Phenotypic Mutation 'Glacier3' (pdf version)
AlleleGlacier3
Mutation Type missense
Chromosome4
Coordinate44,679,526 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Pax5
Gene Name paired box 5
Synonym(s) Pax-5, EBB-1
Chromosomal Location 44,524,757-44,710,487 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. Paired box transcription factors are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Null mutants exhibit impaired development of the midbrain resulting in a reduced inferior colliculus and an altered cerebellar folial pattern, failure of B cell differentiation, runting, and high postnatal mortality with few survivors. [provided by MGI curators]
Accession Number

NCBI Refseq: NM_008782.3; MGI:97489

Mapped Yes 
Amino Acid Change Aspartic acid changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000014174] [ENSMUSP00000099996] [ENSMUSP00000103455] [ENSMUSP00000103457] [ENSMUSP00000103458] [ENSMUSP00000133540] [ENSMUSP00000134370] [ENSMUSP00000139296] [ENSMUSP00000128880] [ENSMUSP00000133671] [ENSMUSP00000134712] [ENSMUSP00000134391] [ENSMUSP00000141186]
SMART Domains Protein: ENSMUSP00000014174
Gene: ENSMUSG00000014030
AA Change: D173G

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-4 SMART
Pfam:Pax2_C 279 390 6e-53 PFAM
Predicted Effect possibly damaging

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
(Using ENSMUST00000014174)
SMART Domains Protein: ENSMUSP00000099996
Gene: ENSMUSG00000014030
AA Change: D173G

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-4 SMART
Pfam:Pax2_C 276 341 1.1e-25 PFAM
Predicted Effect possibly damaging

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
(Using ENSMUST00000102932)
SMART Domains Protein: ENSMUSP00000103455
Gene: ENSMUSG00000014030
AA Change: D173G

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-4 SMART
Pfam:Pax2_C 279 356 5.7e-28 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
(Using ENSMUST00000107825)
SMART Domains Protein: ENSMUSP00000103457
Gene: ENSMUSG00000014030
AA Change: D173G

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 7e-4 SMART
low complexity region 269 281 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
(Using ENSMUST00000107826)
SMART Domains Protein: ENSMUSP00000103458
Gene: ENSMUSG00000014030
AA Change: D173G

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 4e-4 SMART
low complexity region 298 310 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
(Using ENSMUST00000107827)
SMART Domains Protein: ENSMUSP00000133540
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
SCOP:d1ftt__ 177 211 1e-4 SMART
Pfam:Pax2_C 233 298 2.4e-25 PFAM
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000134370
Gene: ENSMUSG00000014030
AA Change: D173G

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-3 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
(Using ENSMUST00000143235)
SMART Domains Protein: ENSMUSP00000139296
Gene: ENSMUSG00000014030
AA Change: D172G

DomainStartEndE-ValueType
PAX 15 139 8e-96 SMART
low complexity region 156 188 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
(Using ENSMUST00000146335)
SMART Domains Protein: ENSMUSP00000128880
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
SCOP:d1ftt__ 177 211 1e-4 SMART
Pfam:Pax2_C 233 347 7.3e-55 PFAM
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000134119
Gene: ENSMUSG00000014030
AA Change: D117G

DomainStartEndE-ValueType
PAX 4 85 2.44e-27 SMART
low complexity region 102 134 N/A INTRINSIC
SCOP:d1ftt__ 165 199 7e-5 SMART
Pfam:Pax2_C 224 335 2.3e-53 PFAM
Predicted Effect unknown
SMART Domains Protein: ENSMUSP00000133671
Gene: ENSMUSG00000014030
AA Change: D107G

DomainStartEndE-ValueType
PAX 16 120 2.93e-30 SMART
SCOP:d1ftt__ 154 188 1e-4 SMART
Pfam:Pax2_C 212 290 8.7e-28 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
(Using ENSMUST00000173733)
SMART Domains Protein: ENSMUSP00000134712
Gene: ENSMUSG00000014030
AA Change: D173G

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-4 SMART
low complexity region 306 325 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
(Using ENSMUST00000173821)
SMART Domains Protein: ENSMUSP00000134391
Gene: ENSMUSG00000014030
AA Change: D173G

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-3 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
(Using ENSMUST00000174242)
SMART Domains Protein: ENSMUSP00000133978
Gene: ENSMUSG00000014030
AA Change: D117G

