Phenotypic Mutation 'Velvet' (pdf version)
Gene Symbol Egfr
Gene Name epidermal growth factor receptor
Synonym(s) RP23-295E4.1, 9030024J15Rik, AI552599, avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Erbb, Errp, Her1, Wa5, waved 2 (wa2, wa-2)
Accession Number
NCBI RefSeq: NM_207655; MGI: 95294
Allele Velvet
Institutional SourceBeutler Lab
Mapped Yes 
Chromosome 11
Chromosomal Location 16,752,203-16,918,158 bp (+)
Type of Mutation MISSENSE
DNA Base Change
(Sense Strand)
A to G at 16,904,399 bp (GRCm38)
Amino Acid Change Aspartic acid changed to Glycine
Ref Sequences
D857G in NCBI: NP_997538 (fasta)
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-27 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1e-23 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using NCBI: NP_997538)
Phenotypic Category immune system, inflammatory bowel disease phenotype, lethality-embryonic/perinatal, skin/coat/nails, touch/vibrissae, vision/eye
Penetrance 100% on either C57BL/6 or C57BL/6:C3H/HeN hybrid background 
Alleles Listed at MGI
All alleles(13) : Targeted, knock-out(4) Targeted, other(4) Spontaneous(2) Chemically induced(3)
Lab Alleles APN: IGL01338:Egfr, IGL01529:Egfr, IGL01556:Egfr
UTSW: R0196:Egfr, R0513:Egfr, R0524:Egfr, R0567:Egfr, R0629:Egfr, R0961:Egfr, R1163:Egfr, R1451:Egfr, R1456:Egfr, R1503:Egfr, R1577:Egfr
Mode of Inheritance Autosomal Dominant
Local Stock Embryos, Sperm, gDNA
Repository

JAX: 006926

Last Updated 12/12/2013 6:56 PM by Stephen Lyon
Record Created unknown
Record Posted 02/25/2008
Phenotypic Description

Figure 1. (A and B) Velvet heterozygote mice are born with eyelids open (B), whereas the eyelids of wild type mice remain closed until 12 days after birth (A). Curly vibrissae are observed on Velvet heterozygotes (arrow). (C) Adult heterozygotes have small eyes and corneal opacity; eye secretions are often observed. (A) and (B) reproduced from reference (1).
Figure 2. The fur of adult Velvet heterozygotes appears disoriented, with individual hair shafts projecting in different directions.
Velvet, identified as a dominant, visible phenotype among ENU-induced G1 mutant mice, is characterized by open eyelids and curly vibrissae in heterozygotes at birth (Figure 1A, B) (1). Histological analysis reveals that the eyelids of Velvet mice fail to fuse during embryogenesis, likely because of a defect in epithelial cell migration. In support of this hypothesis, only 53% of Velvet embryonic fibroblasts display migratory ability relative to wild type fibroblasts in vitro. The eyes of adult heterozygotes are small, and show corneal opacity; excessive secretions are always seen at the edges of eyelids (Figure 1C). Eye structures are otherwise normal.
 
The first coat of Velvet heterozygotes is wavy, but the pelage hair later loses its wavy appearance and becomes disoriented, with individual shafts projecting in various directions relative to neighboring shafts (Figure 2). Aside from eyelid and fur abnormalities, unchallenged heterozygous animals appear healthy (with normal body size and cage activity) and show normal fertility.
 
Velvet heterozygotes are susceptible to dextran sodium sulfate (DSS)-induced colitis, exhibiting progressive weight loss beginning around four days after continuous administration of 2% DSS in the drinking water, when wild type mice have not yet lost any weight (see DSS-induced Colitis Screen). Subsequently, Velvet heterozygotes continue to lose weight at a rate significantly faster than observed in wild type mice, with approximately 20% loss of initial body weight by seven days after DSS treatment began compared to 10% in wild type mice.
 
Velvet is a homozygous lethal phenotype, and homozygotes die as embryos between embryonic day (E) 13.5 and E15.5 (1). The placentas of homozygotes display a disorganized labyrinth trophoblast layer, a reduction in total cell number, and the abnormal presence of dead or dying cells. Lethality may therefore be caused by impaired placental development and function.
 
