Phenotypic Mutation 'waxwing' (pdf version)
Allelewaxwing
Mutation Type nonsense
Chromosome11
Coordinate11,748,464 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Ikzf1
Gene Name IKAROS family zinc finger 1
Synonym(s) LyF-1, 5832432G11Rik, Zfpn1a1, Ikaros
Chromosomal Location 11,685,003-11,772,926 bp (+)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of transcription factors that are characterized by a set of four DNA-binding zinc fingers at the N-terminus and two C-terminal zinc fingers involved in protein dimerization. It is regulated by both epigenetic and transcription factors. This protein is a transcriptional regulator of hematopoietic cell development and homeostasis. In addition, it is required to confer temporal competence to retinal progenitor cells during embryogenesis, demonstrating an essential function in nervous system development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mutants have a variety of T, B, and hematopoeitic cell maturation defects. Heterozygotes for one allele exhibit dominant negative effects and mice develop lymphoproliferative disorders. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001025597 (variant 1), NM_009578 (variant 2), NM_001301863 (variant 3), NM_001301865 (variant 4), NM_001301866 (variant 5), NM_001301868 (variant 6); MGI:1342540

Mapped Yes 
Amino Acid Change Serine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000018798] [ENSMUSP00000046974] [ENSMUSP00000067372] [ENSMUSP00000075992] [ENSMUSP00000119960]
SMART Domains Protein: ENSMUSP00000018798
Gene: ENSMUSG00000018654

DomainStartEndE-ValueType
ZnF_C2H2 58 80 8.02e-5 SMART
ZnF_C2H2 86 108 2.57e-3 SMART
ZnF_C2H2 114 137 8.22e-2 SMART
low complexity region 282 293 N/A INTRINSIC
ZnF_C2H2 371 393 7.49e0 SMART
ZnF_C2H2 399 423 5.34e-1 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000046974
Gene: ENSMUSG00000018654

DomainStartEndE-ValueType
ZnF_C2H2 58 80 8.02e-5 SMART
ZnF_C2H2 86 108 2.57e-3 SMART
ZnF_C2H2 114 137 8.22e-2 SMART
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000067372
Gene: ENSMUSG00000018654
AA Change: S125*

DomainStartEndE-ValueType
ZnF_C2H2 137 159 1.43e-1 SMART
ZnF_C2H2 165 187 8.02e-5 SMART
ZnF_C2H2 193 215 2.57e-3 SMART
ZnF_C2H2 221 244 8.22e-2 SMART
low complexity region 389 400 N/A INTRINSIC
ZnF_C2H2 478 500 7.49e0 SMART
ZnF_C2H2 506 530 5.34e-1 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000075992
Gene: ENSMUSG00000018654
AA Change: S105*

DomainStartEndE-ValueType
ZnF_C2H2 117 139 1.43e-1 SMART
ZnF_C2H2 145 167 8.02e-5 SMART
ZnF_C2H2 173 195 2.57e-3 SMART
ZnF_C2H2 201 224 8.22e-2 SMART
low complexity region 369 380 N/A INTRINSIC
ZnF_C2H2 458 480 7.49e0 SMART
ZnF_C2H2 486 510 5.34e-1 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000119960
Gene: ENSMUSG00000018654

