Phenotypic Mutation 'complementary' (pdf version)
Allele | complementary |
Mutation Type |
missense
|
Chromosome | 1 |
Coordinate | 60,951,650 bp (GRCm39) |
Base Change | T ⇒ C (forward strand) |
Gene |
Ctla4
|
Gene Name | cytotoxic T-lymphocyte-associated protein 4 |
Synonym(s) | Ctla-4, Cd152, Ly-56 |
Chromosomal Location |
60,948,184-60,954,991 bp (+) (GRCm39)
|
MGI Phenotype |
FUNCTION: This gene is a member of the immunoglobulin superfamily, and encodes a protein that functions as a negative regulator of T-cell responses. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013] PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality at 3 to 4 weeks of age, decreased T cell numbers, abnormal T cell physiology, inflammation in mutliple organs, abnormal thymus morphology, and lymph node hypoplasia. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_009843, NM_001281976; MGI:88556
|
Mapped | Yes |
Amino Acid Change |
Tyrosine changed to Histidine
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000027164]
[ENSMUSP00000095327]
|
AlphaFold |
no structure available at present |
SMART Domains |
Protein: ENSMUSP00000027164 Gene: ENSMUSG00000026011 AA Change: Y60H
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
37 |
N/A |
INTRINSIC |
IG
|
43 |
152 |
2.72e-5 |
SMART |
transmembrane domain
|
162 |
184 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
(Using ENSMUST00000027164)
|
SMART Domains |
Protein: ENSMUSP00000095327 Gene: ENSMUSG00000026011 AA Change: Y60H
Domain | Start | End | E-Value | Type |
IG
|
43 |
152 |
2.72e-5 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000097720)
|
Meta Mutation Damage Score |
0.5680 |
Is this an essential gene? |
Possibly nonessential (E-score: 0.307) |
Phenotypic Category |
Unknown |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All Mutations and Alleles(15) : Chemically induced (other)(1) Gene trapped(1) Radiation induced(1) Targeted(11) Transgenic(1)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL03169:Ctla4
|
APN |
1 |
60953764 |
splice site |
probably benign |
|
Congruent
|
UTSW |
1 |
60951695 |
missense |
probably damaging |
1.00 |
zesty
|
UTSW |
1 |
60951872 |
missense |
probably benign |
0.02 |
R0882:Ctla4
|
UTSW |
1 |
60948397 |
missense |
probably benign |
|
R2513:Ctla4
|
UTSW |
1 |
60951723 |
missense |
probably damaging |
1.00 |
R6130:Ctla4
|
UTSW |
1 |
60951650 |
missense |
probably damaging |
1.00 |
R6291:Ctla4
|
UTSW |
1 |
60951837 |
missense |
probably benign |
|
R6450:Ctla4
|
UTSW |
1 |
60951872 |
missense |
probably benign |
0.02 |
R7686:Ctla4
|
UTSW |
1 |
60951752 |
missense |
probably benign |
|
R8464:Ctla4
|
UTSW |
1 |
60951686 |
missense |
probably damaging |
0.98 |
R9167:Ctla4
|
UTSW |
1 |
60951695 |
missense |
probably damaging |
1.00 |
R9410:Ctla4
|
UTSW |
1 |
60951911 |
missense |
probably damaging |
1.00 |
X0023:Ctla4
|
UTSW |
1 |
60951702 |
missense |
probably benign |
0.02 |
|
Mode of Inheritance |
Unknown |
Local Stock | |
Repository | |
Last Updated |
2019-09-04 9:37 PM
by Anne Murray
|
Record Created |
2018-04-19 9:12 AM
by Bruce Beutler
|
Record Posted |
2018-09-07 |
Phenotypic Description |
The complementary phenotype was identified among G3 mice of the pedigree R6130, some of which showed reduced frequencies of naive CD4 T cells in CD4 T cells (Figure 1) and naive CD8 T cells in CD8 T cells (Figure 2) with concomitant increased frequencies of effector memory CD4 T cells in CD4 T cells (Figure 3) and effector memory CD8 T cells in CD8 T cells (Figure 4). Expression of CD44 on peripheral blood T cells (Figure 5) and CD4 T cells (Figure 6) was increased.