DomainStartEndE-ValueType
PAX 4 85 2.44e-27 SMART
low complexity region 102 134 N/A INTRINSIC
SCOP:d1ftt__ 165 199 2e-4 SMART
low complexity region 251 270 N/A INTRINSIC
Predicted Effect unknown
SMART Domains Protein: ENSMUSP00000141186
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 15 108 1.2e-22 SMART
Predicted Effect silent
Meta Mutation Damage Score 0.1502 question?
Is this an essential gene? Essential (E-score: 1.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS IgD MFI - decreased
Candidate Explorer Status CE: potential candidate; human score: -0.5; ML prob: 0.396
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (ENU)(4) Gene trapped(1) Targeted(11)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02369:Pax5 APN 4 44691919 missense probably damaging 1.00
IGL02700:Pax5 APN 4 44682722 missense probably damaging 0.99
IGL02754:Pax5 APN 4 44570059 missense probably damaging 0.96
apple UTSW 4 unclassified
glacier UTSW 4 44679494 missense probably damaging 1.00
glacier2 UTSW 4 44710407 start codon destroyed probably null 0.96
k2 UTSW 4 44697630 missense probably damaging 1.00
Son_of_apple UTSW 4 44710583 unclassified probably benign
R0411:Pax5 UTSW 4 44609783 missense probably damaging 0.99
R0415:Pax5 UTSW 4 44691886 missense probably damaging 1.00
R0655:Pax5 UTSW 4 44537462 missense probably damaging 0.97
R1146:Pax5 UTSW 4 44697512 splice site probably benign
R1752:Pax5 UTSW 4 44609729 missense probably damaging 1.00
R1891:Pax5 UTSW 4 44691859 missense probably damaging 1.00
R4766:Pax5 UTSW 4 44679494 missense probably damaging 1.00
R4783:Pax5 UTSW 4 44570086 missense probably damaging 1.00
R5134:Pax5 UTSW 4 44710407 start codon destroyed probably null 0.96
R5341:Pax5 UTSW 4 44697630 missense probably damaging 1.00
R5458:Pax5 UTSW 4 44679526 missense probably damaging 1.00
R6281:Pax5 UTSW 4 44691955 missense probably benign 0.37
R6871:Pax5 UTSW 4 44710583 unclassified probably benign
R7025:Pax5 UTSW 4 44679501 nonsense probably null
R7204:Pax5 UTSW 4 44679485 missense possibly damaging 0.93
S24628:Pax5 UTSW 4 44691886 missense probably damaging 1.00
X0018:Pax5 UTSW 4 44691880 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:36 PM by Diantha La Vine
Record Created 2018-05-09 11:59 AM by Bruce Beutler
Record Posted 2018-06-18
Phenotypic Description

Figure 1. Glacier3 mice exhibit reduced expression of IgD on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Glacier3 phenotype was identified among G3 mice of the pedigree R5458, some of which showed reduced expression of IgD on peripheral blood B cells (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced IgD MFI using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 50 mutations (X-axis) identified in the G1 male of pedigree R5458. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 50 mutations. The IgD phenotype was linked by continuous variable mapping to a mutation in Pax5: an A to G transition at base pair 44,679,526 (v38) on chromosome 4, or base pair 30,915 in the GenBank genomic region NC_000070. Linkage was found with a dominant model of inheritance, wherein 12 variant homozygotes and 24 heterozygous mice departed phenotypically from 15 homozygous reference mice with a P value of 0.000265 (Figure 2).

 

The mutation corresponds to residue 804 in the mRNA sequence NM_008782 within exon 5 of 10 total exons.

 

788 TCATCGGTGAGCACCGACTCCGCGGGCTCCTCA
168 -S--S--V--S--T--D--S--A--G--S--S-

 

Genomic numbering corresponds to NC_000070. The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to glycine substitution at position 173 (D173G) in the canonical variant of the PAX5 protein.

Protein Prediction
Figure 3. Pax5 encodes multiple Pax5 isoforms. Pax5 protein domains include the highly conserved paired box DNA binding domain (Paired), an octapeptide motif (Oct), a partial homeodomain (HD), a transactivation domain (TAD), and an inhibitory domain (ID), see text for details. The amino acid numbers shown for isoform Pax5a, the primary isoform of Pax5, are from Maier and Hagman (2002). The Pax5 isoforms, Pax5d and Pax5e, are also shown. Mutations found in PAX5 are noted. Click on each mutation for more information.

