduced B to T cell ratio in the spleen, blood, and lymph nodes (15). The Bcl3−/− mice lacked germinal centers with the B cell follicular areas before and after challenge with influenza virus and with the parasite . However, after exposure to TNP–keyhole limpet hemocyanin (TNP-KLH) antigen absorbed in alum, the Bcl3−/− mice showed some PNA-stained cell clusters indicative of germinal center B cells, albeit at lower numbers then that in wild-type littermates. After infection with the T-dependent antigen, influenza, the Bcl3−/− mice exhibited a reduced IgG2a antibody response, and other antibody isotypes were not significantly generated. The microarchitecture of the B cell follicular zones in the Bcl3−/− mice were less well organized, although the T cell zones of the spleen were normal. In the marginal zone of the spleen, the number of marginal metallophilic macrophages and marginal zone macrophages were reduced in the Bcl3−/− mice compared to that in wild-type littermates. Expression of cell surface markers CD4, CD8, B220, IgM, Igκ, Igλ, TCRαβ, TCRγδ, IL-2Rα, HAS, CD43, BP1, Mac1, and Gr1 were comparable between Bcl3−/− and wild-type mice indicating that B and T cell subsets in the Bcl3−/− mice were normal (16). Similar to Bcl3−/− mice, the mice exhibited immune defects indicative of diminished Bcl-3sunrise2 function.

Primers PCR Primer
sunrise2(F):5'- TTGTTACCTTGCCGGCCTAAG -3'
sunrise2(R):5'- TTTGACACAGCCCCATGTC -3'

Sequencing Primer
sunrise2_seq(F):5'- TTGCCGGCCTAAGCTCACTG -3'
sunrise2_seq(R):5'- CCATGTCCAGAATCATTTCAGG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Xue Zhong, Evan Nair-Gill, and Bruce Beutler
List |< first << previous [record 76 of 132] next >> last >|