The Velvet phenotype is similar to the waved-1 (2), waved-2 (3), and Waved-5 (4) phenotypes, which result from mutations in the genes encoding transforming growth factor-α (TGF-α, waved-1) and epidermal growth factor receptor (EGFR, waved-2 and Waved-5).

 

Nature of Mutation
The Velvet mutation was mapped to Chromosome 11, and corresponds to an A to G transition at position 2850 of the Egfr transcript, in exon 21 of 28 total exons.
 
2834 CATGTCAAGATCACAGATTTTGGGCTGGCCAAA
852  -H--V--K--I--T--D--F--G--L--A--K-
 
The mutated nucleotide is indicated in red lettering.
Protein Prediction
Figure 3. Domain structure of EGFR. EGFR is composed of an extracellular ligand binding domain followed by a single transmembrane (TM) domain, a juxtamembrane (JM) domain, and a cytoplasmic domain containing a conserved protein tyrosine kinase (PTK) domain and its regulatory sequences. The position of the Velvet mutation is indicated and results in substitution of aspartic acid 857 by glycine.
Figure 4. Crystal structure of two EGFR extracellular domains complexed with two EGF molecules. In order to display the interactions between the two EGFR molecules, domain II is colored in cyan and orange. The other three domains are colored in the same for both EGFR extracellular domains. Domain I is in pink, domain III is in green and domain IV, which is mostly disordered, is in gray. The two EGF molecules are shown in purple. β-strands are represented by flat arrows and α-helices by coils. UCSF Chimera model is based on PDB 1IVO, Ogiso et al., Cell 110, 775-787 (2002). Click on the 3D structure to view it rotate.
The four members of the epidermal growth factor receptor family (EGFR/ErbB1/HER1, ErbB2/HER2, ErbB3/HER3, and ErbB4/HER4) are transmembrane receptor tyrosine kinases (RTKs) activated by ligand-induced dimerization. Like all RTKs, EGFR is composed of an extracellular ligand binding domain (aa 1-621) followed by a single transmembrane domain (aa 622-644), a juxtamembrane domain (aa 645-685), and a cytoplasmic domain containing a conserved protein tyrosine kinase (PTK) domain (aa 686-960) and its regulatory sequences (Figure 3) [(5) and reviewed in (6)]. EGFR is a 170 kD glycoprotein, with protein constituting approximately 130 kD and N-linked carbohydrates the remainder (7). The extracellular domain of EGFR is composed of four subdomains (I-IV); subdomains II and IV are cysteine-rich (8) (Figure 4; PDB ID 1IVO). Domain swapping experiments between the human and chicken extracellular domains (which have a 100-fold different binding affinity for mouse EGF) indicate that domain III (amino acids ~324-508) is a major ligand binding domain in EGFR (9). Biophysical studies demonstrate that dimerization of EGFR involves binding of one EGF molecule to one EGFR molecule, followed by the association of two EGF:EGFR complexes (10). The mechanism of EGFR dimerization, revealed by crystal structure analysis of ligand:receptor complexes (extracellular domains only), involves binding of one EGF molecule to residues in subdomains I and III of one EGFR molecule, and consequent homophilic interactions between loops projecting from subdomain II (“dimerization loop,” aa ~241-268) of two adjacent EGFR extracellular domains (11;12). This dimer conformation, termed “back-to-back,” is thought to represent the physiological dimer conformation, and point mutations of the dimerization loop prevent EGF-induced EGFR signaling (11;12). In the absence of ligand, the dimerization loop is assumed to exist in an unfavorable conformation for dimer formation, and monomeric status is potentially aided by intramolecular interactions between subdomains II and IV that constrain the relative orientation of ligand-binding domains I and III, as seen in the crystal structure of the extracellular domain of ErbB3 (13). The dimerization loop in subdomain II is highly conserved between EGFR family members, and this mechanism of receptor-mediated dimerization provides a means for both homodimerization and heterodimerization with other family members (6).
 
Figure 5. Crystal structure of the EGFR kinase domain. The N-lobe is shown in cyan, the C-lobe is shown in green, the hinge region that forms part of the nucleotide binding site is in purple with a bound inhibitor in gray. β-strands are represented by flat arrows and α-helices by coils. The location of the Velvet mutation is shown in red. UCSF Chimera model is based on PDB 1M17, Stamos et al., J. Biol. Chem. 277, 46265-46272 (2002). Click on the 3D structure to view it rotate.
The kinase domain of EGFR adopts the characteristic bi-lobed architecture of all protein kinases (14) (Figure 5; PDB ID 1M17). The N-terminal (N-) lobe is formed from mostly β-strands and one α-helix, and the C-terminal (C-) lobe is predominantly α-helical. Between the two lobes and created by residues from both lobes are the ATP-binding site and active site. A DFG motif contributed by the C-lobe is thought to be important for ATP coordination (14). Dimerization of EGFR results in trans-autophosphorylation of key tyrosines in the activation loop of the PTK domain, which serve as docking sites for Src-homology 2 (SH2)- and phosphotyrosine-binding (PTB) domain-containing proteins that propagate signaling from the receptor. In contrast to most other tyrosine kinases, phosphorylation of the activation loop tyrosine (Y845) is not critical to EGFR kinase activation (14;15). The activation loop of EGFR assumes a catalytically competent conformation in the absence of this phosphorylation, suggesting that other mechanisms serve to activate EGFR. Mutational analysis and crystallography recently demonstrated that activation of EGFR utilizes an allosteric mechanism that depends on the formation of an asymmetric dimer by the kinase domains, in which the C-lobe of one molecule induces an active conformation in the kinase domain of the other molecule (5).
 
The Velvet mutation results in substitution of aspartic acid 857 by glycine. This C-lobe residue forms part of the DFG motif that contributes to ATP coordination.
Expression/Localization
EGFR is widely expressed in mammalian tissues. In the skin, it is found in proliferating epithelial cells overlying the basement membrane of the epidermis, sebaceous gland and in the hair follicles (16). EGFR is detected in lung epithelial cells, corneal epithelium, and at the edges of eyelids (17). Egfr RNA is also highly expressed in liver (GNF SymAtlas). The protein is localized on the plasma membrane.
Background
Many years before the Egfr gene was cloned, researchers worked to isolate and purify the protein receptor for EGF, a growth factor of great interest due to its potent mitogenic activity toward several types of cultured cells (18), and its potential ability to regulate the differentiation of cells (19). The binding of EGF to responsive cells was found to be mediated by high-affinity cell surface receptor interactions (20;21), and soon after, the formation of EGF-EGFR complexes was demonstrated to result in tyrosine phosphorylation of membrane proteins (22;23). The gene encoding EGFR was later shown to be located on human Chromosome 7 (24).
 
The physiological functions of EGFR family proteins have been investigated using mice lacking or expressing loss-of-function mutations in these molecules. Mice lacking ErbB2 (25), ErbB3 (26), ErbB4 (27) or the ErbB3/4 ligand heregulin (also called neuregulin) (28) die as embryos, with multiple neural and heart defects. ErbB2-, ErbB4- and heregulin-deficient embryos are thought to die prenatally due to a lack of cardiac trabeculae, specialized tissue that helps mediate blood flow before the embryonic heart is fully developed. Defects in neuronal development in these mutants include reduced numbers of sensory ganglia and motor neurons, a lack of Schwann cells, and aberrant innervation of the hindbrain (25-30).
 
EGFR null mice are growth retarded, have developmental defects in multiple systems, and die at different stages of embryogenesis, depending on the strain background (17;31;32). For example, on the 129/Sv background, EGFR mutant embryos die at mid-gestation, whereas on a 129/Sv x C57BL/6 background some survive until birth, and on a 129/Sv x C57BL/6 x MF1 background a few mice survive to postnatal day 20 (17;32). The placentas of Egfr-/- embryos are smaller and structurally abnormal compared to those of wild type mice, likely contributing to the growth retardation and prenatal death of mutant embryos (17;31). In contrast, postnatal death of the few surviving mutant pups may be due to undernourishment because of delayed development of intestines that display hemorrhaging and have fewer villi and thinner muscle walls; the villi eventually disintegrate (31). Egfr-/- mice exhibit abnormal craniofacial development, and develop narrow, elongated snouts, an underdeveloped lower jaw, and a high incidence of cleft palate (31;33). Mutants also display abnormal brain development, particularly in the cerebellum and cortex, which have abnormally few cells and show signs of impaired neuronal migration (32).
 