Pax5 encodes Pax5 [alternatively, B-cell lineage-specific activator protein (BSAP)], a member of the paired box (PAX) family of transcription factors that have roles in cellular differentiation, migration, and proliferation (1-5). Pax5 has a highly conserved paired box DNA binding domain (PRD), an octapeptide motif, a partial homeodomain, a transactivation domain, and a repressor domain (1;6-12).

 

Pax5 generates multiple isoforms from two known alternative promoters to generate transcripts with distinct first exons (exon 1A and 1B) and otherwise similar in-frame sequences [(9;11;13-15); reviewed in (16)]. Alternative splicing also occurs throughout the transcript to generate multiple protein isoforms [(9); reviewed in (16)]. In both murine spleen and B-lymphoid cell lines, Pax5 generates four isoforms by alternative splicing that are expressed at detectable levels in normal B cells: Pax-5a (i.e., full-length Pax5), Pax5bPax5d, and Pax5e. Pax5a and Pax5d, but not Pax5e, possess an intact DNA-binding domain; Pax5d and Pax5e do not have transactivation, repression, or partial homeodomain homology regions, but do contain a novel 128 base pair sequence with an unknown function (14;17). In ‘aged’ normal lymphocytes, researchers found that transcripts in these lymphocytes corresponded to isoforms already described (9;11), including those with various exon deletions (e.g., Δ2, Δ7/8, Δ2/7/8, Δ2/7/8/9, Δ2/4/8, and Δ2/3/4/8) (18).  

 

The Glacier3 mutation results in an aspartic acid to glycine substitution at position 173 (D173G) in the canonical variant of the PAX5 protein; Asp173 is within an undefined region of PAX5.

 

For more information about Pax5, please see the record for glacier.

Putative Mechanism

The Pax protein family regulates pattern formation, morphogenesis, cellular differentiation, and organogenesis by activating (or repressing) genes that encode secreted proteins, cell surface receptors, cell cycle regulators, and transcription factors [(3;19); reviewed in (20)]. Pax5 plays a role in several aspects of B cell biology including the initiation of B cell lineage commitment in the bone marrow, maintenance of the B cell fate in more mature cells, V-DJ recombination of the Igh locus, and B cell migration [(21-24); reviewed in (25)]. In addition to its role in early B cell lymphopoiesis, Pax5 also functions in mature B cells to downregulate B cell-specific genes and reactivate lineage-inappropriate genes. In Pax5-/- mice, B cell development is arrested at the pro-B cell stage resulting in a lack of immunoglobulin in the serum [(3;21;22;26;27); reviewed in (20)]. In the Pax5-/- fetal liver, B cell development halts before the appearance of B220+ progenitors (26); in the Pax5-/- bone marrow, development progresses to a c-Kit+B220+ progenitor cell stage [(22;26); reviewed in (28)]. Pro-B cells from Pax5-/-mice can differentiate into almost all hemopoietic cell lineages both in vitro and in vivo (29-32). The phenotype observed in the Glacier3 mice is consistant with loss of Pax5Glacier3 function.

Primers PCR Primer
Glacier3_pcr_F: CTCTGCAGCTAAGCATGTCG
Glacier3_pcr_R: GGCTGGGATCTTAGTAAATTCCC

Sequencing Primer
Glacier3_seq_F: AGCTAAGCATGTCGTACTGC
Glacier3_seq_R: AAATTCCCTTTTTATTCTGTGCTTG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 405 nucleotides is amplified (chromosome 4, - strand):


1   ggctgggatc ttagtaaatt ccctttttat tctgtgcttg tattcccttt ctgctgggtc
61  ggggtgggta tccttgagct ggcacttgcc cttctgcagc agttgtaccc agcccagtat
121 atctagtgag cacctctgtg acaggccggc acccctctcc ttctacagtg tctacaggct
181 ccgtgacgca ggtgtcatcg gtgagcaccg actccgcggg ctcctcatac tccatcagtg
241 gcatcctggg catcacgtcc cccagtgccg acaccaacaa acgcaagagg gatgaaggta
301 agagatggct gcgcatcccc acccggaatg cacctagcag ggtctgtgtg gaaccctcgc
361 agaaggggga aacaaaagtg cagtacgaca tgcttagctg cagag


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler