Phenotypic Mutation 'fluffy' (pdf version)
Allelefluffy
Mutation Type missense
Chromosome4
Coordinate101,792,023 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Lepr
Gene Name leptin receptor
Synonym(s) obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
Chromosomal Location 101,717,404-101,815,352 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_146146, NM_010704, NM_001122899; MGI:104993

Mapped Yes 
Amino Acid Change Proline changed to Threonine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000037385] [ENSMUSP00000099838] [ENSMUSP00000102534]
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: P874T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000037552)
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: P874T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000102777)
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: P874T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000106921)
Meta Mutation Damage Score 0.2973 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - increased
Body Weight (Female) - increased
Body Weight (Male) - increased
Body Weight (Z-score) - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
Candidate Explorer Status CE: excellent candidate; human score: 1.5; ML prob: 0.82
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(54) : Chemically induced (ENU)(10) Chemically induced (other)(2) Radiation induced(1) Spontaneous(15) Targeted(23) Transgenic(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.77
IGL01324:Lepr APN 4 101768068 missense probably benign 0.23
IGL01372:Lepr APN 4 101735577 missense possibly damaging 0.67
IGL01626:Lepr APN 4 101733534 missense probably benign 0.10
IGL01733:Lepr APN 4 101765082 missense probably benign 0.00
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.49
IGL01899:Lepr APN 4 101779987 missense possibly damaging 0.86
IGL02138:Lepr APN 4 101768067 missense probably damaging 0.98
IGL02161:Lepr APN 4 101745678 missense probably damaging 0.97
IGL02653:Lepr APN 4 101764944 missense probably benign 0.44
IGL02735:Lepr APN 4 101782638 missense probably damaging 1.00
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
aufsetzigen UTSW 4 101752175 missense probably damaging 1.00
business_class UTSW 4 101764872 missense probably damaging 1.00
cherub UTSW 4 101768063 missense probably benign 0.25
clodhopper UTSW 4 101765290 splice site probably null
donner UTSW 4 101815201 missense probably damaging 1.00
giant UTSW 4 101765152 critical splice donor site probably null
gordo UTSW 4 101765305 missense probably damaging 0.97
Immunoglutton UTSW 4 101765301 splice site probably benign
Jumbo_shrimp UTSW 4 101764954 nonsense probably null
lowleaning UTSW 4 101814391 intron probably null
odd UTSW 4 101728075 splice site probably benign
paleo UTSW 4 101745645 missense possibly damaging 0.94
well-upholstered UTSW 4 101772959 synonymous probably benign
worldly UTSW 4 101768228 missense possibly damaging 0.96
PIT4651001:Lepr UTSW 4 101791997 missense probably damaging 1.00
PIT4696001:Lepr UTSW 4 101779983 missense probably benign 0.10
R0140:Lepr UTSW 4 101768067 missense probably damaging 1.00
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1398:Lepr UTSW 4 101792019 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1602:Lepr UTSW 4 101745645 missense possibly damaging 0.94
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 splice site probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4343:Lepr UTSW 4 101765152 critical splice donor site probably null
R4345:Lepr UTSW 4 101765152 critical splice donor site probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4724:Lepr UTSW 4 101765365 nonsense probably null
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R4939:Lepr UTSW 4 101733438 missense possibly damaging 0.78
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 intron probably benign
R6092:Lepr UTSW 4 101792023 missense probably damaging 1.00
R6130:Lepr UTSW 4 101765372 missense probably damaging 0.99
R6168:Lepr UTSW 4 101735592 missense probably damaging 0.99
R6232:Lepr UTSW 4 101814391 intron probably null
R6380:Lepr UTSW 4 101764954 nonsense probably null
R6427:Lepr UTSW 4 101774257 missense possibly damaging 0.47
R6428:Lepr UTSW 4 101780098 missense probably damaging 1.00
R6641:Lepr UTSW 4 101765305 missense probably damaging 0.97
R6650:Lepr UTSW 4 101815201 missense probably damaging 1.00
R6859:Lepr UTSW 4 101765290 splice site probably null
R7023:Lepr UTSW 4 101789287 missense probably damaging 1.00
R7145:Lepr UTSW 4 101752197 missense probably benign 0.00
R7174:Lepr UTSW 4 101750338 missense probably benign 0.01
R7179:Lepr UTSW 4 101745659 missense probably benign 0.06
R7189:Lepr UTSW 4 101814764 missense probably benign 0.00
R7426:Lepr UTSW 4 101745656 missense probably benign 0.03
R7531:Lepr UTSW 4 101752175 missense probably damaging 1.00
R7620:Lepr UTSW 4 101752073 missense probably benign 0.41
R7804:Lepr UTSW 4 101782586 missense probably damaging 1.00
R8022:Lepr UTSW 4 101782557 missense probably benign 0.32
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Z1176:Lepr UTSW 4 101745614 missense probably damaging 0.99
Z1177:Lepr UTSW 4 101735595 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:37 PM by Diantha La Vine
Record Created 2018-04-06 9:01 AM by Jamie Russell
Record Posted 2018-12-18
Phenotypic Description
Figure 1. Fluffy mice (left) showed increased body weights/sizes compared to wild-type littermates (right).
Figure 2. Fluffy mice exhibit increased body weights. Scaled body weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Fluffy mice exhibit reduced balance and coordination on a rotating rod during a rotarod performance test. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Fluffy mice exhibit reduced heart rates. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Fluffy mice exhibit reduced systolic blood pressures. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Fluffy mice exhibit reduced lean fat ratios. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Fluffy mice exhibit increased fat mass. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Fluffy mice exhibit increased amounts of liver fat. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Fluffy mice exhibit reduced pelvis lengths. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Fluffy mice exhibit reduced tibia lengths. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Fluffy mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Fluffy mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Fluffy mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Fluffy mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The fluffy phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R6092, some of which showed increased body weights/sizes compared to wild-type littermates (Figure 1 & 2). The mice also showed reduced balance and coordination on a rotating rod during a rotarod performance test (Figure 3), reduced heart rates (Figure 4), reduced systolic blood pressures (Figure 5), reduced lean fat ratios (Figure 6), increased fat mass (Figure 7), increased liver fat (Figure 8), and reduced pelvis (Figure 9) and tibia (Figure 10) lengths. Some mice showed increased frequencies of effector memory CD4 T cells in CD4 T cells (Figure 11) and effector memory CD8 T cells in CD8 T cells (Figure 12) with concomitant reduced frequencies of naïve CD4 T cells in CD4 T cells (Figure 13) and naïve CD8 T cells in CD8 T cells (Figure 14) in the peripheral blood.

