Phenotypic Mutation 'splotch2' (pdf version)
Allelesplotch2
Mutation Type splice acceptor site (8 bp from exon)
Chromosome15
Coordinate94,335,561 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Adamts20
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
Synonym(s) ADAMTS-20, bt
Chromosomal Location 94,270,163-94,465,418 bp (-)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_177431; MGI: 2660628

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000036330 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 10 186 3.2e-33 PFAM
Pfam:Reprolysin 255 464 1.2e-26 PFAM
Blast:ACR 467 545 N/A BLAST
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 6.2e-33 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1707 1906 1.1e-87 PFAM
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation
skin/coat/nails
Penetrance Probably greater than 90%, but with variable expressivity. 
Alleles Listed at MGI

All alleles(16) : Spontaneous(11) Chemically induced(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 critical splice donor site probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 splice site probably null
IGL03088:Adamts20 APN 15 94329914 critical splice donor site probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
Meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense probably damaging 1.00
panda UTSW 15 94326699 nonsense
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense probably null
wash UTSW 15 94347670 nonsense probably null
whitebelly UTSW 15 unclassified
whopper UTSW 15 94347810 missense
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1809:Adamts20 UTSW 15 94341087 missense probably damaging 1.00
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site probably benign
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 splice site probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
R6217:Adamts20 UTSW 15 94338715 missense probably benign 0.00
R6283:Adamts20 UTSW 15 94351721 missense probably benign
R6354:Adamts20 UTSW 15 94347810 missense probably damaging 1.00
R6415:Adamts20 UTSW 15 94324659 critical splice donor site probably null
R6419:Adamts20 UTSW 15 94333675 missense possibly damaging 0.84
R6476:Adamts20 UTSW 15 94361810 missense probably benign 0.22
R6485:Adamts20 UTSW 15 94343971 missense probably benign 0.17
R6517:Adamts20 UTSW 15 94283104 intron probably null
R6675:Adamts20 UTSW 15 94331316 critical splice donor site probably null
R6863:Adamts20 UTSW 15 94379746 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Embryos
Repository

none

Last Updated 2018-10-05 4:20 PM by Diantha La Vine
Record Created unknown
Record Posted 2008-02-15
Phenotypic Description

Homozygous splotch2 mice exhibit a white spot on the belly. The size of this spot is variable and in some cases, can extend across the back to form a white belt; the variable expression in genetically identical mice remains an unexplained characteristic of this and other belted (bl) alleles with which splotch2 is allelic. Splotch2 animals show normal immune responses to infection by both Listeria monocytogenes  and mouse cytomegalovirus (MCMV) (MCMV Susceptibility and Resistance Screen), and exhibit normal Toll-like receptor (TLR) signal transduction as measured by TNF production (TLR Signaling Screen).

Nature of Mutation
The Adamts20 gene contains 39 total exons. The splotch2 mutation mapped to Chromosome 15, and corresponds to a T to A transversion at position 65398 in the genomic DNA sequence of the Adamts20 gene (Genbank genomic region NC_000081 for linear genomic sequence of Adamts20).  The mutation is located within intron 16, eight nucleotides upstream from the start of exon 17, and impairs the acceptor splice site of intron 16. Adamts20 cDNA from splotch2 mice has not been sequenced; it is unknown how the mutation affects processing of the Adamts20 transcript. Mutation of the normal acceptor splice site for intron 16 may result in deletion of exon 17 if the next acceptor site is used, partial deletion if the cell uses an alternative downstream site or insertion of non-coding sequence if the cell uses an upstream alternative splice site. Deletion of exon 17 would result in loss of the reading frame, the introduction of five aberrant amino acids, and a truncation of the protein after amino acid 765 (depicted below).
 
