Phenotypic Mutation 'Magnificat'

• Allele: Magnificat
• Mutation Type: missense
• Chromosome: 4
• Coordinate: 32,563,324 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Bach2
• Gene Name: BTB and CNC homology, basic leucine zipper transcription factor 2
• Synonym(s): E030004N02Rik
• Chromosomal Location: 32,238,804-32,586,108 bp (+) (GRCm39)
• MGI Phenotype: PHENOTYPE: Homozygous null mice display impaired B cell differentiation and reduced B cell numbers. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamic Acid changed to Valine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000043693] [ENSMUSP00000103815] [ENSMUSP00000131592]
• AlphaFold: P97303
• SMART Domains: Protein: ENSMUSP00000043693; Gene: ENSMUSG00000040270; AA Change: E474V

Domain	Start	End	E-Value	Type
BTB	37	133	3.21e-28	SMART
low complexity region	276	287	N/A	INTRINSIC
low complexity region	313	326	N/A	INTRINSIC
low complexity region	328	343	N/A	INTRINSIC
BRLZ	520	584	2.3e-14	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000037416)
• SMART Domains: Protein: ENSMUSP00000103815; Gene: ENSMUSG00000040270; AA Change: E597V

Domain	Start	End	E-Value	Type
BTB	37	133	3.21e-28	SMART
low complexity region	276	287	N/A	INTRINSIC
low complexity region	313	326	N/A	INTRINSIC
low complexity region	328	343	N/A	INTRINSIC
low complexity region	514	527	N/A	INTRINSIC
BRLZ	643	707	2.3e-14	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000108180)
• SMART Domains: Protein: ENSMUSP00000131592; Gene: ENSMUSG00000040270; AA Change: E597V

Domain	Start	End	E-Value	Type
BTB	37	133	3.21e-28	SMART
low complexity region	276	287	N/A	INTRINSIC
low complexity region	313	326	N/A	INTRINSIC
low complexity region	328	343	N/A	INTRINSIC
low complexity region	514	527	N/A	INTRINSIC
BRLZ	643	707	2.3e-14	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000171600)
• Meta Mutation Damage Score: 0.1342
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2018-10-14 4:02 PM by Anne Murray
• Record Created: 2018-05-24 2:52 PM by Bruce Beutler
• Record Posted: 2019-01-22
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001109661; MGI:894679

Alleles Listed at MGI

All Mutations and Alleles(14) : Chemically and radiation induced(1) Chemically induced (ENU)(2)  Gene trapped(3) Targeted(8)

Phenotypic Description

Figure 1. Magnificat mice exhibit reduced CD4 + to CD8 + T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Magnificat mice exhibit decreased frequencies of peripheral CD4 + T cells in CD3 + T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Magnificat mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Magnificat phenotype was identified among G3 mice of the pedigree R5983, some of which showed reduced CD4⁺ to CD8⁺ T cell ratios (Figure 1) due to reduced frequencies of CD4⁺ T cells in CD3⁺ T cells (Figure 2) in the peripheral blood. Some mice also showed increased frequencies of B1 cells in the peripheral blood (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the increased B1 cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 29 mutations (X-axis) identified in the G1 male of pedigree R5983. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 29 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Bach2:  an A to T transversion at base pair 32,563,324 (v38) on chromosome 4, or base pair 324,751 in the GenBank genomic region NC_000070. The strongest association was found with an additive model of inheritance to the normalized B1 cell frequency, wherein 12 variant homozygotes and 60 heterozygous mice departed phenotypically from 48 homozygous reference mice with a P value of 2.083 x 10^-12 (Figure 4).   

The mutation corresponds to residue 1,951 in the mRNA sequence NM_001109661 within exon 3 of 5 total exons.

1935 TCTGGATCATTCTCGGAAGCAGACAGTGAGTCG 592  -S--G--S--F--S--E--A--D--S--E--S-

The mutated nucleotide is indicated in red. The mutation results in a glutamic acid to valine substitution at position 597 (E597V) in the BACH2 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction

Figure 5. Domain organization of BACH2. The Magnificat mutation results in a glutamic acid to valine substitution at position 597. Abbreviations: BTB, broad complex-tramtrack-bric-a-brac; CP, cysteine-proline motifs; bZIP, basic leucine zipper; NES, nuclear export signal

Bach2 encodes BACH2 (BTB [broad complex-tramtrack-bric-a-brac] and CNC [Cap'n'collar] homology-2). BACH2 is a member of the BACH subfamily of basic region leucine zipper (bZIP) transcription factors. The BACH family also includes BACH1.

BACH2 contains a BTB/POZ (poxvirus and zinc finger) protein interaction domain, a CNC-type bZIP domain, a heme-binding region with five cysteine-proline motifs, and a cytoplasmic localization signal that mediates its nuclear export and cytoplasmic localization (Figure 5) (1). The human BACH2 protein is 89.5 percent identical to mouse BACH2; the two proteins share 97 percent identity in the BTB and bZIP domains and 94 percent in the serine-rich region (2).