Nature of Mutation

Figure 15. Linkage mapping of the fat mass phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 65 mutations (X-axis) identified in the G1 male of pedigree R6092. Normalized data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 65 mutations. All of the above anomalies were linked to a mutation in Lepr: a C to A transition at base pair 101,792,023 (v38) on chromosome 4, or base pair 74,890 in the GenBank genomic region NC_000070. The strongest association was found with a recessive model of inheritance to the normalized increased fat mass phenotype, wherein six variant homozygotes departed phenotypically from 23 homozygous reference mice and 41 heterozygous mice with a P value of 4.494 x 10-36 (Figure 15).

 

The mutation corresponds to residue 3,172 in the mRNA sequence NM_146146 within exon 18 of 19 total exons.

 
3157 TTTTGGGACGATGTTCCAAACCCCAAGAATTGT
869  -F--W--D--D--V--P--N--P--K--N--C-

 

The mutated nucleotide is indicated in red. The mutation results in a proline to threonine substitution at position 874 (P874T) in the LEPR protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 16. Domain of OB-Rb and structure of mouse leptin receptor isoforms. OB-Rb contains the longest intracellular domain, which is crucial for leptin signaling. OB-Ra, OB-Rc and OB-Rd have varying short cytoplasmic domains. All isoforms contain the Box 1 motif known to bind JAK kinases. OB-Re is a secreted isoform of the leptin receptor. Cytokine receptor homology module (CRH)2 is the main binding site for leptin. The immunoglobin-like (IG-like) and fibronectin type III (FNIII) domains are involved in OB-R activation. The role of CRH1 remains to be determined. Both CRH domains also contain a FNIII fold (see text). The fluffy mutation results in a proline to threonine substitution at position 874 within the Box 1 motif of LEPR. This image is interactive. Other mutations found in the Lepr gene are noted in red. Click on the mutations for more specific information. 