DomainStartEndE-ValueType
ZnF_C2H2 58 78 2.14e0 SMART
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
Blood Pressure: HR Average - decreased
Blood Pressure: HR Day 2 - decreased
Blood Pressure: HR Day 3 - decreased
FACS B cells - decreased
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ CD4 MFI - increased
FACS CD8+ T cells - increased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - decreased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS T cells - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(14) : Chemically induced (ENU)(1) Gene trapped(1) Targeted(12)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Ikzf1 APN 11 11768923 missense probably damaging 1.00
IGL01367:Ikzf1 APN 11 11748358 missense probably benign 0.04
IGL01823:Ikzf1 APN 11 11769091 missense possibly damaging 0.64
IGL02342:Ikzf1 APN 11 11700216 utr 5 prime probably benign
IGL02452:Ikzf1 APN 11 11748545 missense probably damaging 1.00
IGL03209:Ikzf1 APN 11 11700226 missense probably benign
IGL03236:Ikzf1 APN 11 11707848 missense probably damaging 1.00
Herrscher UTSW 11 11768961 nonsense probably null
Star_lord UTSW 11 11769448 missense probably damaging 1.00
R0133:Ikzf1 UTSW 11 11741015 splice site probably null
R0417:Ikzf1 UTSW 11 11769352 missense probably benign 0.19
R0633:Ikzf1 UTSW 11 11769223 missense probably damaging 1.00
R0734:Ikzf1 UTSW 11 11758195 missense probably damaging 1.00
R1693:Ikzf1 UTSW 11 11707838 missense probably damaging 1.00
R2114:Ikzf1 UTSW 11 11769473 missense probably damaging 1.00
R2927:Ikzf1 UTSW 11 11769324 missense probably damaging 1.00
R4250:Ikzf1 UTSW 11 11754166 missense probably damaging 1.00
R5156:Ikzf1 UTSW 11 11769448 missense probably damaging 1.00
R5912:Ikzf1 UTSW 11 11748464 nonsense probably null
R6274:Ikzf1 UTSW 11 11768961 nonsense probably null
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2018-08-23 2:58 PM by Diantha La Vine
Record Created 2018-04-17 10:03 AM by Bruce Beutler
Record Posted 2018-08-22
Phenotypic Description

Figure 1. Waxwing mice exhibit reduced heart rates compared to wild-type littermates. Heart rate on day 3 of testing is shown. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Waxwing mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Waxwing mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Waxwing mice exhibit reduced CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Waxwing mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Waxwing mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Waxwing mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Waxwing mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Waxwing mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Waxwing mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Waxwing mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Waxwing mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Waxwing mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Waxwing mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Waxwing mice exhibit reduced expression of B220 on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Waxwing mice exhibit increased expression of CD44 on peripheral CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The waxwing phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5912, some of which showed reduced heart rates compared to wild-type littermates (Figure 1; heart rate phenotype on day 3 is shown). Some mice also showed reduced frequencies of B cells (Figure 2), T cells (Figure 3), reduced CD4 to CD8 T cells ratios (Figure 4), reduced frequencies of CD4+ T cells (Figure 5), CD4+ T cells in CD3+ T cells (Figure 6), naive CD4 T cells in CD4 T cells (Figure 7), and naive CD8 T cells in CD8 T cells (Figure 8) with concomitant increased frequencies of CD8+ T cells (Figure 9), CD8+ T cells in CD3+ T cells (Figure 10), central memory CD4 T cells in CD4 T cells (Figure 11), central memory CD8 T cells in CD8 T cells (Figure 12), effector memory CD4 T cells in CD4 T cells (Figure 13), and effector memory CD8 T cells in CD8 T cells (Figure 14), all in the peripheral blood. Expression of B220 on peripheral blood B cells was reduced (Figure 15), while expression of CD44 on peripheral blood CD4 T cells was increased (Figure 16).

Nature of Mutation

Figure 17. Linkage mapping of the reduced naive CD8 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 51 mutations (X-axis) identified in the G1 male of pedigree R5912. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 51 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ikzf1: a C to A transversion at base pair 11,748,464 (v38) on chromosome 11, or base pair 63,496 in the GenBank genomic region NC_000077 encoding Ikzf1. The strongest association was found with a recessive model of inheritance to the naïve CD8 T cells in CD8 T cells frequency, wherein one homozygous variant departed phenotypically from 30 homozygous reference mice and 30 heterozygous mice with a P value of 3.528 x 10-22 (Figure 17).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive.

 

The mutation corresponds to residue 872 in the mRNA sequence NM_001025597 within exon 4 of 8 total exons.

 

856 GGCAGCTCGGCTTTGTCAGGAGTTGGAGGCATT

100 -G--S--S--A--L--S--G--V--G--G--I-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of serine 105 for a premature stop codon (S105*) in variant 1 of the IKZF1 protein.

Protein Prediction
Figure 18. Domain organization of IKAROS. IKAROS has six C2H2-type zinc fingers, with four at the N-terminus and two at the C-terminus. The waxwing mutation results in substitution of serine 105 for a premature stop codon in variant 1 of the protein. Other mutations found in the IKAROS protein are shown in red. Click on each mutation for more information.

