Phenotypic Mutation 'bat' (pdf version)
Gene Symbol Frem1
Gene Name Fras1 related extracellular matrix protein 1
Synonym(s) heb, QBRICK, BC037594, D430009N09, D630008K06
Accession Number

NCBI RefSeq: NM_177863; MGI: 2670972

Allele bat
Institutional SourceBeutler Lab
Mapped Yes 
Chromosome 4
Chromosomal Location 82,897,927-83,052,339 bp (-)
Type of Mutation CRITICAL SPLICE DONOR SITE (1 bp from exon)
DNA Base Change
(Sense Strand)
T to C at 82,983,060 bp (GRCm38)
Amino Acid Change
Ref Sequences
NCBI: NP_808531.2 (fasta)
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 986 8.64e-36 PROSPERO
internal_repeat_1 1045 1724 8.64e-36 PROSPERO
Pfam:Calx-beta 1750 1848 1.2e-4 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Phenotypic Category limbs/digits/tail phenotype, renal/urinary system, skin/coat/nails, vision/eye
Penetrance 100% on C57BL/6J background; approximately 70% on C57BL/6J:C3H/HeJ hybrid background 
Alleles Listed at MGI

All alleles(4) : Targeted, knock-out(1) Spontaneous(1) Chemically induced(2)

Lab Alleles APN: IGL00155:Frem1, IGL01069:Frem1, IGL01106:Frem1, IGL01398:Frem1, IGL01617:Frem1
UTSW: R0010:Frem1, R0010:Frem1, R0115:Frem1, R0125:Frem1, R0280:Frem1, R0504:Frem1, R0519:Frem1, R0631:Frem1, R0645:Frem1, R0743:Frem1, R0781:Frem1, R1110:Frem1, R1115:Frem1, R1130:Frem1, R1173:Frem1, R1349:Frem1, R1464:Frem1, R1541:Frem1, X0013:Frem1, X0017:Frem1
Mode of Inheritance Autosomal Recessive
Local Stock Embryos
Repository

MMRRC: 030387-UCD

Last Updated 12/12/2013 6:56 PM by Stephen Lyon
Record Created unknown
Record Posted 02/14/2008
Phenotypic Description
Figure 1. (A) Adult bat mice display cryptophthalmos. (B) Bat embryos develop subepidermal blisters around the eyes and sides of the head from ~13.5 DPC (arrowheads). Figure is reproduced from reference (1).
Bat was identified as a visible phenotype among ENU-induced G3 mice. Homozygous bat mice display a range of defects including cryptophthalmos (skin covering the globe of the eye), occasional hindlimb syndactyly (fusion of fingers or toes), and renal anomalies (unilateral agenesis of the kidney) (1). From 13.5 dpc (days post conception), bat embryos develop subepidermal blisters (“blebs”) around the eyes and the sides of the head; postnatal bat mice do not exhibit such blebs. Light microscopic analysis reveals that blebs are characterized by a separation of the dermal and epidermal layers of the skin, and by electron microscopy, it is seen that the dissection occurs at the basement membrane underlying epidermal cells. Bat mutants have no true eyelids; eyes are permanently closed due to a pseudoblepharon (a layer of skin covering the eye), occurring either unilaterally or bilaterally. Approximately two-thirds of the homozygous stock is affected in both eyes, with the remaining one-third in only one eye (absence of a pseudoblepharon in both eyes is rarely observed). Histological analysis reveals that the corneal epithelium, conjunctiva epithelium, and eyelid epithelium are absent.
 
Unilateral renal agenesis is found in approximately 20% of adult bat homozygotes.

 

Nature of Mutation
The bat mutation mapped to Chromosome 4 and corresponds to a T to C transition in the donor splice site of intron 25 (GTACT->GCACT) of the Frem1 gene (position ­85133 in the Genbank genomic region NC_000070 for linear genomic DNA sequence of Frem1). RT-PCR analysis indicates that the mutation results in skipping of exon 25, and destroys the reading frame thereafter. Thus, 39 nucleotides from exon 26 are transcribed, encoding 12 aberrant amino acids, followed by a premature stop codon. No splicing between exons 25 and 26 is detected. Frem1 contains 36 exons.
 