The BTB/POZ domain is a highly conserved domain of approximately 100 amino acids that contains a dimerization interface, a possible oligomerization surface, and surfaces for interactions with other factors (e.g., nuclear corepressors and histone deacetylases [HDACs]) [reviewed in (3)]. (4-6). The most conserved region of the BTB domain consists of a core of 5 α-helices flanked by 3 short β-sheets; various BTB-containing protein families display N- or C-terminal extensions to this core fold.

The bZIP domain mediates heterodimerization, and also contains a nuclear localization signal. BACH2 heterodimerizes with MafK, MafF, and MafG, which are bZIP proteins that can function as transcriptional activators or repressors (7). BACH2/MafK binds to Maf recognition elements [MARE; TGCTGA(G/C)TCA(T/C)] in target genes. BACH2 putatively regulates whether MafK will function as an activator or repressor (7).

Heme binding to BACH2 regulates the function of BACH2 by preventing BACH2 DNA binding. The heme-binding region is disordered, but heme binding alters its conformation (8). The BACH proteins maintain heme homeostasis in response to oxidative stress. BACH2 functions in oxidative stress-mediated apoptosis and in macrophage-mediated innate immunity and the adaptive immune response. BACH2-bound heme regulates B cell differentiation, antibody class switch, and heme oxygenase-1 expression in B cells (1).

PI3K-mediated phosphorylation of BACH2 at Ser520 (in mouse) promotes the cytoplasmic localization and accumulation of BACH2, inhibiting BACH2 function (9;10). BACH2 is also phosphorylated to Ser535 and Ser509 (10). Ser535 phosphorylation regulates cytoplasmic accumulation of BACH2; mutation of Ser535 promotes nuclear accumulation of BACH2 in pre-B cells. The role of Ser509 phosphorylation is unknown. BACH2 is also SUMOylated, which regulates BACH2 mobility to nuclear foci (11) as well as recruitment around promyelocytic leukemia (PML) bodies associated with transcription activity in response to oxidative stress (12). BACH2 is deSUMOylated by SENP3, which prevents the nuclear export of BACH2 (13). Lack of BACH2 nuclear export results in repression of CD4+ T effector cell differentiation genes and stabilization of Treg cell-specific gene signatures (13).

The Magnificat mutation results in a glutamic acid to valine substitution at position 597 (E597V); Glu597 is within an undefined region preceding the bZIP domain.

Expression/Localization

Bach2 is predominantly expressed in the thymus, spleen, and leukocytes; low expression levels were detected in the small intestine and brain (2). BACH2 is expressed in primary B cells at the progenitor, precursor, immature, and mature B-cell stages (14). Bach2 is also expressed in CD4⁺ T cells, memory CD8⁺ T cells, and macrophages (15;16). In T cells, Bach2 is expressed at low levels in immature thymocytes, but expression is increased in peripheral mature CD4⁺ T cells and CD8⁺ T cells (15). BACH2 mRNA and protein is primarily expressed in B-lymphoid cell lines compared to other hematopoietic cell lines (2).

Without a stimulus, BACH2 is localized to the cytoplasm; oxidative stress promotes BACH2 nuclear localization (17).

Background

Figure 6. BACH2 function in T and B cell development. Bach2 expression increases as T cells differentiate into single positive T cells in the thymus. In the periphery, Bach2 expression decreases as T cells are activated and develop into effector T cells. Bach2 promotes Treg differentiation, but suppresses factors associated with Th1, Th2, and Th17 subset formation. Bach2 also regulates factors associated with B cell differentiation, proliferation, survival, and cell cycle progression. Steps enhanced by BACH2 are noted in green. Steps inhibited by BACH2 are noted in red. See the text and Table 1 for details.

BACH2, in cooperation with the Maf proteins, suppresses the expression of target genes that regulate several immune-related functions, such as regulatory T cell development, T and B cell differentiation, germinal center formation, somatic hypermutation, immunoglobulin gene conversion, and class switch recombination by (Figure 6 and Table 1).

Table 1. Select BACH2 target genes

Target	Effect	References
Hmox1	Maintains T cells in a naïve state	(15)
P3h3
Prdm1 (alternatively, Blimp-1)	Regulates differentiation of effector CD4+ T cells, memory CD8+ T cell, and B cells	(15;18-21)
Id3	Memory CD8+ T cell differentiation	(22)
Irf4 (see the record for honey)	Regulates CD4+ T cell effector differentiation, Th2 cytokine production, Th2 cell differentiation	(3;23)
Gata3	Regulates CD4+ T cell effector differentiation	(3)
Nfil3 (see the record for luna)
Il12rb1 and Il12rb2
Map3k8 (alternatively, TPL2 [see the record for Sluggish])
Gadd45g
Il2	Regulates AP-1-driven CD4+ T cell activation	(24)
Ccr4 and Ccr9	Treg cell development	(18)
Ahr	Th17 differentiation	(25)
Cebpb	B cell differentiation	(14)
Cdkn1a, Cdkn2a, and Cdkn2b	BCR-induced B cell proliferation, survival, and cell cycle progression	(26)
Ccnd3	Cell cycle arrest in B cells	(27)