       <--exon 16 <--intron 16 exon 17-->  exon 18-->
63198 AACTATCTCG………TTGTTTTTCAGCATTATCTG………GTGTTGTGTGTGGGTAA 65738
758   -N--Y--L--              A--L--S-    G--V--V--C--G--*  765
        correct                deleted        aberrant
 
The acceptor splice site of intron 16, which is destroyed by the splotch2 mutation, is shown in blue lettering; the mutated nucleotide is shown in red.
Protein Prediction
Figure 1. Domain structure of ADAMTS20. The splotch2 mutation corresponds to a T to A transversion in intron 16, eight nucleotides upstream from the start of exon 17 of the Adamts20 gene. It impairs the acceptor splice site of intron 16 and may result in deletion of exon 17. SP, Signal peptide; MP, Metalloprotease; DL, Disintegrin-like; CRR, Cystein-rich region. TSP-type domains are yellow and numbered. Other mutations found in ADAMTS20 are noted in red. Click on each mututation for more specific information.
ADAMTS-20 is a 1906 amino acid protein that is a member of a large family of secreted zinc-dependent metalloproteases known as the ADAMTS (a disintegrin and metalloprotease domain, with thrombospondin type-1 repeats) family. These proteins are predicted to interact with the extracellular matrix (ECM) and play a wide role in normal and pathological processes (1-5). The mouse and human ADAMTS-20 proteins share 69% identity (6;7). Smaller splice variants of both the human and mouse proteins exist (1;6;7).
 
The ADAMTS-20 protein contains a number of predicted functional domains, most of which are shared amongst all members of the ADAMTS family. Like other members of the family, ADAMTS-20 has an N-terminal signal peptide and a propeptide domain which contains three conserved Cys residues and ends in a basic region (aa 246-259). This sequence is a putative protein-convertase recognition site to generate mature enzyme. Following the prodomain, ADAMTS-20 contains the zinc-coordinating catalytic sequence HELGHVFNVPHD (aa 399-410) that is closely related to sequences found in metalloproteases. Rather than ending in the serine residue present in most matrix metalloproteases (MMPs), this sequence ends in an asparagine that is characteristic of ADAMTS family members. C-terminal to this motif is a conserved methionine residue (position 427) that forms a characteristic “Met turn” also found in most MMPs. The catalytic domain contains eight conserved Cys residues that likely form internal disulfide bonds (1;4;6-8). Using a peptide substrate commonly used to assay MMP function, the catalytic domain of ADAMTS20 has been found to be functionally active in vitro.  However, this activity is weak suggesting that the other domains of ADAMTS20 are of functional importance (6).
 
The catalytic domain of ADAMTS20 is followed by a disintegrin-like domain which is similar in size and structure amongst all ADAMTS proteins (76 residues) and includes eight conserved Cys residues. In members of the closely related ADAM (a disintegrin and metalloprotease domain) family, this domain can interact with integrins but this function has not been directly tested in most ADAMTS proteins (4;6-8). The disintegrin domain precedes a single thrombospondin type I repeat (TSP1) which is well-conserved and similar to a domain in Thrombospondin I. This repeat contains two motifs (CSVTCG) believed to mediate binding to the thrombospondin receptor CD36 (4;7;8). The first TSP1 repeat is followed by a cysteine (Cys)-rich domain that has ten conserved Cys residues as well as a spacer characteristic of ADAMTS family members. The spacer domain contains a putative sequence for glycosaminoglycan attachment and may be important in substrate recognition and ECM association (4;7). C-terminal to the spacer region, ADAMTS proteins have a highly variable number of TSP1 repeats. The full-length ADAMTS-20 protein contains fourteen of these motifs with linker sequences between the fifth and sixth repeat and the seventh and eighth repeat. The smaller splice variant for mouse ADAMTS-20 contains 9 instead of 14 TSP1 motifs at the C-terminal domain while the human splice variant contains 11 instead of 14 TSP1 domains (1;4;6;8). The ADAMTS-20 protein is distinguished from most members of the ADAMTS family by a final C-terminal region known as the GON domain (named after the GON-1 protein of Caenorhabditis elegans). Similar ADAMTS proteins containing this domain are also found in Drosophila melanogaster, Anopheles gamibiae and Fugu rubripes. This domain is rich in Cys residues but the function is unknown (1-3;6;7).
 