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 50 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ctla4: a T to C transition at base pair 60,912,491 (v38) on chromosome 1, or base pair 3,467 in the GenBank genomic region NC_000067. The strongest association was found with a recessive model of inheritance to the effector memory CD4 T cell phenotype, wherein 10 variant homozygotes departed phenotypically from 39 homozygous reference mice and 45 heterozygous mice with a P value of 1.635 x 10-17 (Figure 7). The mutation corresponds to residue 324 in the mRNA sequence NM_009843 within exon 2 of 4 total exons.
309 AGCTTTCCATGTGAATATTCACCATCACACAAC
55 -S--F--P--C--E--Y--S--P--S--H--N-
|
The mutated nucleotide is indicated in red. The mutation results in a tyrosine to histidine substitution at position 60 (Y60H) in the CTLA4 protein, and is strongly predicted by Polyphen-2 to be damaging (score = 0.998).
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Ctla4 encodes cytotoxic T-lymphocyte antigen 4 (CTLA4; alternatively, CD152), a member of the immunoglobulin superfamily and the CD28 family of receptors. The CD28 family also includes CD28, ICOS, PD-1, and BTLA (1). All members of the CD28 family function in regulating T cell activation and tolerance. CTLA4 is a single-pass transmembrane protein with an Ig-like V-type domain (Figure 8). Amino acids 134 to 139 in the V-type domain are required for interaction with the B7 family ligands CD80 (B7-1) and CD86 (B7-2) expressed on antigen-presenting cells (e.g., dendritic cells, macrophages, and B cells) (2). CTLA4 has a PI3K SH2-binding site as well as other putative SH2 domain-binding motifs and a SH3 domain-association sequence (3). The cytoplasmic domain of CTLA4, namely the unphosphorylated YVKM sequence at Tyr201, functions in the endocytosis of CTLA4 by associating with the medium chain subunit AP50 of the clathrin adaptor AP-2 (4;5). Phosphorylation of Tyr201 prevents binding to the AP-2 adapter complex, blocks endocytosis, and leads to retention of CTLA4 on the cell surface. CTLA4 is also phosphorylated at Tyr218. The Src family tyrosine kinases Fyn, Lyn (see the record for Lemon), and Lck (see the record for iconoclast) as well as Rlk (resting lymphocyte kinase) and JAK2 can phosphorylate both sites (6). CTLA4 is expressed on the surface of T cells as a homodimer. Amino acids 46 to 50 and 150 to 155 mediate homodimerization. N-linked glycosylation at Asn108, Asn113, and Asn145 is essential for CTLA4 dimerization. Alternative splicing of CTLA4 can produce a CTLA4 mRNA that skips the transmembrane domain-encoding exon 3 (7;8). The alternatively spliced CTLA4 encodes a soluble form of CTLA4 (sCTLA4) [(7); reviewed in (9)]]. The soluble CTLA4 transcript is expressed in lymph nodes, spleen, CD4 and CD8 T cells, B cells, and monocytes (7). sCTLA4 exhibits CD80/CD86 binding activity. Increased levels of sCTLA4 are found in patients with autoimmune diseases such as Graves' disease (8;10;11), Hashimoto’s thyroiditis (8;11), myasthenia gravis (12), systemic lupus erythematosus (13;14), systemic sclerosis (15), celiac disease (16), autoimmune pancreatitis (17), and rheumatoid arthritis (18). The mechanism by which sCTLA4 functions is unknown, but sCTLA4 may block the interaction of CD80/CD86 with CD28, inhibiting early T cell activation. Alternatively, sCTLA4 could complete for binding of CD80/CD86 with CTLA4, leading to reduced inhibitory signaling. The complementary mutation results in a tyrosine to histidine substitution at position 60 (Y60H); Tyr is within the Ig-like V-type domain.
|
Expression/Localization | CTLA4 is expressed at high levels in spleen, thymus, and peripheral blood leukocytes (19). CTLA4 is expressed by both CD4+ and CD8+ T cells as well as on the surface of double-positive thymocytes (20;21). CD4+CD25+ regulatory T (Treg) cells constitutively express CTLA4, and TCR- or CD28-mediated conventional T cell activation induces CTLA4 expression. CTLA4 expression has also been detected in B cells, monocytes, granulocytes, CD34+ stem cells, and placental fibroblasts (22-25). The function of CTLA4 in non-T cells is unknown. CTLA4 is predominantly localized in intracellular vesicles of Treg cells or activated conventional T cells. CTLA4 undergoes clathrin-mediated endocytosis in the absence of ligand binding (5;26). Interaction between CLTA4 and AP2 mediates rapid internalization. LRBA binding to CTLA4 putatively results in recycling of CTLA4 to the plasma membrane, and AP1 interaction with CTLA4 putatively mediates CTLA4 trafficking to lysosomal compartments.
