Phenotypic Mutation 'fuchsia' (pdf version)
List |< first << previous [record 5 of 74] next >> last >|
Allelefuchsia
Mutation Type critical splice donor site
Chromosome1
Coordinate138,101,041 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Ptprc
Gene Name protein tyrosine phosphatase, receptor type, C
Synonym(s) B220, Ly-5, Lyt-4, CD45, T200
Chromosomal Location 138,062,861-138,175,708 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001111316 (variant 1), NM_011210 (variant 2), NM_001268286 (variant 3); MGI:1924753

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000138800] [ENSMUSP00000138275] [ENSMUSP00000138350]
SMART Domains Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 5 30 5.8e-13 PFAM
low complexity region 31 64 N/A INTRINSIC
Pfam:CD45 70 129 1.8e-24 PFAM
FN3 233 317 2.28e0 SMART
FN3 333 411 3.48e-1 SMART
transmembrane domain 426 447 N/A INTRINSIC
PTPc 500 762 7.57e-127 SMART
PTPc 791 1077 1.39e-102 SMART
Predicted Effect noncoding transcript
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased 22724066
FACS B:T cells - decreased
FACS B1 cells - increased
FACS B220 MFI - decreased
FACS CD4+ T cells - decreased 20346773
FACS CD4+ T cells in CD3+ T cells - increased 20346773
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - decreased
FACS central memory CD4 T cells in CD4 T cells - increased 19299707
FACS central memory CD8 T cells in CD8 T cells - increased 19299707
FACS effector memory CD4 T cells in CD4 T cells - increased 19299707
FACS effector memory CD8 T cells in CD8 T cells - increased 19299707
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS T cells - decreased 22724066
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(20) :  Chemically induced (ENU)(9) Chemically induced (other)(2) Radiation induced(1) Targeted(7) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138083790 splice acceptor site
IGL00486:Ptprc APN 1 138115621 missense probably damaging 0.97
IGL00771:Ptprc APN 1 138113677 missense probably benign 0.00
IGL00833:Ptprc APN 1 138078492 missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138113642 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138120173 splice site probably null
IGL01024:Ptprc APN 1 138080912 missense probably damaging 1.00
IGL01302:Ptprc APN 1 138099631 missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138099481 critical splice donor site probably null
IGL01620:Ptprc APN 1 138068410 missense possibly damaging 0.88
IGL01775:Ptprc APN 1 138064759 missense probably damaging 1.00
IGL01820:Ptprc APN 1 138066198 missense probably damaging 1.00
IGL02340:Ptprc APN 1 138071219 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138099513 missense probably damaging 0.99
IGL03169:Ptprc APN 1 138113619 missense probably benign 0.15
IGL03308:Ptprc APN 1 138126320 missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138093001 missense probably damaging 1.00
belittle UTSW 1 138137493 nonsense
Dumpling UTSW 1 138067890 missense
guotie UTSW 1 138068401 nonsense probably null
guotie2 UTSW 1 138094299 missense probably damaging 1.00
Guotie3 UTSW 1 138078451 missense
Half_measure UTSW 1 138071249 missense
jirisan UTSW 1 138113678 nonsense
R0013:Ptprc UTSW 1 138113559 unclassified probably null
R0189:Ptprc UTSW 1 138082715 missense probably benign 0.10
R0390:Ptprc UTSW 1 138122575 missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138088697 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138089485 splice site probably benign
R0627:Ptprc UTSW 1 138068320 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138073610 missense probably benign 0.01
R0751:Ptprc UTSW 1 138092930 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138101132 missense possibly damaging 0.47
R0942:Ptprc UTSW 1 138068401 nonsense probably null
R0943:Ptprc UTSW 1 138111164 missense probably damaging 0.96
R1159:Ptprc UTSW 1 138072319 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138072312 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138120086 missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1728:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1728:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1728:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1728:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1729:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1729:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1729:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1729:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1730:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1730:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1730:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1730:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1739:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1739:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1739:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1739:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1762:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1762:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1762:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1762:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1783:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1783:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1783:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1783:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1783:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1784:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1784:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1784:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1784:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1785:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1785:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1785:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1785:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1862:Ptprc UTSW 1 138112227 missense probably benign 0.13
