Mutagenetix > Phenotypic Mutation 'charlotte

Phenotypic Mutation 'charlotte_gray' (pdf version)

Allele

charlotte_gray

Mutation Type

intron

Chromosome

Coordinate

13,602,026 bp (GRCm38)

Base Change

T ⇒ G (forward strand)

Gene

Lyst

Gene Name

lysosomal trafficking regulator

Synonym(s)

D13Sfk13

Chromosomal Location

13,590,397-13,778,803 bp (+)

MGI Phenotype

Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]

Accession Number

NCBI RefSeq: NM_010748; MGI: 107448

Mapped

Yes

Amino Acid Change

Institutional Source

Beutler Lab

Gene Model

not available

AlphaFold

no structure available at present

SMART Domains

Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726

Domain	Start	End	E-Value	Type
low complexity region	26	36	N/A	INTRINSIC
low complexity region	72	82	N/A	INTRINSIC
low complexity region	399	412	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	2295	2307	N/A	INTRINSIC
low complexity region	2427	2445	N/A	INTRINSIC
low complexity region	2534	2546	N/A	INTRINSIC
Pfam:PH_BEACH	3006	3101	5.8e-25	PFAM
Beach	3118	3408	1.25e-193	SMART
Blast:Beach	3441	3478	9e-13	BLAST
WD40	3539	3579	5.75e-1	SMART
WD40	3591	3630	2.89e-5	SMART
WD40	3633	3676	1.38e0	SMART
WD40	3724	3765	1.27e-1	SMART

Predicted Effect

probably benign

Meta Mutation Damage Score

Not available question?

Is this an essential gene?

Possibly nonessential (E-score: 0.300) question?

Phenotypic Category

Autosomal Recessive

Candidate Explorer Status

loading ...

Single pedigree
Linkage Analysis Data

Penetrance

100%

Alleles Listed at MGI

All alleles(45) : Gene trapped(30) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Lab Alleles