|
Background |
Naïve T cells require two signals in order to proliferate and differentiate into effector T cells. The first signal is antigen-specific and occurs when the T cell receptor interacts with a peptide presented with MHC antigens. The second signal is costimulatory and is mediated by CD80/CD86 binding to CD28. The mechanism by which CD28 affects T cell activation is unknown. Activated CD28 putatively disassociates from the serine/threonine phosphatase PP2A (phosphatase 2A) and recruits PI3K (phosphatidylinositol 3-kinase) and GRB2 (growth factor receptor bound protein 2). PI3K activation would then induce the phosphorylation of phosphatidylinositol (PI) into phosphatidylinositol 3-phosphate (PIP3) and/or the activation of protein kinase B (PKB/Akt). Akt activation would subsequently result in NF-κB activation, BCL-XL upregulation, T-cell survival, and IL-2 production [reviewed in (27)]. CTLA4 is one of three inhibitory molecules (i.e., CTLA4, PD-1 [programmed death-1], and KIRs [killer inhibitory receptors)] expressed on the surface of T cells (Figure 9). CTLA4 inhibits T cell activation by reducing IL-2 production, reducing IL-2 receptor expression, and by arresting T cells at the G1 phase of the cell cycle (28;29). Little is known about CTLA4-associated signaling. It is unclear whether CTLA4 inhibits T cell responses by antagonizing CD28 (by scavenging CD80/CD86 and/or by sequestering intracellular molecules that can bind both receptors) and/or by directly/indirectly reducing TCR signals. CTLA4 can inhibit T cell responses in the absence of CD28 (30). Other studies showed that expression of a tailless CTLA4 did not prevent T cell activation or proliferation, indicating that the intracellular portion of CTLA4 does mediate inhibitory effects (31). CTLA4 putatively suppresses ERK or JNK activity downstream of the TCR (32). CTLA4 activation attenuates AP-1, NFAT and NF-κB nuclear transcription factor activity in activated CD4+ T cells and inhibits the DNA binding of AP-1 and NFAT complexes in the nucleus (33). CTLA4 also putatively recruits the tyrosine phosphatase SHP-2 through a YVKM motif in its cytoplasmic domain (34). SHP-2 would subsequently dephosphorylate factors involved in TCR signaling. However, studies showed that the tyrosine residue in the YVKM motif is not required for CTLA4 function (35;36). Mutations in CTLA4 are associated with several human diseases related to immune dysregulation and autoimmunity (Table 1).
Human disease
|
OMIM
|
Patient symptoms
|
References
|
Autoimmune lymphoproliferative syndrome, type V (alternatively, CHAI [CTLA-4 haploinsufficiency with autoimmune infiltration] disease)
|
#616100
|
Autoimmune thrombocytopenias and abnormal lymphocytic infiltration of nonlymphoid organs, including the lungs, brain, and gastrointestinal tract, resulting in enteropathy; loss of circulating B cells and/or immunoglobulin levels
|
(37;38)
|
{Susceptibility to celiac disease-3}
|
#609755
|
Malabsorption resulting from inflammatory injury to the mucosa of the small intestine
|
(39-41)
|
{Insulin-dependent diabetes mellitus-12}
|
#601388
|
Elevated blood glucose levels
|
(41-43)
|
{Susceptibility to Graves disease-1}
|
%27500
|
Constitutive activation of the thyrotropin receptor and increased levels of thyroid hormone
|
(44;45)
|
{Hashimoto thyroiditis}
|
#140300
|
Hypothyroidism
|
(8;46)
|
{Susceptibility to systemic lupus erythematosus}
|
#152700
|
Autoimmune disease that induces inflammation and subsequent injury of multiple organs
|
(47;48)
|
Anti-CTLA4 antibodies have been developed for the use against metastatic melanoma, prostate cancer, ovarian cancer, and renal cancer. Blocking CLTA4 with anti-CTLA4 increases antitumor responses by permitting the immune system to respond to an antigen.