Other phenotypes displayed by EGFR null mice affect epithelial cell types in several tissues. Egfr-/- lungs at E18.5 are immature compared to those in wild type mice, and contain undifferentiated epithelium in respiratory bronchioles and alveoli (17). These mutants are also born with open eyelids and thin corneas, a lack of or short or curly whiskers, and skin abnormalities (thin, disorganized epidermis; delayed hair follicle differentiation; disoriented and irregularly spaced hair follicles) (17;31;32). Mice that survive to postnatal development fail to grow fur by P7, when wild type mice already have a thick coat (17;31). The tongue epithelium of Egfr-/- mice is thin and immature, with few or no fungiform taste papillae (31;32).
 

Figure 6. EGFR Signaling Pathways.  Several ligands including EGF, TGFα, β-cellulin, and epiregulin bind to EGFR, causing it to homodimerize or to heterodimerize with Erb2, Erb3, or Erb4.  (A) EGF-dependent Ras activation requires the adapter protein GRB2, which associates with the guanine nucleotide exchange factor SOS in unstimulated cells.  Upon EGFR activation, the GRB2/SOS complex relocates to the receptor (either directly or by binding to SHC) at the plasma membrane, allowing SOS to activate RAS.  The GRB2/SOS complex dissociates upon phosphorylation of SOS by MAPK. GRB2 has also been shown to complex with FAK, dynamin, Cb1, Dab-2, SOCS1, and SHIP1.  (B) EGFR activation results in recruitment and phosphorylation of Src and PI3K.  Activated Src also directly phosphorylates the p85 subunit of PI3K that regulates cell proliferation and survival (see (D)), and numerous substrates involved in cytoskeletal organization including p190RhoGAP, FAK, p130Cas, cortactin, EAST, and Eps-8.  The association of phosphorylated p190RhoGAP with p120RasGAP regulates actin stress fiber formation.  (C) Activated EGFR also phosphorylates STAT1 and STAT3, which are not activated by JAK in this pathway.  Activated STAT1 and STAT3 homo- or heterodimerize and subsequently translocate to the nucleus to regulate transcription.  (D) The phospholipases PLD and PLCγ are activated by EGFR and hydrolyze, respectively, phosphatidycholine to produce phosphatidic acid and choline, or PIP2 to generate IP3 and DAG.  These events regulate a number of cellular responses including lipid biosynthesis, NF-κB activation, and cell proliferation.  PI3K activation by EGFR leads to the production of PIP3, which recruits Akt to the plasma membrane where it is phosphorylated and activated by PDK.  Akt phosphorylates numerous substrates including mTOR and Bad, which control cell growth and survival.

EGFR signaling is activated by a variety of ligands and activates several signaling pathways leading to gene transcription, cell proliferation and cell migration (Figure 6). The known ligands for EGFR include EGF, and the EGF-family hormones TGF-α, epiregulin, β-cellulin, heparin-binding (HB)-EGF and amphiregulin, all of which share an EGF-like motif (a predominantly β-sheet structure made up of approximately 50 amino acids including six cysteines, found in all ErbB receptor ligands) (34). Most EGFR ligands are part of a larger precursor, which must be processed to the mature form (by glycosylation, cleavage, etc.). Ligands may bind to only one or to several EGFR family proteins, suggesting that some ligands are functionally redundant. Other signaling pathways can also affect EGFR signaling. For example, activation of G-protein-coupled receptors (GPCRs) by lysophosphatidic acid (LPA), thrombin or endothelin can stimulate matrix metalloproteinases (MMPs) to process HB-EGF, freeing it to activate receptors (35-37). Growth hormone receptor activation can also lead to EGFR activation by stimulating JAK2 to phosphorylate EGFR (38). Presumably, connections between EGFR and other major signaling pathways facilitate the coordination of cellular responses to a variety of stimuli.
 