Abbreviations: Hmox1, heme oxygenase 1; P3h3, Prolyl 3-hydroxylase 3; Prdm1, PR domain containing 1, with ZNF domain; Id3, inhibitor of DNA binding 3; Gata3, GATA binding protein 3; Irf4, interferon regulatory factor 4; Nfil3, nuclear factor, interleukin 3, regulated; Il12rb1, interleukin 12 receptor, beta 1; Il12rb2, interleukin 12 receptor, beta 2; Map3k8, mitogen-activated protein kinase kinase kinase 8; Gadd45g, growth arrest and DNA-damage-inducible 45 gamma; Il2, interleukin 2; Ccr4, chemokine (C-C motif) receptor 4; Ccr9, chemokine (C-C motif) receptor 9; Ahr, aryl hydrocarbon receptor; Cebpb, CCAAT/enhancer binding protein (C/EBP), beta; Cdkn1a, cyclin-dependent kinase inhibitor 1A (P21); Cdkn2a, cyclin-dependent kinase inhibitor 2A, Cdkn2b, cyclin-dependent kinase inhibitor 2B; Ccnd3, cyclin D3

B cells

BACH2 regulates several functions in B cells: (i) differentiation of common lymphoid progenitors to B cells; (ii) the antibody response, due to its function in class switch recombination and somatic hypermutation of antibody genes; (iii) negative selection through activation of p53 at the pre-BCR checkpoint (28). The pre-BCR checkpoint is after B cells undergo recombination of the immunoglobulin heavy and light chain genes. B cells that fail to rearrange are eliminated, but those that rearrange are reserved. (iv) B cell proliferation in response to B cell receptor-associated signaling (26); (v) expression of Bcl-xL and the repression of cyclin-dependent kinase inhibitors in order to regulate BCR-induced proliferation, survival, and cell cycle progression. B cells from Bach2-deficient mice showed reduced cell cycle progression after BCR engagement and lower incorporation of BrdU as well as increased rates of apoptosis.

T cells

BACH2 is a T cell ‘super enhancer’ that represses many genes needed for T cell function. Super enhancers are large clusters of transcriptional enhancers that promote the expression of genes and thus decide cell identity (29). Super enhancer regions are usually associated with cytokine or cytokine receptor genes (e.g., Ifng, Il17a,f [see the record for seventeenager], and Il4ra [see the record for Lowe]) and lineage determining transcription factor genes (e.g., Tbx21 [see the record for plateau], Gata3, and Rorc [see the record for chestnut].

BACH2 is required to maintain naïve T cell quiescence in the periphery (15). BACH2 deletion in T cells resulted in reduced numbers of naïve CD4 T cells and an increase of CD62L-negative cells that resembled effector memory T cells (15). The BACH2-deficient CD62L-negative cells did not develop into functional antigen-specific effector memory T cells, and the cells were less efficient in protecting the host from Listeria monocytogenes infection or inducing colitis after transfer into Rag1^-/- recipient mice (15). BACH2-deficient T cells spontaneously developed an activated phenotype without exposure to an antigen, indicating that BACH2 restrains T cell activation at steady-state. BACH2-deficient CD4 T cells showed increased Th2 differentiation and increased levels of Th2-associated cytokines (15).

BACH2 is required for the formation of thymic (tTreg) and induced regulatory (iTreg) T cells expressing FOXP3 (18). BACH2 represses the differentiation programs of CD4+ T cell effector lineages and stabilizes Treg cell development. BACH2-deficient cells differentiated primarily into Th1, Th2, and Th17 cells instead of iTreg cells after stimulation. BACH2 represses several genes in effector lineage cells, including Ccr4 and Ccr9. BACH2 can also restrain Th17 differentiation putatively by repressing the expression of the aryl hydrocarbon receptor (25). BACH2 and BCL-6 putatively work independently, simultaneously, or coordinately to mediate Tfh cell development by suppressing Prdm1 expression (30).

Macrophages

BACH2 is essential for the function of alveolar macrophages, which are responsible for the uptake and degradation of pulmonary surfactant (16). Bach2-deficient mice develop a respiratory condition with age that mimics human pulmonary surfactant proteinosis (16). Alveolar macrophages from the mice show changes in the expression of genes that function in chemotaxis, lipid metabolism, and alternative M2 macrophage activation.

Human disease

BACH2 is a multiple sclerosis susceptibility gene. BACH2 expression is reduced in the blood of multiple sclerosis patients (31). BACH2 is a putative susceptibility gene for other autoimmune conditions, including rheumatoid arthritis (32), systemic lupus erythematosus (33), asthma (34), inflammatory bowel disease (35), vitiligo (36), type 1 diabetes (37), Addison’s disease (38), and Graves’ disease (39). Chromosomal translocation of BACH2 has been detected in lymphoma and leukemia patients; BACH2 is fused with the loci of IgH (40) and BCL2L1 (41).

BACH2 is a tumor suppressor in pre-B cell acute lymphocytic leukemia and mantle cell lymphoma; reduced levels of BACH2 are associated with poor outcome in mantle cell lymphoma patients (42). BACH2 mediates p53-dependent tumor suppression at the pre-B cell receptor checkpoint (28).

