Phenotypic Mutation 'Cpg5'

• Allele: Cpg5
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 106,224,689 bp (GRCm38)
• Base Change: T ⇒ C (forward strand)
• Gene: Tlr9
• Gene Name: toll-like receptor 9
• Chromosomal Location: 106,222,598-106,226,883 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q9EQU3
• PDB Structure: Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION] ; Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION] ; Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION] ; Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION] ; Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000082207; Gene: ENSMUSG00000045322; AA Change: L393P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRR	62	85	1.49e2	SMART
LRR	122	144	1.41e1	SMART
LRR	198	221	4.98e-1	SMART
LRR	283	306	6.59e1	SMART
LRR	307	332	1.62e1	SMART
Blast:LRR	333	361	8e-6	BLAST
LRR	390	413	7.38e1	SMART
LRR	414	440	1.86e2	SMART
LRR	496	520	1.81e2	SMART
LRR	521	544	6.05e0	SMART
LRR	545	568	2.27e2	SMART
LRR	575	599	4.58e1	SMART
LRR	628	651	3.87e1	SMART
LRR_TYP	677	700	3.39e-3	SMART
LRR	702	724	2.27e2	SMART
LRR	726	748	3.09e2	SMART
Blast:LRRCT	761	810	4e-11	BLAST
Pfam:TIR	870	1029	7.4e-11	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000062241)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.117)
• Phenotypic Category: Autosomal Semidominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Sperm, gDNA
• MMRRC Submission: 030344-UCD
• Last Updated: 2016-05-13 3:09 PM by Peter Jurek
• Record Created: unknown
• Record Posted: 2008-03-06
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Nengming Xiao, Bruce Beutler

Accession Number

NCBI RefSeq: NM_031178; MGI: 1932389

Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(1) Gene trapped(1) Chemically induced(7)

Phenotypic Description

The CpG5 phenotype was identified in a screen of ENU-induced G3 mutants for altered response to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Peritoneal macrophages from heterozygous CpG5 mice produce normal amounts of tumor necrosis factor (TNF)-α in response to all TLR ligands tested, except oligodeoxynucleotides containing CpG motifs (CpG ODNs). Upon stimulation with CpG ODN, heterozygous CpG5 macrophages produce reduced amounts of TNF-α. In addition, naïve B cells from whole blood of heterozygous CpG5 mice fail to proliferate upon stimulation with CpG ODN in vitro, a response recently demonstrated to be specific for CpG ODN among other TLR agonists (1).

 

Homozygous CpG5 mice will be tested in both the TNF bioassay and the B cell proliferation assay. Results should indicate whether CpG5 is dominant or semidominant; it has been tentatively classified as semidominant.

 

Although not all of the same phenotypes have been examined, those tested are identical between CpG1, CpG2, CpG3 and CpG5 mice. Sequence analysis revealed that all four strains contain mutations in Tlr9. However, the positions of the mutations differ, with the CpG1, CpG3 and CpG5 mutations located in the sixteenth, sixth and ­­fourteenth extracellular leucine-rich repeats (LRR), respectively, and the CpG2 mutation located in the cytoplasmic Toll/IL-1R (TIR) domain. In addition to CpG1, CpG2, CpG3 and CpG5, another strain of mice, designated effete, also exhibits impaired TNF-α responses to CpG ODN treatment. The mutant has no TLR9 mutation; the causative mutation is under investigation.

Nature of Mutation

A Tlr9 mutation corresponding to a T to C transition at position 1284, in exon 2 of 2 total exons, was identified for CpG5.

 

1268 GCCGATCTGCCCAAACTCCACACTCTGCATCTT

388  -A--D--L--P--K--L--H--T--L--H--L-

 

The mutated nucleotide is indicated in red lettering, and corresponds to the missense error L393P in the polypeptide chain.

Protein Prediction

Figure 1. Protein and domain structure of TLR9. (A) Schematic representation of TLR9 based on crystalized structures of mouse TLR9 LRR (PBD 3WPF) and human TLR2 TIR (1FYW) domains. The residue affected by the CpG5 mutation is highlighted. 3D image was created using UCSF Chimera. (B) TLR9 is a 1032 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane (TM) domain (blue) and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain (green). The CpG5 mutation (red asterisk) results in a leucine to proline change at position 393 of the TLR9 protein in the predicted fourteenth LRR. This image is interactive. Click on the image to view other mutations found in TLR9. Click on each mutation for more specific information.