     <--exon 24  <--exon 25 intron 25--> exon 26-->
80779 ACAATCCAG……ACAACAACAGGTACTTTCC……………GTGAATTCATCCACGAGCGATTTAGCCAGAAGGACTTAA 86136
1635  -T--I--Q-……-T--T--T-               -V--N--S--S--T--S--D--L--A--R--R--T--*  1649
      correct     deleted                                aberrant
 
The donor splice site of intron 25, which is destroyed by the bat mutation, is indicated in blue lettering; the mutated nucleotide is indicated in red lettering.
Protein Prediction
Figure 2. Domain structure of FREM1. The bat mutation introduces 12 aberrant amino acids before premature termination of FREM1.
FREM1 is a 2191 amino acid protein with similarity to the extracellular matrix (ECM) protein encoded by Fras1 [Fraser syndrome 1 homolog (human)]. Sequence analysis of FREM1 reveals several predicted structural domains (Figure 2). Following an N-terminal signal sequence are twelve chondroitin sulfate proteoglycan (CSPG) repetitive elements, first described for the NG2 proteoglycan core protein (also called CSPG4) (2;3). Weak sequence similarity is found between CSPG and cadherin repeats, and comparison of the predicted structure of the CSPG repeat and known cadherin repeat structure suggests that they share the same secondary structural fold (3). CSPG repeat domains are thought to form a structural unit containing six β-strands (as in the cadherin repeat in the second domain of N-cadherin), with multiple CSPG repeats folding into a rod-like three dimensional structure (3). Based on studies of the CSPG repeat region of NG2, it has been proposed that CSPG repeats serve as attachment sites for glycosaminoglycans (2), as collagen-binding sites (4), or as binding sites for growth factors [basic fibroblast growth factor (bFGF) and platelet-derived growth factor (PDGF)-AA in the case of NG2] (5).
 
A CALX-β domain, found in the intracellular regulatory exchanger loop of Na+-Ca2+ exchange proteins, follows the twelve CSPG repeats in FREM1 (1). CALX-β domains are composed of two Ca2+-binding domains (CBD), one of which is thought to function as the primary Ca2+ sensor in Na+-Ca2+ exchange proteins (6). It is unknown whether Ca2+ sensing or binding is required for FREM1 function. The C terminus of FREM1 contains a C-type lectin domain. Several putative glycosaminoglycan modification sites were identified in FREM1. Unlike FRAS1, no furin, von Willebrand factor type C (VWFC), or PDZ domains are found in FREM1. In addition, no transmembrane domain is predicted for FREM1 (1).
 
Based on the presence of the CSPG repeat domain, two related Frem family genes, Frem2 and Frem3, were identified in mouse and human (1). FREM3 lacks transmembrane and C-terminal PDZ domains; FREM2 contains both of these domains.
 
The bat mutation introduces 12 aberrant amino acids before premature termination of FREM1 toward the C-terminal end of the CSPG repeat elements.
Expression/Localization
In general, Frem1 is expressed at high levels in tissues in which a differentiating epidermis is interacting with an underlying mesenchyme. Thus, Frem1 transcript is expressed during embryogenesis in developing epidermal appendages including vibrissae, cranial and trunk hair follicles, Meibomian glands, teeth, footpads, eyelash primordia, and invaginating mammary glands (1). In the limbs, Frem1 is detected in sheets of dermal cells on the apical and basal surfaces of the digits. Frem1 expression is typically restricted to the mesenchymal components of these tissues. The expression level of Frem1 appears to be highest in dermal cells underlying the epidermis in the head, limbs and eyelids. Embryonic kidneys express Frem1 from 12.5 dpc in the mesenchyme surrounding the branching ureteric tree, and in cells of the differentiating nephron by 13.5 dpc (1). The timing of expression differs among these tissues [e.g. expression turned on first (at 10.5 dpc) in eyelids and sensory vibrissae, and last (at 16.5 dpc) in limbs, paw pads and Meibomian glands], although expression levels in all tissues appear to peak during the period of embryogenesis and then disappear postnatally (except in dermal papillae).
 
FREM1 is most likely secreted from dermal cells into the basement membrane (1;7).
Background
Fraser syndrome (OMIM #219000), first described in 1962, is a rare, multi-system, congenital disorder inherited in an autosomal recessive manner, occurring in about 1 in 10,000 still births and 0.43 in 100,000 live births [reviewed in (8)]. Autozygosity mapping and gene sequencing in Fraser syndrome kindreds have revealed mutations in FRAS1 (9;10) and FREM2 (11). Fraser syndrome is characterized by defects in epidermal adhesion, which result in the formation of large blisters during embryonic development, and lead to a variety of postnatal defects. Major postnatal characteristics of Fraser syndrome include cryptophthalmos, cutaneous syndactyly of varying severity, and abnormal or ambiguous genitalia. Surgery can usually ameliorate the developmental eye defect and results in the ability to distinguish light, dark and some movement. Minor characteristics of Fraser syndrome include laryngeal stenosis (narrowing or constriction of laryngeal airway), renal dysgenesis or agenesis, skeletal defects, pulmonary hyperplasia, ear malformations with conductive deafness, orofacial clefting, gastrointestinal malformations and heart defects. Laryngeal stenosis and renal a/dysgenesis occur so frequently that their characterization as major features of Fraser syndrome has been suggested (8). The diagnosis of patients with Fraser syndrome requires the presence of two major and one minor, or one major and four minor features of the disease.
 