BACH mutant mice

Bach2-deficient (Bach2^-/-) mice show high serum levels of IgM, but reduced levels of IgG subclasses and IgA compared to wild-type mice (43). The Bach2^-/- mice also showed aberrant T-independent and T-dependent IgG responses, indicating defective class switch recombination, somatic hypermutation, and germinal center formation (43). Bach2^-/- mice are normal at birth, but exhibit a progressive wasting disease with reduced survival (18). The Bach2^-/- mice showed increased levels of autoantibodies as well as pulmonary and intestinal inflammation (18). Characterization of a EUCOMM Bach2 mutant mouse showed that the mice had increased numbers of eosinophils, neutrophils, NK cells, NK T cells, CD4+ T cells, effector memory CD4+ T cells, monocytes, and myeloid cells with concomitant reduced numbers of B cells and naïve CD8+ T cells (MGI). The mice also showed reduced circulating levels of creatinine and insulin as well as reduced bone mineral content and bone mineral density. Homozygous mice bearing an ENU-induced missense mutation (Ser16Pro) showed reduced numbers of B220+ B cells, reduce marginal zone B cells in the spleen, and mild myeloid expansion (MGI). A second ENU-induced mouse model bearing an Glu81Gly mutation showed increased immature B cell numbers with concomitant reduced numbers of mature B cells (MGI). Expression of IgM was increased on the surface of the mutant B cells.

Putative Mechanism

The phenotypes observed in the Magnificat mice indicates loss of BACH2-associated function in T and B cell differentiation.

Primers

PCR Primer
Magnificat_pcr_F: CGTATTCCTACGCAGAGGAC
Magnificat_pcr_R: GGTCACCTTTAACCTTGACACC

Sequencing Primer
Magnificat_seq_F: TCCTACGCAGAGGACGGGAG
Magnificat_seq_R: AATGCCTCCATGAGATCTGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 773 nucleotides is amplified (chromosome 4, + strand):

1   cgtattccta cgcagaggac gggagtgggg gctccccctg cagcctccct ctctgtgagt
61  tctcctcttc gccctgttcc cagggagcca gattccttgc cacggaacat caggaaccag
121 gcctgatggg agatggaatg tacaaccaag tccgacccca gattaaatgt gagcagtctt
181 acggaaccaa ttccagtgac gagtctggat cattctcgga agcagacagt gagtcgtgtc
241 ctgtgcagga caggggccag gaggtaggga atcctaagtt tcaagcgtgt gacctactat
301 ctcagtcctt tccctctacc caaacatcac tctcaggtcg ttcttttatg ttgtcatagt
361 tagggtttct gttgctgtga ctaaacgcca tgaccaaaaa ccaatctgag gaggaaagag
421 tttatctggt ttacgcgtgc atgtttctgt tcatcatcaa aggtaatcag gacaagagct
481 cagtcaaggc aggagctggt gcagaggctg tggagcggtg ctgcttactg gcttgctcct
541 catggcttgt tcagcccgca ttcttttaga actaaggagc accagctcag ggatggcacc
601 acccacaatg ggatggaccc tcccccacca atccctaatt taagaaatta ccctccagcc
661 agatctcatg gaggcatttt ctcaattaag attccctcct tccagatagc tctagtttat
721 gtgtccagct gacatgagat cagccagcac aggtgtcaag gttaaaggtg acc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Sasaki, S., Ito, E., Toki, T., Maekawa, T., Kanezaki, R., Umenai, T., Muto, A., Nagai, H., Kinoshita, T., Yamamoto, M., Inazawa, J., Taketo, M. M., Nakahata, T., Igarashi, K., and Yokoyama, M. (2000) Cloning and Expression of Human B Cell-Specific Transcription Factor BACH2 Mapped to Chromosome 6q15. Oncogene. 19, 3739-3749.

  2. Watanabe-Matsui, M., Muto, A., Matsui, T., Itoh-Nakadai, A., Nakajima, O., Murayama, K., Yamamoto, M., Ikeda-Saito, M., and Igarashi, K. (2011) Heme Regulates B-Cell Differentiation, Antibody Class Switch, and Heme Oxygenase-1 Expression in B Cells as a Ligand of Bach2. Blood. 117, 5438-5448.

  3. Stogios, P. J., Downs, G. S., Jauhal, J. J., Nandra, S. K., and Prive, G. G. (2005) Sequence and Structural Analysis of BTB Domain Proteins. Genome Biol. 6, R82.

  4. Stogios, P. J., Chen, L., and Prive, G. G. (2007) Crystal Structure of the BTB Domain from the LRF/ZBTB7 Transcriptional Regulator. Protein Sci. 16, 336-342.

  5. Rosbrook, G. O., Stead, M. A., Carr, S. B., and Wright, S. C. (2012) The Structure of the Bach2 POZ-Domain Dimer Reveals an Intersubunit Disulfide Bond. Acta Crystallogr D Biol Crystallogr. 68, 26-34.