Ligand binding induces the formation of EGFR homo- or heterodimers and the activation of intrinsic receptor tyrosine kinase activity, resulting in trans-phosphorylation of cytoplasmic tyrosine residues. As mentioned above (Protein Prediction), trans-phosphorylation of receptor tyrosines creates binding sites for SH2 domain- and PTB domain-containing proteins which recruit complexes that propagate downstream signaling. These proteins include the adapters Grb2, Nck, Crk, and Shc, phosphatases PTP-1B and SHP-1, tyrosine kinases Src and Abl, and PLC-γ, and p120RasGAP [reviewed in (34;39)]. Their binding leads to substrate phosphorylation and the activation of multiple pathways, including the Ras-MAPK, Src and Abl family kinase, JNK, STAT and PLC-γ pathways. These in turn regulate transcriptional programs controlling cell proliferation, death and differentiation, as well as signaling cascades controlling cell adhesion, motility and migration. Termination of signaling from the EGFR is mediated by receptor endocytosis (40-42).
 
Because of its strong mitogenic function, the EGFR signaling pathway is frequently found to be hyperactivated in cancers, and continues to be intensely studied as a target of therapeutic agents. Mutations in EGFR itself are particularly common in brain cancers (gliomas) but are also found in cancers of the neck, pancreas, kidney, colon, breast, lung, ovary, prostate, bladder and lung [reviewed in (43)]. Gene amplification of EGFR and/or deletion of part of the extracellular domain leading to constitutive activation are commonly found in tumor cells (44;45). Somatic mutations in the tyrosine kinase domain of EGFR have recently been identified in non-small-cell lung cancers (46). A number of EGFR-targeted therapeutics are approved or undergoing clinical trials for cancer treatment. So far, these therapeutics are either ectodomain-binding antibodies or small-molecule tyrosine kinase inhibitors.
Putative Mechanism
During normal mouse embryonic development, the eyelids begin to grow across the surface of the developing eye at E12.5, with the upper and lower eyelids eventually fusing tightly with each other at E16.5. They remain fused until approximately 12 days after birth (47). Failure of fusion leads to a readily apparent “open-eyelids-at-birth” defect. A number of mutations cause eyelid closure defects, including recessive mutations in the Tgfa, Egfr, MEKK-1 and Fgfr2 loci (2;3;17;31;32;48-50). A number of unidentified loci, such as eob, lgGa, oe, and gp, can also produce an open-eyelid defect (51-53). In some cases, a wavy coat and curly vibrissae accompany open eyelids. This complex of traits is exemplified by the classical spontaneous mutations waved-1 (wa1) and waved-2 (wa2), which represent recessive lesions in the Tgfa and Egfr genes, respectively.
 
The outer root sheath of the hair follicle and the epidermal layer of the eyelid probably express EGFR in greater abundance than most other tissues (16); both areas display an immense proliferative capacity. Transgenic expression of a dominant negative human EGFR in the basal layer of the epidermis and outer root sheath of hair follicles results initially in short, wavy pelage hair and curly whiskers, later deteriorating to alopecia accompanied by epidermal abnormalities (54). Thus, both the outer root sheath of hair follicles and the epidermal layer of the eyelid probably depend upon EGFR signaling for normal development, and in particular upon its function as a regulator of cell migration through the extracellular matrix, a process that is highly dependent upon interactions between epithelium and underlying mesenchyme. EGFR is linked to two pathways of particular importance in the promotion of cell motility: the PLCγ and the Ras-MAPK pathways. EGF-induced cell movement requires PLCγ activation (55), which stimulates cell motility by releasing PIP2-bound gelsolin to cap actin filaments (56). The Ras-MAPK pathway may regulate cell movement by promoting the disassembly of focal adhesions (57), and/or by promoting acto-myosin contractility through activation of myosin light chain kinase (58). Mutations that disrupt signal transduction in these pathways can cause dysregulation of cell migration, an effect that may be manifested in defects of eyelid and hair development, as seen in mice with EGFR mutations.
 