The splotch2 mutation likely results in the loss or weakening of the normal splice acceptor site of intron 16, leading to skipping of exon 17 which encodes a portion of the spacer region of the protein. Deletion of exon 17 would result in a frame shift and protein truncation after the Cys-rich region due to introduction of five new amino acids (GVVCG) and a premature stop codon after amino acid 760. However, the consequences of the mutation at the protein level are unverified.
Expression/Localization
Adamts20 displays a complex and dynamic expression pattern during mouse embryonic development, as revealed by in situ hybridization (1). Initially visible in the neural tube at embryonic day 9.5, expression expands laterally along the sides of the embryo to the base of the limb buds by embryonic day 11.5. Craniofacial expression is present in the first pharangeal arch and also at the cleft between the medial nasal processes. At embryonic day 12.5, transcript is detected in developing vibrissae follicles and the boundary between the developing nasal process and the telencephalon as well as in condensing mammary gland and developing digits. On embryonic day 13.5, expression is detected mainly in the dermis but is more highly expressed in the vibrissae follicles of the snout and in hair follicles of the skin at later ages. This expression pattern generally precedes the appearance of melanoblasts in the same region but Adamts20 is not expressed in the migrating cells themselves. ADAMTS-20 is also expressed in palatal mesenchyme (9).
 
As determined by Northern and Western blot analysis, mouse Adamts20 mRNA and protein is detected in adult brain and testis extracts (6). Other studies show that human ADAMTS20 mRNA is detected at low levels in the epithelial cells of the breast and lung but not in stromal cells (7) and is found in testis, prostate, ovary, heart, placenta, lung, and pancreas (6). As mentioned above, ADAMTS-20 is a secreted protein likely associated with the ECM.
 
ADAMTS20 mRNA is overexpressed in some human malignant tumors including brain, colon and breast carcinomas (6;7).
Background
White-spotting mutants are a subclass of coat color mutants in mice. These mutants exhibit white spots that include belly spots, head spots, belts spanning the caudal trunk region, piebald spotting and peppering. Unlike color variations in mice which are typically due to alterations in melanin production, distribution, or deposition into hair and/or skin, white-spotting mutants are often the result of improper melanoblast development or survival. The lack of pigment in the adult reflects the absence of mature melanocytes in that area due to defects at various stages of melanocyte development including proliferation, survival, migration, invasion of the integument, hair follicle entry and melanocyte stem cell renewal (10;11). Early studies using white-spotted mutant mice and chimeras hypothesized that a very small number of melanocyte precursors populate the entire coat of adult animals with melanoblasts migrating laterally from the neural crest prior to undergoing proliferation. White-spotted mutations were thought to cause selective death of a subset of these precursors (12;13). A more recent study (14), suggests that the melanoblast population is derived from a much larger number of neural crest progenitors with melanoblasts migrating axially as well as laterally. The descendants of a single progenitor can thus be distributed over a large area. This study also found that most melanoblasts migrate from the cervical region of the embryo and that different cell dispersion mechanisms may operate in the head and trunk regions. Furthermore, a large number of progenitors populates the head and face region of the embryo while a smaller number populates the trunk region. Finally, three distinct phases occur in trunk melanoblast development: a primary proliferative phase, followed by migration, leading to a second phase of proliferation by the dispersed cells. The differences observed in this study between melanoblast migration and dispersion in the head region versus the trunk region may help explain why certain white-spotting mutations affect particular areas of the body.
 