  6. Oyake, T., Itoh, K., Motohashi, H., Hayashi, N., Hoshino, H., Nishizawa, M., Yamamoto, M., and Igarashi, K. (1996) Bach Proteins Belong to a Novel Family of BTB-Basic Leucine Zipper Transcription Factors that Interact with MafK and Regulate Transcription through the NF-E2 Site. Mol Cell Biol. 16, 6083-6095.

  7. Watanabe-Matsui, M., Matsumoto, T., Matsui, T., Ikeda-Saito, M., Muto, A., Murayama, K., and Igarashi, K. (2015) Heme Binds to an Intrinsically Disordered Region of Bach2 and Alters its Conformation. Arch Biochem Biophys. 565, 25-31.

  8. Zhou, Y., Wu, H., Zhao, M., Chang, C., and Lu, Q. (2016) The Bach Family of Transcription Factors: A Comprehensive Review. Clin Rev Allergy Immunol. 50, 345-356.

  9. Yoshida, C., Yoshida, F., Sears, D. E., Hart, S. M., Ikebe, D., Muto, A., Basu, S., Igarashi, K., and Melo, J. V. (2007) Bcr-Abl Signaling through the PI-3/S6 Kinase Pathway Inhibits Nuclear Translocation of the Transcription Factor Bach2, which Represses the Antiapoptotic Factor Heme Oxygenase-1. Blood. 109, 1211-1219.

  10. Ando, R., Shima, H., Tamahara, T., Sato, Y., Watanabe-Matsui, M., Kato, H., Sax, N., Motohashi, H., Taguchi, K., Yamamoto, M., Nio, M., Maeda, T., Ochiai, K., Muto, A., and Igarashi, K. (2016) The Transcription Factor Bach2 is Phosphorylated at Multiple Sites in Murine B Cells but a Single Site Prevents its Nuclear Localization. J Biol Chem. 291, 1826-1840.

  11. Kono, K., Harano, Y., Hoshino, H., Kobayashi, M., Bazett-Jones, D. P., Muto, A., Igarashi, K., and Tashiro, S. (2008) The Mobility of Bach2 Nuclear Foci is Regulated by SUMO-1 Modification. Exp Cell Res. 314, 903-913.

  12. Tashiro, S., Muto, A., Tanimoto, K., Tsuchiya, H., Suzuki, H., Hoshino, H., Yoshida, M., Walter, J., and Igarashi, K. (2004) Repression of PML Nuclear Body-Associated Transcription by Oxidative Stress-Activated Bach2. Mol Cell Biol. 24, 3473-3484.

  13. Yu, X., Lao, Y., Teng, X. L., Li, S., Zhou, Y., Wang, F., Guo, X., Deng, S., Chang, Y., Wu, X., Liu, Z., Chen, L., Lu, L. M., Cheng, J., Li, B., Su, B., Jiang, J., Li, H. B., Huang, C., Yi, J., and Zou, Q. (2018) SENP3 Maintains the Stability and Function of Regulatory T Cells Via BACH2 deSUMOylation. Nat Commun. 9, 3157-018-05676-6.

  14. Itoh-Nakadai, A., Hikota, R., Muto, A., Kometani, K., Watanabe-Matsui, M., Sato, Y., Kobayashi, M., Nakamura, A., Miura, Y., Yano, Y., Tashiro, S., Sun, J., Ikawa, T., Ochiai, K., Kurosaki, T., and Igarashi, K. (2014) The Transcription Repressors Bach2 and Bach1 Promote B Cell Development by Repressing the Myeloid Program. Nat Immunol. 15, 1171-1180.

  15. Tsukumo, S., Unno, M., Muto, A., Takeuchi, A., Kometani, K., Kurosaki, T., Igarashi, K., and Saito, T. (2013) Bach2 Maintains T Cells in a Naive State by Suppressing Effector Memory-Related Genes. Proc Natl Acad Sci U S A. 110, 10735-10740.

  16. Nakamura, A., Ebina-Shibuya, R., Itoh-Nakadai, A., Muto, A., Shima, H., Saigusa, D., Aoki, J., Ebina, M., Nukiwa, T., and Igarashi, K. (2013) Transcription Repressor Bach2 is Required for Pulmonary Surfactant Homeostasis and Alveolar Macrophage Function. J Exp Med. 210, 2191-2204.

  17. Hoshino, H., Kobayashi, A., Yoshida, M., Kudo, N., Oyake, T., Motohashi, H., Hayashi, N., Yamamoto, M., and Igarashi, K. (2000) Oxidative Stress Abolishes Leptomycin B-Sensitive Nuclear Export of Transcription Repressor Bach2 that Counteracts Activation of Maf Recognition Element. J Biol Chem. 275, 15370-15376.

  18. Roychoudhuri, R., Hirahara, K., Mousavi, K., Clever, D., Klebanoff, C. A., Bonelli, M., Sciume, G., Zare, H., Vahedi, G., Dema, B., Yu, Z., Liu, H., Takahashi, H., Rao, M., Muranski, P., Crompton, J. G., Punkosdy, G., Bedognetti, D., Wang, E., Hoffmann, V., Rivera, J., Marincola, F. M., Nakamura, A., Sartorelli, V., Kanno, Y., Gattinoni, L., Muto, A., Igarashi, K., O'Shea, J. J., and Restifo, N. P. (2013) BACH2 Represses Effector Programs to Stabilize T(Reg)-Mediated Immune Homeostasis. Nature. 498, 506-510.