|
Putative Mechanism | Ctla4-deficient (Ctla4-/-) mice exhibited enlarged lymph nodes and spleens due to accumulation of T-cells as well as higher serum immunoglobin concentrations compared to wild-type mice (49;50). Ctla4-/- mice showed an increased frequency of double-negative T cells with a concomitant reduced number of single-positive T cells (51). Ctla4-/- mice showed increased frequencies of IFN-gamma, IL-17, IL-2, and IL-4 Foxp3-CD4+ T cells in the spleen and lymph nodes (52). Ctla4-/- mice died at 3 to 4 weeks of age due to myocardial failure due to lymphocytic infiltration (49-54). The phenotype of the complementary mice indicate loss of CTLA4-associated function; however, lethality was not observed in the complementary mice, indicating that some residual CTLA4 function may remain.
|
Primers |
PCR Primer
complementary_pcr_F: TGAGCTTGCAGGAGTTCATC
complementary_pcr_R: ATGAGTTCCACCTTGCAGAG
Sequencing Primer
complementary_seq_F: TCCAAGATGAACCTCCCCTGG
complementary_seq_R: AACAGCTCTCAGTCCTTGGATGG
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 407 nucleotides is amplified (chromosome 1, + strand):
1 tgagcttgca ggagttcatc caagatgaac ctcccctggc ctcaggtgtg gcctaatagt 61 tcaaaccgtg gatgatcatg agcccactaa gtgccctttg gactttccat gtcagccata 121 caggtgaccc aaccttcagt ggtgttggct agcagccatg gtgtcgccag ctttccatgt 181 gaatattcac catcacacaa cactgatgag gtccgggtga ctgtgctgcg gcagacaaat 241 gaccaaatga ctgaggtctg tgccacgaca ttcacagaga agaatacagt gggcttccta 301 gattacccct tctgcagtgg tacctttaat gaaagcagag tgaacctcac catccaagga 361 ctgagagctg ttgacacggg actgtacctc tgcaaggtgg aactcat
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References |
2. Harper, K., Balzano, C., Rouvier, E., Mattei, M. G., Luciani, M. F., and Golstein, P. (1991) CTLA-4 and CD28 Activated Lymphocyte Molecules are Closely Related in both Mouse and Human as to Sequence, Message Expression, Gene Structure, and Chromosomal Location. J Immunol. 147, 1037-1044.
5. Shiratori, T., Miyatake, S., Ohno, H., Nakaseko, C., Isono, K., Bonifacino, J. S., and Saito, T. (1997) Tyrosine Phosphorylation Controls Internalization of CTLA-4 by Regulating its Interaction with Clathrin-Associated Adaptor Complex AP-2. Immunity. 6, 583-589.
6. Miyatake, S., Nakaseko, C., Umemori, H., Yamamoto, T., and Saito, T. (1998) Src Family Tyrosine Kinases Associate with and Phosphorylate CTLA-4 (CD152). Biochem Biophys Res Commun. 249, 444-448.
7. Oaks, M. K., Hallett, K. M., Penwell, R. T., Stauber, E. C., Warren, S. J., and Tector, A. J. (2000) A Native Soluble Form of CTLA-4. Cell Immunol. 201, 144-153.
10. Daroszewski, J., Pawlak, E., Karabon, L., Frydecka, I., Jonkisz, A., Slowik, M., and Bolanowski, M. (2009) Soluble CTLA-4 Receptor an Immunological Marker of Graves' Disease and Severity of Ophthalmopathy is Associated with CTLA-4 Jo31 and CT60 Gene Polymorphisms. Eur J Endocrinol. 161, 787-793.
11. Saverino, D., Brizzolara, R., Simone, R., Chiappori, A., Milintenda-Floriani, F., Pesce, G., and Bagnasco, M. (2007) Soluble CTLA-4 in Autoimmune Thyroid Diseases: Relationship with Clinical Status and Possible Role in the Immune Response Dysregulation. Clin Immunol. 123, 190-198.