The mouse blebbed (bl), eye blebs (eb), head blebs (heb) and myelencephalic blebs (my) phenotypes (collectively termed “blebs phenotypes”) are caused by mutations in Fras1 (9;10), Grip1 (12), Frem1 (1) and Frem2 (11), respectively. Like humans with Fraser syndrome, these mouse mutants develop large fluid-filled epidermal blisters in utero, and are born with cryptophthalmos, renal anomalies and syndactyly. These phenotypes differ in frequency among mutants, and also between mutants on different genetic backgrounds (8). Defects in neural tube closure have also been reported in eb, my and heb mice (13-15). Interestingly, although linkage has been established in some cases, no mutations in coding sequence or intron/exon boundaries have been found in human FREM1 or GRIP1 in Fraser syndrome patients (8), perhaps suggesting that mutations of these genes in humans leads to prenatal death as a result of more severe developmental phenotypes. As mentioned above (Protein Prediction), FREM3 is a third member of the FREM family, but no mutations in FREM3 have been found in either mouse blebs mutants or human Fraser syndrome patients.
 
In all blebs mutants, and in bat mice, blisters arise at approximately 12 days of gestation. They occur over the eyes, extremities or hindbrain, and either resolve by 16 dpc or become hemorrhagic, sometimes leading to resorption of the embryo. By the time the mice are born, blisters are no longer observed, suggesting that FRAS1 and FREM proteins are transiently required during embryogenesis and that other proteins can compensate for their loss during later periods. The blisters are created by the loss of adhesion of the developing epidermis from the underlying basement membrane (BM), a zone of ECM proteins that links and anchors the epidermis and dermis and mediates signaling between the two. Studies of Fraser syndrome patients and blebs mutants demonstrate that without exception, blistering occurs below the level of the BM, and specifically below the lamina densa, one of the BM layers rich in collagen IV (1;10-12). Blistering at the same level is observed in human patients with dystrophic epidermolysis bullosa (DEB; OMIM #226600), caused by mutations of collagen VII, which anchors the BM to the dermis (16). However, blistering occurs primarily after birth (16); additionally, Fras1 and Frem1 mutants have normal deposition of collagen VII (1;10), suggesting that blistering in DEB is distinct from that in blebs mice. CSPG repeat domains in recombinant NG2 protein bind to collagens V and VI (4). Whether CSPG repeats in FRAS1 and FREM proteins bind any collagens to mediate adhesion requires further study. A more widespread epidermal blistering phenotype is seen in PDGF receptor (PDGFR)-α- and PDGF-C-deficient mice (17;18). PDGF signaling is ubiquitous and controls cell proliferation, survival, morphology and movement. Together with data indicating that CSPG repeats in NG2 can bind to PDGF-AA (5), these findings raise the possibility that FRAS1 and FREM proteins regulate signaling from growth factor receptors to regulate epidermal adhesion.
 
The putative protein domains identified in FRAS1 and FREM proteins, which include ECM-interaction (CSPG repeat, lectin and VWFC) and Ca2+-binding (CALX-β) domains, together with the phenotype of the blebs mutants, strongly suggest that FRAS1 and FREM proteins interact with ECM components to maintain epidermal adhesion during embryogenesis. A recent study indicates that FREM1 can interact via a canonical RGD integrin-binding motif with αv- and α8-containing integrins during cell adhesion in vitro (19). Integrin αv- and α8-deficient mice do not have skin defects (20;21), suggesting that integrin-binding is not the primary mechanism for FREM1 action. Notably, integrin α8-null mice display renal dysgenesis or agenesis (21); FREM1-integrin α8 interactions may contribute to renal development.
Putative Mechanism
Recent studies provide evidence that FRAS1, FREM1 and FREM2 proteins interact in a complex in the basement membrane (12;22). FRAS1, FREM1 and FREM2 can be coimmunoprecipitated from the conditioned medium of 293F cells transfected with FREM1 when they are cocultured with cells expressing both FRAS1 and FREM2 (22). However, FREM1 fails to co-precipitate with FRAS1 when cells expressing FREM1 are cocultured with cells expressing FRAS1 alone. These results suggest that FRAS1 and FREM2, putative transmembrane spanning proteins, can be shed into the media, possibly via furin cleavage. Although the domains required for interaction are unknown, FREM2 appears to bind to both FRAS1 and FREM1 and mediate complex formation.
 
The expression pattern of FREM1 is approximately complementary to that of FRAS1 and FREM2, with all three proteins at the edge of the basement membrane, but FREM1 on the dermal side and FRAS1 and FREM2 on the epidermal side (1;22). FRAS1 expression at the basement membrane is reduced in both Frem1-/- and Frem2my/my mutant embryos (22); a reduction of FREM1 at the basement membrane is also observed in Fras1-/- mice (23). In Grip1eb/eb mutants, localization of all three of FRAS1, FREM1 and FREM2 is reduced at the basement membrane (12;22). Together with the results from coimmunoprecipitation experiments, these data suggest that FRAS1, FREM1 and FREM2 interact to facilitate each other’s deposition at the basement membrane.
 
Figure 3. Putative mechanism of FREM1. FRAS1, FREM1 and FREM2 may interact in a complex in the basement membrane. Around 10.5 dpc, deposition of FRAS1 and FREM2 to the basement membrane is mediated by GRIP1 while FREM1 is independently secreted from the dermis. FRAS1 and FREM2 can be shed into the media, possibly via furin cleavage. FREM2 appears to bind to both FRAS1 and FREM1 and mediate complex formation. Around 17.5 dpc, expression of collagen VII rapidly increases in the basement membrane, and may serve to mediate epidermal adhesion after FRAS1 and FREM protein expression declines.
A model for FRAS1, FREM1, FREM2 and GRIP1 function in skin development has been proposed (24): around 10.5 dpc, deposition of FRAS1 and FREM2 to the basement membrane is mediated by GRIP1 (12) while FREM1 is independently secreted from the dermis into the basement membrane (7;22) (Figure 3). FRAS1 and FREM2 may be released into the basement membrane by furin cleavage. FREM2 mediates complex formation between FREM1 and FRAS1, and the complex persists for several days of embryonic development (until about 16 dpc) (7). Later on, around 17.5 dpc, expression of collagen VII rapidly increases in the basement membrane, and may serve to mediate epidermal adhesion after FRAS1 and FREM protein expression declines (7;16).
 
The mechanisms by which FRAS1 and FREM proteins regulate renal development are yet unknown, but probably do not involve defective adhesion or blister formation. As mentioned above, FREM1 interacts with integrin α8 in vitro, and integrin α8-null mice exhibit renal agenesis, raising the possibility of an interaction between FREM1 and integrin α8 during kidney development (19;21).
 
The Frem1bat allele encodes a mutant FREM1 protein truncated prematurely near the C-terminal end of the CSPG repeat domains. Twelve aberrant amino acids are inserted just before the premature stop codon. Interestingly, in contrast to Frem1-/- mice, FRAS1 is localized normally in homozygous bat mice (1;22). This suggests that the protein encoded by Frem1bat retains some function, but this residual function is not sufficient to mediate normal epidermal development. Alternatively, FRAS1 expression at the basement membrane is not absolutely required for normal epidermal adhesion. The CALX-β domain is lacking in the bat-mutant FREM1 protein, potentially indicating a functional role for this domain during development. A point mutation in one of five CALX-β domains of FREM2 has been reported in Fraser syndrome patients, although how the mutation affects protein function is not understood (11).
Genotyping
Bat genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.
 
Primers
Bat(F): 5’- AACAAGACAGGCTTCGGCAGAAATC -3’
Bat(R): 5’- AGCACTCACCAAACGGGCCTACCTAC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 60°C             0:15
4) 72°C             0:30
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
The following sequence of 479 nucleotides (from Genbank genomic region NC_000070 for linear genomic sequence of Frem1) is amplified:
 
84789         aa caagacaggc ttcggcagaa atcaacagat aaggactcca agcgatctct
84841 gggttgagga gttcactatt gttgagccag gaaagccctg tgtagcatag ggagagaagt
84901 ccttgtgtaa cgctacgttg gtgattcagg tggatcagct ggacaaggca gcgccccgta
84961 tcacacactt gcactcccct actcaagtgg ggctcttgaa aaatggctgc tatgggattt
85021 acatcacttc ccgtgtgctg aaggcatcag accctgacac agaggatgac cagatcatct
85081 ttaagatttt acgaggccca ttgtacggac gtctggagaa cacaacaaca ggtactttcc
85141 atcttttttg ggggggcggg tgtactttcc atctcagtcc ttgtaagtcc tcattttaaa
85201 ctactagttg ctggcagagc taaagaggaa ctcaggtaag tgtaggtagg cccgtttggt
85261 gagtgct
 
Primer binding sites are underlined; the mutated T is highlighted in red.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsXin Du, Bruce Beutler
Edit History
09/01/2011 5:11 PM (current)
09/01/2011 4:52 PM
09/01/2011 4:52 PM
08/31/2011 8:39 PM
08/22/2011 2:45 PM
01/07/2011 8:51 AM
11/18/2010 11:06 AM
02/03/2010 5:36 PM