White-spotted mutants have been ascribed to a variety of genes including ones encoding the transcription factors MITF, PAX3, and SOX10 (mutated in Dalmation), the KIT receptor tyrosine kinase (mutated in Casper and Pretty2), a G-protein coupled receptor and its ligand (EDNRB and endothelin-3 respectively), a transmembrane protein (Mucolipin 3) as well as ADAMTS-20, a putative ECM associated metalloprotease (10;11). Adamts20 is the gene mutated in belted and splotch2 mutant mice. Belted animals were first described in 1945 and exhibit a mostly pigmented coat except for a region near the hindlimbs that resembles a belt (15). At least twelve different belted alleles are in existence and four of these, including splotch2, have been sequenced. Two of the three previously described mutations result in single amino acid changes either in the cysteine-rich domain or one of the C-terminal TSP1 repeats. The third mutation generates a premature stop codon, resulting in truncation of the protein and loss of eight C-terminal TSP1 domains. As all three of these mutations are well downstream of the Adamts20 catalytic domain, it is unknown whether they result in hypomorphic alleles or functional nulls (1).
 
Early experiments seeking to address the mechanisms underlying the belted phenotype had conflicting conclusions (1;10;16). Grafts using skin isolated from embryonic day 12-12.5 suggested that melanoblasts were able to occupy the entire skin graft from the white-spotted area, but were unable to form differentiated melanocytes within the hair follicles. The hypothesis arising from this study suggests that ADAMTS-20 function is necessary to allow entry of the melanoblast into the hair follicle or to support melanocyte differentiation within the follicular environment (16). Although these findings were unconfirmed by later experiments, the expression pattern of Adamts20 mRNA in hair follicles but not in melanoblasts themselves is consistent with this hypothesis (1;10).
 
Figure 2. Phylogenic tree and physiological roles of ADAMTS family members. The pathologies listed to the right are associated with deficiency in the gene.
ADAMTS proteins are metalloproteases that are secreted as pro-enzymes and then activated in the secretory pathway or at the cell surface by pro-protein convertases such as furin. These proteins are suggested to interact with the extracellular matrix (ECM) and cleave a variety of substrates. They play diverse roles in development and disease including roles in cancer and inflammation (1;4;5) (Figure 2). For instance, ADAMTS-4 and 5 cleave the ECM aggrecan proteins which are present in large amounts in the articular cartilage. Aggrecan proteins are implicated in progression of arthritic diseases (4;17;18). ADAMTS-4 is also able to cleave brevican, a protein highly expressed in the ECM of glioma tumors. Cleavage of brevican is thought to aid tumor invasion (19). ADAMTS-1 can be induced in reaction to the inflammatory cytokine interleukin-1, exhibits angioinhibitory properties and also has aggrecanase activity(4;5). ADAMTS-2, 3 and 14 are procollagen N-proteases, and ADAMTS-2 deficiency causes Ehlers-Danlos syndrome VIIC in humans (OMIM   #225410  ). This disease is characterized by severe skin fragility (4;20). Adamts9 haploinsufficiency in mice results in cardiac and aortic anomalities due to decreased cleavage and subsequent accumulation of the ECM proteoglycan versican (21). ADAMTS-20 is also able to cleave versican in vivo (22). Finally, mutations in the ADAMTS13 gene causes thromobotic thrombocytopenic purpura (TTP; OMIM #274150) in humans, which is characterized by a decrease in Pproteolysis of the blood-clotting protein von Willebrand factor (VWF) (23).
 
The region containing the human ADAMTS20 gene (12q12) has been found to be a recurrent site of translocations and other alterations in human malignancies, supporting the finding that ADAMTS20 is overexpressed in certain cancers (6;7;24;25). However, none of these malignancies have yet been directly attributed to changes in the ADAMTS20 gene.
Putative Mechanism

The above described dynamic expression pattern of ADAMTS-20 during mouse embryonic development implies a tightly regulated signaling interaction between the tissues that express the protein and the migrating melanoblasts. Because Adamts20 mRNA expression always precedes that of the melanoblast marker DCT and Adamts20 mRNA is detected in hair follicles but not the melanoblasts themselves, it may be that deficient ADAMTS-20 activity causes loss of melanoblast entry into the hair follicles (1). This theory is consistent with the putative function of ADAMTS-20 as a potential ECM-associated metalloprotease. ADAMTS-20 may degrade specific peptide substrates, either ECM components or signaling molecules, and this degradation could be necessary for melanoblast migration to the proper areas. Indeed, a highly similar protein GON-1 in C. elegans (46% similarity) is required for distal tip cell migration during gonadal morphogenesis. The C. elegans gonad is a complex epithelial tube consisting of long arms and regulatory “leader” cells are crucial for extension. Although these leader cells are correctly specified in gon-1 mutants, they fail to migrate. GON-1 likely mediates leader cell migration either by degrading components of the extracellular matrix or by cleaving regulators necessary for directing migration (2;3).

 

More recently, an examination of ADAMTS-20 function during melanoblast development determined that mice with mutations in Adamts20 had a normal distribution of melanoblasts during embryogenesis suggesting that melanoblast migration is normal in these animals. The numbers of melanoblasts were specifically reduced in the lumbar region of these animals due to a seven-fold higher rate of apoptosis specifically in this region. Haploinsufficiency for Adamts9 exacerbated the melanoblast defect. Skin explant cultures suggest that the presence of ADAMTS-20 is required to respond to soluble KIT ligand, and belted mice heterozygous for Kit mutations exhibit increased white spotting (26). The phenotypes of Kit mutant animals can be attributed to the failure of stem cell populations, including melanoblasts, to migrate and/or proliferate effectively during development (27).

 
 
Primers Primers cannot be located by automatic search.
Genotyping
Splotch2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. This protocol has not been tested.
 
Primers for PCR amplification
Spl2(F): 5’- ACGGGATGTTGTCTGCTTTCTGCAC -3’
Spl2(R): 5’- ATGGCAAGCACGTCACAAGTCCACTG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Spl2_seq(F): 5’- GAATCTGTCTTAACATACTTGGCTGC -3’
Spl2_seq(R): 5’- GTCACAAGTCCACTGATAAAGACT -3’
 
The following sequence of 582 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Adamts20) is amplified:
 

65065                           acggga tgttgtctgc tttctgcact ggtgattgtc
65101 tagttgggtg ctctgtatgg gggcgctctg gtttgtccag tttctcctgt ctctgtgtgt
65161 ctttcctgtt tcatgcctct ggagaggttc tgggatgcgg cagggtggga tgaatctgtc
65221 ttaacatact tggctgctct gttcaggttt ccttacacag caccatggag aagcttatct
65281 ccttagcccc catttatatc tgctttctgc agattcagga aagagcttga atttgaaagt
65341 gaagccagtt cctcccaccc tgcccggtcc ctatctcagg agagccgcgt tacattgttt
65401 ttcagcatta tctgacactc aagggaactt tctcctgaat ggaaactttg ttgtaagtat
65461 ggcgaagaaa gagatcaaca tccagggtgc tgttttcgaa tacagcgggt caaacaactc
65521 gattgaaaga attaacagca cggaccggct ggaggcggag ctcgttctgc aggtaactaa
65581 cggctagtag gcagcggcga gacagagctg cagtctttat cagtggactt gtgactgtgt
65641 gctcca

 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
15.  Murray, J. M. and Snell, G. D. (1945) Belted, A New 6Th Chromosome Mutation in the Mouse, Journal of Heredity 36, 266-268.

24.  Hough, R. E., Goepel, J. R., Alcock, H. E., Hancock, B. W., Lorigan, P. C., and Hammond, D. W. (2001) Copy number gain at 12q12-14 may be important in the transformation from follicular lymphoma to diffuse large B cell lymphoma, Br. J. Cancer 84, 499-503.

Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsPhilippe Georgel, Karine Crozat, Bruce Beutler
Edit History
2011-08-26 2:53 PM (current)
2011-08-03 4:25 PM
2011-03-02 9:09 AM
2011-03-02 9:09 AM
2011-03-02 9:00 AM
2011-02-28 1:32 PM
2011-01-07 9:48 AM
2010-11-02 1:28 PM
2010-11-02 1:28 PM
2009-10-16 12:00 AM