The Lepr or obr gene encodes an 1162 amino acid protein that is the receptor for leptin, a four-helical cytokine-like hormone produced primarily by adipocytes [Figure 16; (1;2)]. The leptin receptor is a member of the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT (signal transducer and activator of transcription) proteins (see domino for more information on STAT signaling). Six isoforms of the leptin receptor are generated by alternative splicing; each isoform, with the exception of a soluble isoform (OB-Re) are single-pass membrane-spanning proteins differing only in the sequences of their C-terminal intracellular domains. The extracellular portion of the human leptin receptor contains two CK domains that contain conserved cysteine-containing motifs (amino acids 62-178 and amino acids 428-535), four domains that contain a fibronectin type III (FNIII) fold (amino acids 235-327, 536-635, 636-731, and amino acids 732-841), and a domain that has an Ig-like fold (amino acids 328-427). The first CK domain and the first FNIII domain form the cytokine receptor homology module 1 (CRH1), while the second CK domain and remaining FNIII domains form the cytokine receptor homology module 2. 

 

The fluffy mutation results in a proline to threonine substitution at position 874 (P874T); amino acid 874 is within the cytoplasmic Box 1 motif of LEPR, which binds JAK kinases to promote downstream signaling.

 

Please see the record for Business_class for more information on Lepr.

Putative Mechanism

Leptin, a systemic hormone, regulates multiple functions of the body including energy utilization and storage, various endocrine axes, bone metabolism, thermoregulation, angiogenesis, immunity and inflammation by binding to the long form of the leptin receptor (OB-Rb) and subsequent initiation of various signal transduction pathways [reviewed in (3-5)].  It is primarily produced by adipocytes in proportion to fat stores, but can also be produced by placenta (syncytiotrophoblasts), ovaries, skeletal muscle, stomach, mammary epithelial cells, bone marrow, pituitary and liver (6). Humans and other animals deficient for leptin or its receptor, exhibit hyperphagia and low metabolism that results in obesity and insulin resistance [OMIM #614963; (2;7;8)].  Similar to other Lepr mouse models (see MGI for a list of Lepr alleles as well as the entry for Business_class), the fluffy mice exhibit obesity. The phenotype of the fluffy mice indicates that the LepRfluffy protein exhibits loss of function.

Primers PCR Primer
fluffy_pcr_F: TAGTACAGAGCCTGGCACAC
fluffy_pcr_R: CAAACCCAGCTTTTGAGAAAGAG

Sequencing Primer
fluffy_seq_F: CAGTTTAGGGAACACTTTGTGGAATC
fluffy_seq_R: CCCAGCTTTTGAGAAAGAGAAAGG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 425 nucleotides is amplified (chromosome 4, + strand):


1   tagtacagag cctggcacac agcattagag agatcttcat aacagtttag ggaacacttt
61  gtggaatcaa atgtaaatgt gggtttggcc ctactgacct gatccagccg accaatgctt
121 attttgtatg ttaactgcta acggttttac agtctccaca tttctgtaac cagagtgctt
181 tatttcttct ttgcagaatg aaaaagttgt tttgggacga tgttccaaac cccaagaatt
241 gttcctgggc acaaggactg aatttccaaa aggtcactgt ttaagtattt taacccagat
301 atctaaggtt gcagtttaga tgccacagta cttacagatc tttaaacaac tttaaagggc
361 tttatgttgt tgtgttcatg ttctcaagcc tgttcatcct ttctctttct caaaagctgg
421 gtttg


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJami Keef, Lauren Prince, Jamie Russell, and Bruce Beutler