12. Wang, X. B., Kakoulidou, M., Giscombe, R., Qiu, Q., Huang, D., Pirskanen, R., and Lefvert, A. K. (2002) Abnormal Expression of CTLA-4 by T Cells from Patients with Myasthenia Gravis: Effect of an AT-Rich Gene Sequence. J Neuroimmunol. 130, 224-232.
13. Wong, C. K., Lit, L. C., Tam, L. S., Li, E. K., and Lam, C. W. (2005) Aberrant Production of Soluble Costimulatory Molecules CTLA-4, CD28, CD80 and CD86 in Patients with Systemic Lupus Erythematosus. Rheumatology (Oxford). 44, 989-994.
15. Sato, S., Fujimoto, M., Hasegawa, M., Komura, K., Yanaba, K., Hayakawa, I., Matsushita, T., and Takehara, K. (2004) Serum Soluble CTLA-4 Levels are Increased in Diffuse Cutaneous Systemic Sclerosis. Rheumatology (Oxford). 43, 1261-1266.
16. Simone, R., Brizzolara, R., Chiappori, A., Milintenda-Floriani, F., Natale, C., Greco, L., Schiavo, M., Bagnasco, M., Pesce, G., and Saverino, D. (2009) A Functional Soluble Form of CTLA-4 is Present in the Serum of Celiac Patients and Correlates with Mucosal Injury. Int Immunol. 21, 1037-1045.
17. Umemura, T., Ota, M., Hamano, H., Katsuyama, Y., Muraki, T., Arakura, N., Kawa, S., and Kiyosawa, K. (2008) Association of Autoimmune Pancreatitis with Cytotoxic T-Lymphocyte Antigen 4 Gene Polymorphisms in Japanese Patients. Am J Gastroenterol. 103, 588-594.
18. Toussirot, E., Saas, P., Deschamps, M., Pouthier, F., Perrot, L., Perruche, S., Chabod, J., Tiberghien, P., and Wendling, D. (2009) Increased Production of Soluble CTLA-4 in Patients with Spondylarthropathies Correlates with Disease Activity. Arthritis Res Ther. 11, R101.
19. Ling, V., Wu, P. W., Finnerty, H. F., Sharpe, A. H., Gray, G. S., and Collins, M. (1999) Complete Sequence Determination of the Mouse and Human CTLA4 Gene Loci: Cross-Species DNA Sequence Similarity Beyond Exon Borders. Genomics. 60, 341-355.
20. Brunet, J. F., Denizot, F., Luciani, M. F., Roux-Dosseto, M., Suzan, M., Mattei, M. G., and Golstein, P. (1987) A New Member of the Immunoglobulin Superfamily--CTLA-4. Nature. 328, 267-270.
21. Wagner, D. H.,Jr, Hagman, J., Linsley, P. S., Hodsdon, W., Freed, J. H., and Newell, M. K. (1996) Rescue of Thymocytes from Glucocorticoid-Induced Cell Death Mediated by CD28/CTLA-4 Costimulatory Interactions with B7-1/B7-2. J Exp Med. 184, 1631-1638.
23. Kaufman, K. A., Bowen, J. A., Tsai, A. F., Bluestone, J. A., Hunt, J. S., and Ober, C. (1999) The CTLA-4 Gene is Expressed in Placental Fibroblasts. Mol Hum Reprod. 5, 84-87.
24. Wang, X. B., Giscombe, R., Yan, Z., Heiden, T., Xu, D., and Lefvert, A. K. (2002) Expression of CTLA-4 by Human Monocytes. Scand J Immunol. 55, 53-60.
26. Linsley, P. S., Bradshaw, J., Greene, J., Peach, R., Bennett, K. L., and Mittler, R. S. (1996) Intracellular Trafficking of CTLA-4 and Focal Localization Towards Sites of TCR Engagement. Immunity. 4, 535-543.
28. Walunas, T. L., Lenschow, D. J., Bakker, C. Y., Linsley, P. S., Freeman, G. J., Green, J. M., Thompson, C. B., and Bluestone, J. A. (1994) CTLA-4 can Function as a Negative Regulator of T Cell Activation. Immunity. 1, 405-413.
31. Masteller, E. L., Chuang, E., Mullen, A. C., Reiner, S. L., and Thompson, C. B. (2000) Structural Analysis of CTLA-4 Function in Vivo. J Immunol. 164, 5319-5327.