  19. Kim, E. H., Gasper, D. J., Lee, S. H., Plisch, E. H., Svaren, J., and Suresh, M. (2014) Bach2 Regulates Homeostasis of Foxp3+ Regulatory T Cells and Protects Against Fatal Lung Disease in Mice. J Immunol. 192, 985-995.

  20. Kometani, K., Nakagawa, R., Shinnakasu, R., Kaji, T., Rybouchkin, A., Moriyama, S., Furukawa, K., Koseki, H., Takemori, T., and Kurosaki, T. (2013) Repression of the Transcription Factor Bach2 Contributes to Predisposition of IgG1 Memory B Cells Toward Plasma Cell Differentiation. Immunity. 39, 136-147.

  21. Ochiai, K., Katoh, Y., Ikura, T., Hoshikawa, Y., Noda, T., Karasuyama, H., Tashiro, S., Muto, A., and Igarashi, K. (2006) Plasmacytic Transcription Factor Blimp-1 is Repressed by Bach2 in B Cells. J Biol Chem. 281, 38226-38234.

  22. Hu, G., and Chen, J. (2013) A Genome-Wide Regulatory Network Identifies Key Transcription Factors for Memory CD8(+) T-Cell Development. Nat Commun. 4, 2830.

  23. Yamashita, M., and Kuwahara, M. (2018) The Critical Role of Bach2 in Regulating Type 2 Chronic Airway Inflammation. Int Immunol. 30, 397-402.

  24. Jang, E., Lee, H. R., Lee, G. H., Oh, A. R., Cha, J. Y., Igarashi, K., and Youn, J. (2017) Bach2 Represses the AP-1-Driven Induction of Interleukin-2 Gene Transcription in CD4 T Cells. BMB Rep. 50, 472-477.

  25. Veldhoen, M., Hirota, K., Westendorf, A. M., Buer, J., Dumoutier, L., Renauld, J. C., and Stockinger, B. (2008) The Aryl Hydrocarbon Receptor Links TH17-Cell-Mediated Autoimmunity to Environmental Toxins. Nature. 453, 106-109.

  26. Miura, Y., Morooka, M., Sax, N., Roychoudhuri, R., Itoh-Nakadai, A., Brydun, A., Funayama, R., Nakayama, K., Satomi, S., Matsumoto, M., Igarashi, K., and Muto, A. (2018) Bach2 Promotes B Cell Receptor-Induced Proliferation of B Lymphocytes and Represses Cyclin-Dependent Kinase Inhibitors. J Immunol. 200, 2882-2893.

  27. Tamahara, T., Ochiai, K., Muto, A., Kato, Y., Sax, N., Matsumoto, M., Koseki, T., and Igarashi, K. (2017) The mTOR-Bach2 Cascade Controls Cell Cycle and Class Switch Recombination during B Cell Differentiation. Mol Cell Biol. 37, 10.1128/MCB.00418-17. Print 2017 Dec 15.

  28. Swaminathan, S., Huang, C., Geng, H., Chen, Z., Harvey, R., Kang, H., Ng, C., Titz, B., Hurtz, C., Sadiyah, M. F., Nowak, D., Thoennissen, G. B., Rand, V., Graeber, T. G., Koeffler, H. P., Carroll, W. L., Willman, C. L., Hall, A. G., Igarashi, K., Melnick, A., and Muschen, M. (2013) BACH2 Mediates Negative Selection and p53-Dependent Tumor Suppression at the Pre-B Cell Receptor Checkpoint. Nat Med. 19, 1014-1022.

  29. Whyte, W. A., Orlando, D. A., Hnisz, D., Abraham, B. J., Lin, C. Y., Kagey, M. H., Rahl, P. B., Lee, T. I., and Young, R. A. (2013) Master Transcription Factors and Mediator Establish Super-Enhancers at Key Cell Identity Genes. Cell. 153, 307-319.

  30. Ochiai, K., Muto, A., Tanaka, H., Takahashi, S., and Igarashi, K. (2008) Regulation of the Plasma Cell Transcription Factor Blimp-1 Gene by Bach2 and Bcl6. Int Immunol. 20, 453-460.

  31. Perga, S., Montarolo, F., Martire, S., Berchialla, P., Malucchi, S., and Bertolotto, A. (2015) Anti-Inflammatory Genes Associated with Multiple Sclerosis: A Gene Expression Study. J Neuroimmunol. 279, 75-78.

  32. McAllister, K., Yarwood, A., Bowes, J., Orozco, G., Viatte, S., Diogo, D., Hocking, L. J., Steer, S., Wordsworth, P., Wilson, A. G., Morgan, A. W., UK Rheumatoid Arthritis Genetics Consortium, Rheumatoid Arthritis Consortium International, Kremer, J. M., Pappas, D., Gregersen, P., Klareskog, L., Plenge, R., Barton, A., Greenberg, J., Worthington, J., and Eyre, S. (2013) Identification of BACH2 and RAD51B as Rheumatoid Arthritis Susceptibility Loci in a Meta-Analysis of Genome-Wide Data. Arthritis Rheum. 65, 3058-3062.