R2145:Ptprc UTSW 1 138073681 missense probably damaging 1.00
R2290:Ptprc UTSW 1 138111188 missense probably benign 0.00
R2403:Ptprc UTSW 1 138088532 missense probably damaging 1.00
R2439:Ptprc UTSW 1 138066152 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138080178 missense probably damaging 1.00
R2906:Ptprc UTSW 1 138064534 missense possibly damaging 0.93
R3774:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3775:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3776:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3834:Ptprc UTSW 1 138083567 missense probably damaging 1.00
R4019:Ptprc UTSW 1 138078516 missense probably damaging 1.00
R4377:Ptprc UTSW 1 138067925 missense probably benign 0.04
R4580:Ptprc UTSW 1 138071251 missense probably benign 0.09
R4923:Ptprc UTSW 1 138078498 missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138099497 missense probably benign 0.04
R4937:Ptprc UTSW 1 138089500 missense probably damaging 1.00
R4970:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5112:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5145:Ptprc UTSW 1 138089566 missense probably benign 0.07
R5158:Ptprc UTSW 1 138175084 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138117862 missense probably benign
R5593:Ptprc UTSW 1 138117720 intron probably benign
R5689:Ptprc UTSW 1 138117777 missense probably benign 0.01
R5885:Ptprc UTSW 1 138088508 missense probably damaging 1.00
R6010:Ptprc UTSW 1 138101056 missense probably benign 0.09
R6026:Ptprc UTSW 1 138071249 missense probably damaging 0.98
R6047:Ptprc UTSW 1 138101041 critical splice donor site probably null
R6173:Ptprc UTSW 1 138067890 missense probably damaging 1.00
R6328:Ptprc UTSW 1 138113678 nonsense probably null
R6383:Ptprc UTSW 1 138078451 missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138083639 missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138113562 critical splice donor site probably null
R6520:Ptprc UTSW 1 138080143 nonsense probably null
R6805:Ptprc UTSW 1 138067885 critical splice donor site probably null
R6830:Ptprc UTSW 1 138072255 critical splice donor site probably null
R6847:Ptprc UTSW 1 138088545 missense probably damaging 0.99
R6960:Ptprc UTSW 1 138078445 critical splice donor site probably null
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2018-10-05 4:45 PM by Diantha La Vine
Record Created 2018-03-29 12:28 PM by Xue Zhong
Record Posted 2018-04-04
Phenotypic Description
Figure 1. Fuschia mice exhibit decreased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Fuschia mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Fuschia mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Fuschia mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Fuschia mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Fuschia mice exhibit decreased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Fuschia mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Fuschia mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Fuschia mice exhibit increased frequencies of B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Fuschia mice exhibit increased frequencies of CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Fuschia mice exhibit increased frequencies of central memory CD4 T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Fuschia mice exhibit increased frequencies of central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Fuschia mice exhibit increased frequencies of effector memory CD4 T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Fuschia mice exhibit increased frequencies of effector memory CD8 T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Fuschia mice exhibit reduced B220 expression on peripheral blood B cell. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Fuschia mice exhibit increased CD44 expression on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 17. Fuschia mice exhibit increased CD44 expression on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 18. Fuschia mice exhibit increased CD44 expression on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The fuchsia phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6047, some of which showed a reduced B to T cell ratio (Figure 1), reduced frequencies of B cells (Figure 2), T cells (Figure 3), CD4+ T cells (Figure 4), CD8+ T cells (Figure 5), CD8+ T cells in CD3+ T cells (Figure 6), naive CD4 T cells in CD4 T cells (Figure 7), and naive CD8 T cells in CD8 T cells (Figure 8) with concomitant increased frequencies of B1 cells (Figure 9), CD4+ T cells in CD3+ T cells (Figure 10), central memory CD4 T cells in CD4 T cells (Figure 11), central memory CD8 T cells in CD8 T cells (Figure 12), effector memory CD4 T cells in CD4 T cells (Figure 13), and effector memory CD8 T cells in CD8 T cells (Figure 14), all in the peripheral blood. Some mice showed reduced B220 expression on peripheral blood B cells (Figure 15) as well as increased CD44 expression on peripheral blood T cells (Figure 16), CD4+ T cells (Figure 17), and CD8+ T cells (Figure 18).