34. Marengere, L. E., Waterhouse, P., Duncan, G. S., Mittrucker, H. W., Feng, G. S., and Mak, T. W. (1996) Regulation of T Cell Receptor Signaling by Tyrosine Phosphatase SYP Association with CTLA-4. Science. 272, 1170-1173.
35. Baroja, M. L., Luxenberg, D., Chau, T., Ling, V., Strathdee, C. A., Carreno, B. M., and Madrenas, J. (2000) The Inhibitory Function of CTLA-4 does Not Require its Tyrosine Phosphorylation. J Immunol. 164, 49-55.
36. Nakaseko, C., Miyatake, S., Iida, T., Hara, S., Abe, R., Ohno, H., Saito, Y., and Saito, T. (1999) Cytotoxic T Lymphocyte Antigen 4 (CTLA-4) Engagement Delivers an Inhibitory Signal through the Membrane-Proximal Region in the Absence of the Tyrosine Motif in the Cytoplasmic Tail. J Exp Med. 190, 765-774.
37. Kuehn, H. S., Ouyang, W., Lo, B., Deenick, E. K., Niemela, J. E., Avery, D. T., Schickel, J. N., Tran, D. Q., Stoddard, J., Zhang, Y., Frucht, D. M., Dumitriu, B., Scheinberg, P., Folio, L. R., Frein, C. A., Price, S., Koh, C., Heller, T., Seroogy, C. M., Huttenlocher, A., Rao, V. K., Su, H. C., Kleiner, D., Notarangelo, L. D., Rampertaap, Y., Olivier, K. N., McElwee, J., Hughes, J., Pittaluga, S., Oliveira, J. B., Meffre, E., Fleisher, T. A., Holland, S. M., Lenardo, M. J., Tangye, S. G., and Uzel, G. (2014) Immune Dysregulation in Human Subjects with Heterozygous Germline Mutations in CTLA4. Science. 345, 1623-1627.
38. Schubert, D., Bode, C., Kenefeck, R., Hou, T. Z., Wing, J. B., Kennedy, A., Bulashevska, A., Petersen, B. S., Schaffer, A. A., Gruning, B. A., Unger, S., Frede, N., Baumann, U., Witte, T., Schmidt, R. E., Dueckers, G., Niehues, T., Seneviratne, S., Kanariou, M., Speckmann, C., Ehl, S., Rensing-Ehl, A., Warnatz, K., Rakhmanov, M., Thimme, R., Hasselblatt, P., Emmerich, F., Cathomen, T., Backofen, R., Fisch, P., Seidl, M., May, A., Schmitt-Graeff, A., Ikemizu, S., Salzer, U., Franke, A., Sakaguchi, S., Walker, L. S. K., Sansom, D. M., and Grimbacher, B. (2014) Autosomal Dominant Immune Dysregulation Syndrome in Humans with CTLA4 Mutations. Nat Med. 20, 1410-1416.
39. Djilali-Saiah, I., Schmitz, J., Harfouch-Hammoud, E., Mougenot, J. F., Bach, J. F., and Caillat-Zucman, S. (1998) CTLA-4 Gene Polymorphism is Associated with Predisposition to Coeliac Disease. Gut. 43, 187-189.
40. van Belzen, M. J., Mulder, C. J., Zhernakova, A., Pearson, P. L., Houwen, R. H., and Wijmenga, C. (2004) CTLA4 +49 A/G and CT60 Polymorphisms in Dutch Coeliac Disease Patients. Eur J Hum Genet. 12, 782-785.
41. Zhernakova, A., Eerligh, P., Barrera, P., Wesoly, J. Z., Huizinga, T. W., Roep, B. O., Wijmenga, C., and Koeleman, B. P. (2005) CTLA4 is Differentially Associated with Autoimmune Diseases in the Dutch Population. Hum Genet. 118, 58-66.
42. Nistico, L., Buzzetti, R., Pritchard, L. E., Van der Auwera, B., Giovannini, C., Bosi, E., Larrad, M. T., Rios, M. S., Chow, C. C., Cockram, C. S., Jacobs, K., Mijovic, C., Bain, S. C., Barnett, A. H., Vandewalle, C. L., Schuit, F., Gorus, F. K., Tosi, R., Pozzilli, P., and Todd, J. A. (1996) The CTLA-4 Gene Region of Chromosome 2q33 is Linked to, and Associated with, Type 1 Diabetes. Belgian Diabetes Registry. Hum Mol Genet. 5, 1075-1080.