Ikzf1 (IKAROS family zinc finger 1) encodes IKAROS (alternatively, IK1). IKAROS has six C2H2-type zinc fingers, with four at the N-terminus and two at the C-terminus (Figure 18) (1). The N-terminal zinc fingers mediate binding to the core DNA motif A/GGGAA. The C-terminal zinc fingers mediate IKAROS homodimerization as well as heterodimerization with other members of the IKAROS protein family (2). Dimerization of the IKAROS proteins enhances their DNA affinity and transcriptional activity.

 

The waxwing mutation results in substitution of serine 105 for a premature stop codon (S105*) in variant 1 of the IKZF1 protein; Ser105 immediately precedes the first zinc finger.

 

For more information about Ikzf1, please see the record for star_lord.

Putative Mechanism

IKAROS is a transcription factor that regulates the expression of genes that mediate the production of blood and immune cells, promotes precursor self-renewal, common lymphoid progenitor generation from hematopoietic stem cells, B and NK cell lineages from common lymphoid progenitors, inhibition of common myeloid progenitor differentiation, neutrophil generation from granulocyte-macrophage progenitors, and generation of erythroid cells from megakaryocyte-erythroid progenitors [reviewed in (3)].

 

Mutations in IKZF1 are associated with common variable immunodeficiency-13 (OMIM: #616873) (4;5). Patients with common variable immunodeficiency-13 exhibit recurrent bacterial infections, hypogammaglobulinemia, and decreased numbers of B cells (4;5). Some patients also have reduced numbers of NK cells and increased numbers of T lymphocytes (4). Dominant negative mutations in IKZF1 are linked to acute lymphoblastic leukemia (ALL) in infants and adults (6-8). Patients with ALL exhibit uncontrolled B-lymphoid progenitor expansion in the bone marrow.

 

Ikzf1-deficient (Ikzf1-/-) mice typically (95%) exhibited postnatal lethality by four weeks of age due to bacterial infections (9). The Ikzf1-/-mice exhibited reduced body sizes compared to wild-type mice (9). Ikzf1-/- mice exhibited reduced circulating adrenocorticotrophic hormone levels, adrenal glucocorticoid insufficiency, and contraction of the pituitary corticomelanotroph population due to loss of IKAROS-associated proopiomelanocortin gene expression (10). Ikzf1-/- mice also exhibited reduced numbers of B1a, B1b cells, NK cells, and double-positive T cells, deficient B cell differentiation, reduced spleen germinal center number, aberrant B cell activation and proliferation after IL-7 stimulation, and reduced IgG3 levels (9;11;12). Homozygous mice expressing an ENU-induced mutant Ikzf1 allele (Ikzf1plastc/plastc; H191R) exhibited embryonic lethality between embryonic days 15.5 and 17.5 due to fetal anemia (13). The Ikzf1plastc/plastc embryos showed thymus and liver hypoplasia, a failure in T and B cell differentiation, increased numbers of granulocyte/macrophage progenitor cells, reduced numbers of erythroid progenitor cells, aberrant erythroblast differentiation and growth (13). Homozygous mice expressing a mutant Ikzf1 allele that is missing zinc finger 1 (Ikzf1deltaF1/deltaF1) exhibited reduced numbers of immature B cells as well as pre-B, B1a, and B1b cell numbers, thymus hypoplasia, and reduced numbers of DN1 thymic pro-T cells (14).

 

The phenotype of the waxwing mice indicates abberant IKZF1waxwing-associated function in lymphocyte differentiation and function.

Primers PCR Primer
waxwing(F):5'- AGGTACAGGCTCAAAACTGC -3'
waxwing(R):5'- TGACAGTACATTTTGCTCCTTCAG -3'

Sequencing Primer
waxwing_seq(F):5'- GAAGCTCCAACTGTCTATTTGATGC -3'
waxwing_seq(R):5'- TCCTTCAGCCCCCACAGG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsRoberto Pontes, Xue Zhong, Jin Huk Choi, and Bruce Beutler