  33. Zhu, Z., Yang, C., Wen, L., Liu, L., Zuo, X., Zhou, F., Gao, J., Zheng, X., Shi, Y., Zhu, C., Liang, B., Yin, X., Wang, W., Cheng, H., Shen, S., Tang, X., Tang, H., Sun, L., Zhang, A., Yang, S., Cui, Y., Zhang, X., and Sheng, Y. (2018) Bach2 Regulates Aberrant Activation of B Cell in Systemic Lupus Erythematosus and can be Negatively Regulated by BCR-ABL/PI3K. Exp Cell Res. 365, 138-144.

  34. Ferreira, M. A., Matheson, M. C., Duffy, D. L., Marks, G. B., Hui, J., Le Souef, P., Danoy, P., Baltic, S., Nyholt, D. R., Jenkins, M., Hayden, C., Willemsen, G., Ang, W., Kuokkanen, M., Beilby, J., Cheah, F., de Geus, E. J., Ramasamy, A., Vedantam, S., Salomaa, V., Madden, P. A., Heath, A. C., Hopper, J. L., Visscher, P. M., Musk, B., Leeder, S. R., Jarvelin, M. R., Pennell, C., Boomsma, D. I., Hirschhorn, J. N., Walters, H., Martin, N. G., James, A., Jones, G., Abramson, M. J., Robertson, C. F., Dharmage, S. C., Brown, M. A., Montgomery, G. W., Thompson, P. J., and Australian Asthma Genetics Consortium. (2011) Identification of IL6R and Chromosome 11q13.5 as Risk Loci for Asthma. Lancet. 378, 1006-1014.

  35. Franke, A., McGovern, D. P., Barrett, J. C., Wang, K., Radford-Smith, G. L., Ahmad, T., Lees, C. W., Balschun, T., Lee, J., Roberts, R., Anderson, C. A., Bis, J. C., Bumpstead, S., Ellinghaus, D., Festen, E. M., Georges, M., Green, T., Haritunians, T., Jostins, L., Latiano, A., Mathew, C. G., Montgomery, G. W., Prescott, N. J., Raychaudhuri, S., Rotter, J. I., Schumm, P., Sharma, Y., Simms, L. A., Taylor, K. D., Whiteman, D., Wijmenga, C., Baldassano, R. N., Barclay, M., Bayless, T. M., Brand, S., Buning, C., Cohen, A., Colombel, J. F., Cottone, M., Stronati, L., Denson, T., De Vos, M., D'Inca, R., Dubinsky, M., Edwards, C., Florin, T., Franchimont, D., Gearry, R., Glas, J., Van Gossum, A., Guthery, S. L., Halfvarson, J., Verspaget, H. W., Hugot, J. P., Karban, A., Laukens, D., Lawrance, I., Lemann, M., Levine, A., Libioulle, C., Louis, E., Mowat, C., Newman, W., Panes, J., Phillips, A., Proctor, D. D., Regueiro, M., Russell, R., Rutgeerts, P., Sanderson, J., Sans, M., Seibold, F., Steinhart, A. H., Stokkers, P. C., Torkvist, L., Kullak-Ublick, G., Wilson, D., Walters, T., Targan, S. R., Brant, S. R., Rioux, J. D., D'Amato, M., Weersma, R. K., Kugathasan, S., Griffiths, A. M., Mansfield, J. C., Vermeire, S., Duerr, R. H., Silverberg, M. S., Satsangi, J., Schreiber, S., Cho, J. H., Annese, V., Hakonarson, H., Daly, M. J., and Parkes, M. (2010) Genome-Wide Meta-Analysis Increases to 71 the Number of Confirmed Crohn's Disease Susceptibility Loci. Nat Genet. 42, 1118-1125.

  36. Jin, Y., Birlea, S. A., Fain, P. R., Ferrara, T. M., Ben, S., Riccardi, S. L., Cole, J. B., Gowan, K., Holland, P. J., Bennett, D. C., Luiten, R. M., Wolkerstorfer, A., van der Veen, J. P., Hartmann, A., Eichner, S., Schuler, G., van Geel, N., Lambert, J., Kemp, E. H., Gawkrodger, D. J., Weetman, A. P., Taieb, A., Jouary, T., Ezzedine, K., Wallace, M. R., McCormack, W. T., Picardo, M., Leone, G., Overbeck, A., Silverberg, N. B., and Spritz, R. A. (2012) Genome-Wide Association Analyses Identify 13 New Susceptibility Loci for Generalized Vitiligo. Nat Genet. 44, 676-680.

  37. Cooper, J. D., Smyth, D. J., Smiles, A. M., Plagnol, V., Walker, N. M., Allen, J. E., Downes, K., Barrett, J. C., Healy, B. C., Mychaleckyj, J. C., Warram, J. H., and Todd, J. A. (2008) Meta-Analysis of Genome-Wide Association Study Data Identifies Additional Type 1 Diabetes Risk Loci. Nat Genet. 40, 1399-1401.