The CpG5 mutation results in a leucine to proline change at position 393 of the TLR9 protein. L393 is the first leucine residue of the predicted fourteenth LRR module of the TLR9 ectodomain (Figure 1) (2).

Please see the record for CpG1 for information about Tlr9.

Putative Mechanism

The CpG5 mutation substitutes leucine with proline at position 393 of the TLR9 protein, which is the predicted first leucine of the fourteenth LRR module in the ectodomain. No tertiary structural data presently exist for TLR9, making it difficult to hypothesize how the CpG5 mutation could affect either ligand binding or receptor dimerization.  Recently, the crystal structure of the related TLR3 heterodimer bound to double-stranded (ds) RNA has been elucidated (see record for CpG1).  The ligand-bound TLR3 heterodimer forms an M-shape with the dsRNA binding to the concave surfaces of the TLR3 heterodimer at two locations on each ectodomain (3). It has been hypothesized that TLR7, 8 and 9 ligands may also bind to the concave surface of the ectodomain at a site made up by insertions at LRR 2, 5, 8 and 11 (4).  The CpG5 mutation might somehow disrupt ligand binding and/or receptor dimerization, or destroy proper folding or localization of the receptor.  The CpG5 phenotype supports any and all of these possibilities.

Primers

Primers cannot be located by automatic search.

Genotyping

CpG5 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. The same primers are used for PCR amplification and for sequencing.

 

Primers

CpG1(F): 5’-AACTCTTCCTGGTTCCAAGGTCTG -3’

CpG1(R): 5’-GGGTATGAATGTCATTGTGTGCC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:15

3) 60°C             0:30

4) 68°C             1:00

5) repeat steps (2-4) 40X

6) 68°C             7:00

7) 4°C               ∞

 

The following sequence of 850 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Tlr9) is amplified:

 

1812             aactcttcc tggttccaag gtctggtcaa cctctcggtg ctggacctaa

1861 gcgagaactt tctctatgaa agcatcaccc acaccaatgc ctttcagaac ctaacccgcc

1921 tgcgcaagct caacctgtcc ttcaattacc gcaagaaggt atcctttgcc cgcctccacc

1981 tggcaagttc ctttaagaac ctggtgtcac tgcaggagct gaacatgaac ggcatcttct

2041 tccgcttgct caacaagtac acgctcagat ggctggccga tctgcccaaa ctccacactc

2101 tgcatcttca aatgaacttc atcaaccagg cacagctcag catctttggt accttccgag

2161 cccttcgctt tgtggacttg tcagacaatc gcatcagtgg gccttcaacg ctgtcagaag

2221 ccacccctga agaggcagat gatgcagagc aggaggagct gttgtctgcg gatcctcacc

2281 cagctccgct gagcacccct gcttctaaga acttcatgga caggtgtaag aacttcaagt

2341 tcaccatgga cctgtctcgg aacaacctgg tgactatcaa gccagagatg tttgtcaatc

2401 tctcacgcct ccagtgtctt agcctgagcc acaactccat tgcacaggct gtcaatggct

2461 ctcagttcct gccgctgact aatctgcagg tgctggacct gtcccataac aaactggact

2521 tgtaccactg gaaatcgttc agtgagctac cacagttgca ggccctggac ctgagctaca

2581 acagccagcc ctttagcatg aagggtatag gccacaattt cagttttgtg acccatctgt

2641 ccatgctaca gagccttagc ctggcacaca atgacattca taccc

 

Primer binding sites are underlined; the mutated T is shown in red text.

References

   1.  Jiang, W., Lederman, M. M., Harding, C. V., Rodriguez, B., Mohner, R. J., and Sieg, S. F. (2007) TLR9 stimulation drives naive B cells to proliferate and to attain enhanced antigen presenting function, Eur. J Immunol. 37, 2205-2213.

   2.  Matsushima, N., Tanaka, T., Enkhbayar, P., Mikami, T., Taga, M., Yamada, K., and Kuroki, Y. (2007) Comparative sequence analysis of leucine-rich repeats (LRRs) within vertebrate toll-like receptors, BMC. Genomics 8, 124.  

   3.   Liu, L., Botos, I., Wang, Y., Leonard, J. N., Shiloach, J., Segal, D. M., and Davies, D. R. (2008) Structural basis of toll-like receptor 3 signaling with double-stranded RNA, Science 320, 379-381.     

   4.  Bell, J. K., Mullen, G. E., Leifer, C. A., Mazzoni, A., Davies, D. R., and Segal, D. M. (2003) Leucine-rich repeats and pathogen recognition in Toll-like receptors, Trends Immunol. 24, 528-533.