43. Marron, M. P., Raffel, L. J., Garchon, H. J., Jacob, C. O., Serrano-Rios, M., Martinez Larrad, M. T., Teng, W. P., Park, Y., Zhang, Z. X., Goldstein, D. R., Tao, Y. W., Beaurain, G., Bach, J. F., Huang, H. S., Luo, D. F., Zeidler, A., Rotter, J. I., Yang, M. C., Modilevsky, T., Maclaren, N. K., and She, J. X. (1997) Insulin-Dependent Diabetes Mellitus (IDDM) is Associated with CTLA4 Polymorphisms in Multiple Ethnic Groups. Hum Mol Genet. 6, 1275-1282.
44. Heward, J. M., Allahabadia, A., Armitage, M., Hattersley, A., Dodson, P. M., Macleod, K., Carr-Smith, J., Daykin, J., Daly, A., Sheppard, M. C., Holder, R. L., Barnett, A. H., Franklyn, J. A., and Gough, S. C. (1999) The Development of Graves' Disease and the CTLA-4 Gene on Chromosome 2q33. J Clin Endocrinol Metab. 84, 2398-2401.
45. Kouki, T., Sawai, Y., Gardine, C. A., Fisfalen, M. E., Alegre, M. L., and DeGroot, L. J. (2000) CTLA-4 Gene Polymorphism at Position 49 in Exon 1 Reduces the Inhibitory Function of CTLA-4 and Contributes to the Pathogenesis of Graves' Disease. J Immunol. 165, 6606-6611.
46. Donner, H., Braun, J., Seidl, C., Rau, H., Finke, R., Ventz, M., Walfish, P. G., Usadel, K. H., and Badenhoop, K. (1997) Codon 17 Polymorphism of the Cytotoxic T Lymphocyte Antigen 4 Gene in Hashimoto's Thyroiditis and Addison's Disease. J Clin Endocrinol Metab. 82, 4130-4132.
48. Barreto, M., Santos, E., Ferreira, R., Fesel, C., Fontes, M. F., Pereira, C., Martins, B., Andreia, R., Viana, J. F., Crespo, F., Vasconcelos, C., Ferreira, C., and Vicente, A. M. (2004) Evidence for CTLA4 as a Susceptibility Gene for Systemic Lupus Erythematosus. Eur J Hum Genet. 12, 620-626.
49. Waterhouse, P., Penninger, J. M., Timms, E., Wakeham, A., Shahinian, A., Lee, K. P., Thompson, C. B., Griesser, H., and Mak, T. W. (1995) Lymphoproliferative Disorders with Early Lethality in Mice Deficient in Ctla-4. Science. 270, 985-988.
50. Tivol, E. A., Borriello, F., Schweitzer, A. N., Lynch, W. P., Bluestone, J. A., and Sharpe, A. H. (1995) Loss of CTLA-4 Leads to Massive Lymphoproliferation and Fatal Multiorgan Tissue Destruction, Revealing a Critical Negative Regulatory Role of CTLA-4. Immunity. 3, 541-547.
52. Wing, K., Onishi, Y., Prieto-Martin, P., Yamaguchi, T., Miyara, M., Fehervari, Z., Nomura, T., and Sakaguchi, S. (2008) CTLA-4 Control Over Foxp3+ Regulatory T Cell Function. Science. 322, 271-275.
53. Oosterwegel, M. A., Mandelbrot, D. A., Boyd, S. D., Lorsbach, R. B., Jarrett, D. Y., Abbas, A. K., and Sharpe, A. H. (1999) The Role of CTLA-4 in Regulating Th2 Differentiation. J Immunol. 163, 2634-2639.
54. Luhder, F., Chambers, C., Allison, J. P., Benoist, C., and Mathis, D. (2000) Pinpointing when T Cell Costimulatory Receptor CTLA-4 must be Engaged to Dampen Diabetogenic T Cells. Proc Natl Acad Sci U S A. 97, 12204-12209.
|
Science Writers | Anne Murray |
Illustrators | Diantha La Vine |
Authors | Jin Huk Choi, Xue Zhong, and Bruce Beutler |