  38. Eriksson, D., Bianchi, M., Landegren, N., Nordin, J., Dalin, F., Mathioudaki, A., Eriksson, G. N., Hultin-Rosenberg, L., Dahlqvist, J., Zetterqvist, H., Karlsson, A., Hallgren, A., Farias, F. H., Muren, E., Ahlgren, K. M., Lobell, A., Andersson, G., Tandre, K., Dahlqvist, S. R., Soderkvist, P., Ronnblom, L., Hulting, A. L., Wahlberg, J., Ekwall, O., Dahlqvist, P., Meadows, J. R., Bensing, S., Lindblad-Toh, K., Kampe, O., and Pielberg, G. R. (2016) Extended Exome Sequencing Identifies BACH2 as a Novel Major Risk Locus for Addison's Disease. J Intern Med. 280, 595-608.

  39. Medici, M., Porcu, E., Pistis, G., Teumer, A., Brown, S. J., Jensen, R. A., Rawal, R., Roef, G. L., Plantinga, T. S., Vermeulen, S. H., Lahti, J., Simmonds, M. J., Husemoen, L. L., Freathy, R. M., Shields, B. M., Pietzner, D., Nagy, R., Broer, L., Chaker, L., Korevaar, T. I., Plia, M. G., Sala, C., Volker, U., Richards, J. B., Sweep, F. C., Gieger, C., Corre, T., Kajantie, E., Thuesen, B., Taes, Y. E., Visser, W. E., Hattersley, A. T., Kratzsch, J., Hamilton, A., Li, W., Homuth, G., Lobina, M., Mariotti, S., Soranzo, N., Cocca, M., Nauck, M., Spielhagen, C., Ross, A., Arnold, A., van de Bunt, M., Liyanarachchi, S., Heier, M., Grabe, H. J., Masciullo, C., Galesloot, T. E., Lim, E. M., Reischl, E., Leedman, P. J., Lai, S., Delitala, A., Bremner, A. P., Philips, D. I., Beilby, J. P., Mulas, A., Vocale, M., Abecasis, G., Forsen, T., James, A., Widen, E., Hui, J., Prokisch, H., Rietzschel, E. E., Palotie, A., Feddema, P., Fletcher, S. J., Schramm, K., Rotter, J. I., Kluttig, A., Radke, D., Traglia, M., Surdulescu, G. L., He, H., Franklyn, J. A., Tiller, D., Vaidya, B., de Meyer, T., Jorgensen, T., Eriksson, J. G., O'Leary, P. C., Wichmann, E., Hermus, A. R., Psaty, B. M., Ittermann, T., Hofman, A., Bosi, E., Schlessinger, D., Wallaschofski, H., Pirastu, N., Aulchenko, Y. S., de la Chapelle, A., Netea-Maier, R. T., Gough, S. C., Meyer Zu Schwabedissen, H., Frayling, T. M., Kaufman, J. M., Linneberg, A., Raikkonen, K., Smit, J. W., Kiemeney, L. A., Rivadeneira, F., Uitterlinden, A. G., Walsh, J. P., Meisinger, C., den Heijer, M., Visser, T. J., Spector, T. D., Wilson, S. G., Volzke, H., Cappola, A., Toniolo, D., Sanna, S., Naitza, S., and Peeters, R. P. (2014) Identification of Novel Genetic Loci Associated with Thyroid Peroxidase Antibodies and Clinical Thyroid Disease. PLoS Genet. 10, e1004123.

  40. Kobayashi, S., Taki, T., Chinen, Y., Tsutsumi, Y., Ohshiro, M., Kobayashi, T., Matsumoto, Y., Kuroda, J., Horiike, S., Nishida, K., and Taniwaki, M. (2011) Identification of IGHCdelta-BACH2 Fusion Transcripts Resulting from Cryptic Chromosomal Rearrangements of 14q32 with 6q15 in Aggressive B-Cell lymphoma/leukemia. Genes Chromosomes Cancer. 50, 207-216.

  41. Turkmen, S., Riehn, M., Klopocki, E., Molkentin, M., Reinhardt, R., and Burmeister, T. (2011) A BACH2-BCL2L1 Fusion Gene Resulting from a t(6;20)(q15;q11.2) Chromosomal Translocation in the Lymphoma Cell Line BLUE-1. Genes Chromosomes Cancer. 50, 389-396.

  42. Zhang, H., Chen, Z., Miranda, R. N., Medeiros, L. J., and McCarty, N. (2017) Bifurcated BACH2 Control Coordinates Mantle Cell Lymphoma Survival and Dispersal during Hypoxia. Blood. 130, 763-776.

  43. Muto, A., Tashiro, S., Nakajima, O., Hoshino, H., Takahashi, S., Sakoda, E., Ikebe, D., Yamamoto, M., and Igarashi, K. (2004) The Transcriptional Programme of Antibody Class Switching Involves the Repressor Bach2. Nature. 429, 566-571.