The Velvet mutation results in substitution of aspartic acid 857 by glycine. This C-lobe residue forms part of the DFG motif which defines the beginning of the activation loop and contributes to ATP coordination (14). The DFG motif is conserved in EGFR proteins across species, and among tyrosine kinase domains (1). In addition to ATP coordination, it is thought to promote and maintain the catalytically active conformation of the activation loop. The Velvet mutation replaces the bulky, acidic side chain of aspartic acid with the hydrogen atom of glycine, and confers a dominant loss-of-function phenotype to the receptor. The mutated EGFR is still expressed in vivo, although autophosphorylation is drastically reduced compared to that observed in wild type mice. The strong dominant effect of the Velvet allele has been explained by a "poison subunit" model. In vitro, the EgfrVelvet product has a clear dose-dependent inhibitory effect on EGF-induced MAPK activation, supporting the hypothesis that upon dimer formation, the mutated receptor can impair the function of normal receptors (1). Such a mutated receptor may disrupt signal transduction through EGFR homodimers and heterodimers alike. In this respect, the kinase-dead Velvet allele would predictably be more deleterious than a null allele.
 
It appears that homozygous Egfrwa2/wa2 mice exhibit a phenotype approximately similar to heterozygous EgfrVelvet/+ mice. The wa2 mutation is a valine to glycine substitution near the N terminus of the kinase domain which drastically reduces EGFR tyrosine kinase activity in vitro, and moderately reduces it in vivo (3). Egfrwa2/wa2 mutants clearly retain some EGFR signaling ability, since injection of newborn Egfrwa2/wa2 mice with EGF for two weeks promotes accelerated eyelid opening and incisor eruption (3), a known effect of EGF administration in vivo (59). Notably, Velvet is phenotypically identical to Waved-5 (Wa5), which was ascribed to an identical ENU-induced nucleotide substitution in mice of mixed background (BALB/c x C3H x C57BL/6J) (4). In this study, Egfrwa2/Wa5 compound heterozygotes were generated and found to exhibit phenotypes similar to those of Egfr-/- mice. Four out of 16 Egfrwa2/Wa5 mice survived until three months of age but were severely growth retarded, and developed complete alopecia at approximately eight weeks of age. Egfrwa2/Wa5 mice also had craniofacial malformations, including underdeveloped jaws and narrow, elongated snouts (4). These data support the idea that the Wa5 or Velvet allele encodes a “poison subunit” that can further impair the function of the hypomorphic wa2 allele.
Genotyping
Velvet genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.
 
Primers
Vel(F): 5’-GTCATTCATGCCAGATAATTCCAA -3’
Vel(R): 5’-CCATTCACAAAGTAGAG-3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 60°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 35X
6) 72°C             5:00
7) 4°C              ∞
 
The following sequence of 519 nucleotides (from Genbank genomic region NC_000077 for linear DNA sequence of Egfr) is amplified:
 
151901                                             gtcattcatg ccagataatt
151921 ccaaatgttt gccaaccgca tcaagcaaag tacaaaggct aaaaacacag tccttggtgt
151981 tgagcagcct agagattctt gtggatttaa ccctgtgttc aggtgcatgg gtgctagctt
152041 cccatgacac tgaggatgcc cagatggttc actccctcac ggcagcatcc tctgtatttc
152101 agggcatgaa ctacctggaa gatcggcgtt tggtgcaccg tgacttggca gccaggaatg
152161 tactggtgaa gacaccacag catgtcaaga tcacagattt tgggctggcc aaactgcttg
152221 gtgctgaaga gaaagaatat catgccgagg ggggcaaagt aagtcctggg agtagatcag
152281 gaagcatttt cctgacagcc cagacccatc cccctccctg tcagctgtgg gcagcatttg
152341 ccaaagattc tgagtggggt cagagcagct gccaccatga cctgaatctc gtcagggtca
152401 ttctctactt tgtgaatgg
 
Primer binding sites are underlined; the mutated A is shown in red text.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsXin Du, Katharina Brandl, Bruce Beutler
Edit History
08/25/2011 4:28 PM (current)
08/25/2011 4:27 PM
08/25/2011 2:24 PM
08/25/2011 2:22 PM
07/11/2011 12:04 PM
07/11/2011 12:03 PM
07/11/2011 12:00 PM
07/11/2011 11:48 AM
07/11/2011 11:45 AM
07/11/2011 11:39 AM
01/07/2011 9:57 AM
12/14/2010 3:18 PM
12/08/2010 11:53 AM
12/08/2010 11:53 AM
11/23/2010 12:15 PM
02/03/2010 3:03 PM