Phenotypic Mutation 'farfalla_notturna' (pdf version)
Allelefarfalla_notturna
Mutation Type missense
Chromosome6
Coordinate124,732,435 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Ptpn6
Gene Name protein tyrosine phosphatase, non-receptor type 6
Synonym(s) Hcph, hcp, SHP-1, Ptp1C
Chromosomal Location 124,720,707-124,738,714 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013545 (variant 1), NM_001077705 (variant 2); MGI:96055

Mapped Yes 
Amino Acid Change Tyrosine changed to Cysteine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000004377] [ENSMUSP00000108103] [ENSMUSP00000129124] [ENSMUSP00000133747] [ENSMUSP00000133991]
SMART Domains Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266
AA Change: Y66C

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000004377)
SMART Domains Protein: ENSMUSP00000108103
Gene: ENSMUSG00000004266
AA Change: Y64C

DomainStartEndE-ValueType
SH2 2 85 4.05e-28 SMART
SH2 108 200 1.45e-29 SMART
PTPc 243 517 7.51e-131 SMART
low complexity region 569 579 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000112484)
SMART Domains Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266
AA Change: Y66C

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000171549)
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000133747
Gene: ENSMUSG00000004266
AA Change: Y43C

DomainStartEndE-ValueType
SH2 2 64 2.35e-6 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000173647)
SMART Domains Protein: ENSMUSP00000133991
Gene: ENSMUSG00000004266
AA Change: Y25C

DomainStartEndE-ValueType
Pfam:SH2 1 40 3.5e-6 PFAM
SH2 69 161 1.45e-29 SMART
PTPc 204 478 7.51e-131 SMART
low complexity region 530 540 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000174265)
Meta Mutation Damage Score 0.8384 question?
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased
FACS B1 cells - increased
FACS CD4:CD8 - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.964; ML prob: 0.948; human score: 4
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (ENU)(4) Gene trapped(3) Spontaneous (4) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ptpn6 APN 6 124732356 splice site probably null
IGL01490:Ptpn6 APN 6 124728344 missense probably damaging 1.00
IGL01865:Ptpn6 APN 6 124732465 missense probably damaging 1.00
IGL02017:Ptpn6 APN 6 124732486 missense probably damaging 0.98
IGL02272:Ptpn6 APN 6 124721208 missense probably damaging 0.99
IGL02276:Ptpn6 APN 6 124728865 missense probably null 1.00
IGL02556:Ptpn6 APN 6 124728660 missense probably benign 0.00
candle UTSW 6 124728419 missense probably damaging 1.00
caterpillar UTSW 6 124724984 missense probably benign
Flutterby UTSW 6 124721858 missense possibly damaging 0.89
Lepidopteran UTSW 6 124728172 missense probably damaging 1.00
Malachite UTSW 6 124728651 missense possibly damaging 0.84
Naphthalene UTSW 6 124721789 missense probably benign 0.42
spin UTSW 6 124728559 missense probably damaging 1.00
spin2 UTSW 6 124732369 missense probably damaging 1.00
Vermeil UTSW 6 124732950 missense probably benign 0.10
R0183:Ptpn6 UTSW 6 124728951 missense probably damaging 1.00
R0254:Ptpn6 UTSW 6 124728150 missense probably damaging 1.00
R0636:Ptpn6 UTSW 6 124725279 missense probably benign
R0835:Ptpn6 UTSW 6 124727536 critical splice acceptor site probably null
R1383:Ptpn6 UTSW 6 124721893 missense probably damaging 1.00
R1638:Ptpn6 UTSW 6 124721185 missense probably benign
R1900:Ptpn6 UTSW 6 124728933 missense probably benign 0.15
R2047:Ptpn6 UTSW 6 124721789 missense probably benign 0.42
R2143:Ptpn6 UTSW 6 124724984 missense probably benign 0.01
R3907:Ptpn6 UTSW 6 124725276 missense possibly damaging 0.86
R4082:Ptpn6 UTSW 6 124728419 missense probably damaging 1.00
R4382:Ptpn6 UTSW 6 124727398 missense possibly damaging 0.86
R5319:Ptpn6 UTSW 6 124732950 missense probably benign 0.10
R5807:Ptpn6 UTSW 6 124724984 missense probably benign
R5878:Ptpn6 UTSW 6 124728785 missense probably damaging 1.00
R6056:Ptpn6 UTSW 6 124732435 missense probably damaging 1.00
R6374:Ptpn6 UTSW 6 124732569 splice site probably null
R7238:Ptpn6 UTSW 6 124721858 missense possibly damaging 0.89
R7381:Ptpn6 UTSW 6 124728172 missense probably damaging 1.00
R7935:Ptpn6 UTSW 6 124732462 missense possibly damaging 0.93
R8297:Ptpn6 UTSW 6 124728651 missense possibly damaging 0.84
Z1176:Ptpn6 UTSW 6 124725076 nonsense probably null
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 10:29 PM by Diantha La Vine
Record Created 2018-03-22 8:08 AM by Anne Murray
Record Posted 2018-04-04
Phenotypic Description

Figure 1. Farfalla_notturna mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Farfalla_notturna mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Farfalla_notturna mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Farfalla_notturna mice exhibit increased frequencies of peripheral  CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Farfalla_notturna mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Farfalla_notturna mice exhibit increased frequencies of peripheral  effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Farfalla_notturna mice exhibit increased frequencies of peripheral  effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Farfalla_notturna mice exhibit increased frequencies of peripheral  B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Farfalla_notturna mice exhibit increased expression of CD44 on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Farfalla_notturna mice exhibit increased expression of CD44 on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Farfalla_notturna mice exhibit increased expression of CD44 on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The farfalla_notturna phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6056, some of which showed reduced frequencies of CD4+ T cells in CD3+ T cells (Figure 1), naive CD4 T cells in CD4 T cells (Figure 2), and naive CD8 T cells in CD8 T cells (Figure 3) with concomitant increased frequencies of CD8+ T cells in CD3+ T cells (Figure 4), central memory CD8 T cells in CD8 T cells (Figure 5), effector memory CD8 T cells in CD8 T cells (Figure 6), effector memory CD4 T cells in CD4 T cells (Figure 7), and B1 cells (Figure 8), all in the peripheral blood. CD44 expression on peripheral blood T cells (Figure 9), CD4+ T cells (Figure 10), and CD8+ T cells (Figure 11) was increased.

Nature of Mutation

Figure 12. Linkage mapping of the reduced naive CD4 T cells in CD4 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 102 mutations (X-axis) identified in the G1 male of pedigree R6056. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 102 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ptpn6:  an A to G transition at base pair 124,732,435 (v38) on chromosome 6, or base pair 6,275 in the GenBank genomic region NC_000072. The strongest association was found with a recessive model of inheritance to the normalized frequency of peripheral blood naïve CD4 T cells in CD4 T cells, wherein five variant homozygotes departed phenotypically from 11 homozygous reference mice and nine heterozygous mice with a P value of 5.928 x 10-11 (Figure 12).  A substantial semidominant effect was observed in most of the assays, but the mutation is preponderantly recessive. 

 

The mutation corresponds to residue 392 in the mRNA sequence NM_013545 within exon 3 of 16 total exons.

 

376 GACTTCTATGACCTGTACGGAGGGGAGAAGTTT

59  -D--F--Y--D--L--Y--G--G--E--K--F-

 

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine to cysteine substitution at position 64 (Y64C) in variant 1 of the SHP1 protein.

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 13. Domain structure of SHP1. The position of the farfalla_notturna mutation is indicated. Other mutations found in SHP1 are noted in red. Click on the mutations for more specific information.

Ptpn6 encodes SHP1, a Src-homology 2 (SH2) domain-containing cytoplasmic protein tyrosine phosphatase. SHP1 has 4 isoforms. Three isoforms of SHP1 contain variations in their N-termini; the fourth isoform is a longer form with an extended C-terminus. SHP1 contains two tandem N-terminal SH2 domains (residues 1-108 and 116-208), a central catalytic domain (residues 270-532), and a C-terminal tail [(1), discussed in (2)]. The C-terminal tail contains multiple sites for tyrosine and serine phosphorylation. The mutation results in a tyrosine to cysteine substitution at position 64 (Y64C) within the SH2 domain. The farfalla_notturna mutation is predicted to affect all of the SHP1 isoforms.

  

For more information on Ptpn6, please see the record for spin.

Putative Mechanism

The phenotype of the farfalla_notturna mice suggests decreased SHP1 function. The phenotype of farfalla_notturna animals is less severe than the spin (3) and spin2 phenotypes as foot lesions were not observed in the farfalla_notturna mice. The foot lesions observed in the spin mice were associated with the development of splenomegaly and an increased number of erythroid and myeloid cells in the spleen, as well as a reduction in mature B cell numbers in the peripheral blood, spleen and bone marrow. Spontaneously occurring motheaten (me) and viable motheaten (me-v) mutants are immunodeficient and exhibit multiple defects stemming from increased inflammation, including alopecia, glomerulonephritis, dermatitis, inflammation of the paws, and interstitial pneumonitis which ultimately causes death by 3 and 9 weeks of age in Ptpn6me/me and Ptpn6me-v/me-v mice, respectively. The phenotype of the farfalla_notturna animals is significantly less severe than the Ptpn6me-v allele, which encodes a SHP1 protein with approximately 20% catalytic activity (4).  It is likely that the SHP1 protein encoded by the farfalla_notturna allele retains catalytic activity that is greater than 20% of normal, and greater than the SHP1 protein encoded by the spin and spin2 alleles.

Primers PCR Primer
farfalla_notturna_pcr_F: ACTTATCTCAAGGGACAGGGC
farfalla_notturna_pcr_R: CCTTGGCAGCTCATTGTGTG

References

Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, Evan Nair-Gill, and Bruce Beutler