Nature of Mutation

Figure 19. Linkage mapping of the increased effector memory CD4 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R6047. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ptprc: a G to A transition at base pair 138,101,041 (v38) on chromosome 1, or base pair 74,716 in the GenBank genomic region NC_000067 within the donor splice site of intron 13. The strongest association was found with a recessive model of inheritance to the effector memory CD4 T cell frequency, wherein five variant homozygotes departed phenotypically from nine homozygous reference mice and 18 heterozygous mice with a P value of 2.397 x 10-23 (Figure 19).

 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in skipping of the 156-nucleotide exon 13 (out of 33 total exons), resulting in an in-frame deletion of 52 amino acids (amino acids 421 to 472) of the protein (which is normally 1,293 amino acids long).

 

          <--exon 12      <--exon 13 intron 13-->      exon 14-->
1288 ……AAGAACAATTCAG ……ACAAAAGCAGATC gtaagtttttggctt…… GTCCGGACAAG……
417  ……-K--N--N--S-- ……-T--K--A--D--                   R--P--D--K-……

          correct        deleted                         correct

 

The donor splice site of intron 13, which is destroyed by the fuschia mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 20. Domain structure of the CD45RABC isoform. The extracellular N-terminal A, B, and C regions are encoded by exons 4, 5, and 6, respectively, and are heavily O-glycosylated. The remainder of the extracelluar domain contains 15 sites for N-glycosylation. The catalytic cysteine (828) is indicated within the PTP D1 domain. The fuchsia mutation is shown in red. FNIII=Type III fibronectin; TM=Transmembrane domain; PTP=Protein tyrosine phosphatase. This image is interactive. Other mutations found in CD45 are noted in red. Click on the mutations for more specific information.

Ptprc encodes CD45, a receptor-like protein tyrosine phosphatase (PTP) expressed by cells of the immune system. It is known by several names, including T200 (1), B220 for the B cell form (2), the mouse allotypic marker Ly-5 (3), and CD45. CD45 is a type I transmembrane glycoprotein containing a large N-terminal extracellular domain of ~400-500 residues (depending on the expression of several alternative exons, see below), a single transmembrane domain (22 amino acids), and a C-terminal cytoplasmic domain of 707 residues containing tandem PTP domains only one of which is enzymatically active. Following the PTP domains is a 79 residue C-terminal tail. 

 

Exons 4, 5, and 6 of Ptprc are alternatively spliced to generate three protein isoforms with variations in the most N-terminal domain, furthest from the cell membrane. The three peptides are designated as A, B, and C, respectively. The protein isoforms are commonly named based on the exons included, with the largest isoform (RABC) including all three exons, RAB including exons 4 and 5, etc., and the smallest isoform lacking all three exons designated RO. The D2 domain is a protein tyrosine phosphatase (PTP) domain that is enzymatically inactive, but optimal phosphatase activity in cells requires both the D1 and the D2 domains (4). Within the D2 domain is a unique acidic region of 19 residues that contains multiple sites for serine phosphorylation by casein kinase II (5;6). This modification is important for optimal CD45 phosphatase activity toward a model substrate in vitro and for cellular signaling leading to Ca2+ flux in Jurkat T cells, although the mechanistic basis for these effects is unknown. The D2 domain may also modulate substrate access and localization, as suggested by the interaction of D2 with the CD45 substrate Lck (7).

 

The fuschia mutation is predicted to result in an in-frame deletion of 52 amino acids (amino acids 421 to 472) of the CD45 protein; amino acids 421 to 472 are within the first type III fibronectin (FN-III) domain.

 

Please see the record for belittle for information about CD45.

Putative Mechanism

The physiological function of CD45 has been examined most extensively in T cells. Studies with CD45-deficient cell lines identified CD45 as an obligate positive regulator of antigen receptor signaling, since T cells lacking CD45 failed to proliferate or produce cytokines in response to TCR stimulation (8;9). CD45 can regulate both the activating and inhibitory tyrosines of Src family kinases.

 

Ptprc-/- mice have profound defects in thymic development due to dysfunctional signaling through the preTCR and TCR, leading to a block in thymocyte development at β selection and at the DP stage (10-12). As a result, the absolute number of DP thymocytes is reduced twofold, and the number of single positive (SP) thymocytes is reduced five-fold. Peripheral B cell numbers are actually increased in CD45-deficient mice.  CD45 deficiency has less severe consequences for B cells than for T cells. Peripheral B cell numbers are actually increased in CD45-deficient mice (10-12). Marginal zone B cells are increased, while B1 cell production is decreased, and B cell development is blocked at the transitional 2 (T2) to mature follicular B cell transition (13). Humans deficient in CD45 develop severed combined immunodeficiency (SCID) with defects in T and B cell development and function (OMIM #608971) (14;15)

 

The immune cell phenotype of the Ptprcfuschia/fuschia mice is similar to that of the Ptprc-/- mice suggesting that the fuscia mutation abrogates CD45 expression. Another ENU-induced Ptprc allele, storm (MGI:4819159), exhibited decreased B cell numbers as well as reduced T cell numbers. The expression and localization of CD45fushia have not been examined; however, the phenotype of the fuschia mice indicates that the fuschia mice doe not express functional CD45.

Primers PCR Primer
fuchsia(F):5'- AGGAAGTACACTGGCTGGTG -3'
fuchsia(R):5'- CTTTCAGAAACTTACTAACTCAGGC -3'

Sequencing Primer
fuchsia_seq(F):5'- TCAACTCTGTCACTCTATCAGATAG -3'
fuchsia_seq(R):5'- GACCAGTTTTGAGGTGGAA -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Xue Zhong, Evan Nair-Gill, and Bruce Beutler
List |< first << previous [record 5 of 74] next >> last >|