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Lyst	APN	13	13648878	missense	probably benign
IGL00474:Lyst	APN	13	13643536	missense	possibly damaging	0.48
IGL00484:Lyst	APN	13	13709603	missense	probably benign	0.02
IGL00492:Lyst	APN	13	13678175	missense	possibly damaging	0.54
IGL00807:Lyst	APN	13	13650423	missense	possibly damaging	0.91
IGL00949:Lyst	APN	13	13635485	missense	possibly damaging	0.87
IGL00952:Lyst	APN	13	13678107	missense	probably benign	0.05
IGL01305:Lyst	APN	13	13678056	missense	probably benign	0.01
IGL01317:Lyst	APN	13	13670870	missense	probably benign
IGL01419:Lyst	APN	13	13635838	missense	probably benign	0.00
IGL01445:Lyst	APN	13	13651714	missense	probably benign	0.00
IGL01690:Lyst	APN	13	13743246	missense	probably damaging	1.00
IGL01791:Lyst	APN	13	13635302	missense	probably damaging	1.00
IGL01809:Lyst	APN	13	13637803	missense	probably damaging	1.00
IGL01896:Lyst	APN	13	13635577	missense	probably benign	0.04
IGL01938:Lyst	APN	13	13637424	missense	possibly damaging	0.93
IGL01986:Lyst	APN	13	13775627	critical splice donor site	probably null
IGL02022:Lyst	APN	13	13664044	nonsense	probably null
IGL02044:Lyst	APN	13	13712846	missense	probably damaging	1.00
IGL02157:Lyst	APN	13	13660956	missense	probably benign
IGL02185:Lyst	APN	13	13661093	nonsense	probably null
IGL02215:Lyst	APN	13	13660956	missense	probably benign
IGL02245:Lyst	APN	13	13660956	missense	probably benign
IGL02246:Lyst	APN	13	13660956	missense	probably benign
IGL02247:Lyst	APN	13	13660956	missense	probably benign
IGL02297:Lyst	APN	13	13638092	nonsense	probably null
IGL02411:Lyst	APN	13	13660956	missense	probably benign
IGL02415:Lyst	APN	13	13660956	missense	probably benign
IGL02419:Lyst	APN	13	13660956	missense	probably benign
IGL02420:Lyst	APN	13	13660956	missense	probably benign
IGL02429:Lyst	APN	13	13660956	missense	probably benign
IGL02501:Lyst	APN	13	13711645	missense	probably benign	0.02
IGL02522:Lyst	APN	13	13634705	missense	possibly damaging	0.81
IGL02535:Lyst	APN	13	13650342	missense	probably benign	0.00
IGL02596:Lyst	APN	13	13660956	missense	probably benign
IGL02601:Lyst	APN	13	13660956	missense	probably benign
IGL02603:Lyst	APN	13	13660956	missense	probably benign
IGL02608:Lyst	APN	13	13712754	missense	probably damaging	0.98
IGL02622:Lyst	APN	13	13681390	missense	probably damaging	1.00
IGL02690:Lyst	APN	13	13641125	missense	possibly damaging	0.58
IGL02715:Lyst	APN	13	13674320	splice site	probably null
IGL02725:Lyst	APN	13	13760827	missense	probably damaging	1.00
IGL02729:Lyst	APN	13	13674339	missense	possibly damaging	0.81
IGL02729:Lyst	APN	13	13746609	missense	possibly damaging	0.95
IGL02820:Lyst	APN	13	13638058	missense	probably benign	0.03
IGL02945:Lyst	APN	13	13761198	missense	possibly damaging	0.48
IGL02981:Lyst	APN	13	13634911	missense	probably damaging	0.99
IGL03087:Lyst	APN	13	13635056	missense	probably damaging	1.00
IGL03149:Lyst	APN	13	13681444	missense	probably benign	0.14
IGL03158:Lyst	APN	13	13651752	critical splice donor site	probably null
IGL03226:Lyst	APN	13	13709559	missense	probably benign	0.01
IGL03242:Lyst	APN	13	13656881	nonsense	probably null
IGL03385:Lyst	APN	13	13656980	nonsense	probably null
50-cal	UTSW	13	13708212	critical splice donor site	probably null
charcoal	UTSW	13	13696761	nonsense	probably null
charzard	UTSW	13	13647083	nonsense	probably null
grey_wolf	UTSW	13		unclassified
lightspeed	UTSW	13	13740536	missense	possibly damaging	0.91
pardon	UTSW	13	13677952	missense	probably benign	0.00
robin	UTSW	13	13648802	nonsense	probably null
sooty	UTSW	13		unclassified
souris	UTSW	13	13683223	unclassified	probably benign
Swallow	UTSW	13	13757422	missense	probably benign	0.00
vulpix	UTSW	13	13696794	splice site	probably null
ANU22:Lyst	UTSW	13	13678056	missense	probably benign	0.01
IGL02835:Lyst	UTSW	13	13661100	missense	possibly damaging	0.82
P0031:Lyst	UTSW	13	13664031	missense	probably damaging	1.00
R0012:Lyst	UTSW	13	13687694	missense	probably benign	0.10
R0012:Lyst	UTSW	13	13687694	missense	probably benign	0.10
R0031:Lyst	UTSW	13	13708156	missense	probably benign	0.14
R0115:Lyst	UTSW	13	13677952	missense	probably benign	0.00
R0212:Lyst	UTSW	13	13635985	missense	possibly damaging	0.93
R0386:Lyst	UTSW	13	13708214	splice site	probably benign
R0393:Lyst	UTSW	13	13647079	missense	probably benign	0.01
R0415:Lyst	UTSW	13	13711610	splice site	probably benign
R0446:Lyst	UTSW	13	13638048	missense	probably benign	0.00
R0481:Lyst	UTSW	13	13677952	missense	probably benign	0.00
R0499:Lyst	UTSW	13	13616713	missense	probably damaging	1.00
R0506:Lyst	UTSW	13	13638015	missense	probably benign
R0530:Lyst	UTSW	13	13757306	splice site	probably benign
R0541:Lyst	UTSW	13	13681293	missense	probably benign	0.00
R0570:Lyst	UTSW	13	13709386	missense	probably benign	0.26
R0680:Lyst	UTSW	13	13650341	missense	probably benign	0.01
R0842:Lyst	UTSW	13	13678241	nonsense	probably null
R0848:Lyst	UTSW	13	13634930	missense	probably benign	0.00
R1014:Lyst	UTSW	13	13634060	missense	possibly damaging	0.49
R1205:Lyst	UTSW	13	13680202	missense	probably benign
R1251:Lyst	UTSW	13	13634483	missense	probably benign	0.00
R1304:Lyst	UTSW	13	13751984	nonsense	probably null
R1398:Lyst	UTSW	13	13740536	missense	possibly damaging	0.91
R1445:Lyst	UTSW	13	13640054	missense	possibly damaging	0.94
R1475:Lyst	UTSW	13	13708212	critical splice donor site	probably null
R1479:Lyst	UTSW	13	13634482	missense	probably benign	0.00
R1484:Lyst	UTSW	13	13678190	missense	probably benign	0.01
R1498:Lyst	UTSW	13	13650375	missense	possibly damaging	0.49
R1540:Lyst	UTSW	13	13635101	missense	possibly damaging	0.81
R1611:Lyst	UTSW	13	13634897	missense	probably damaging	0.97
R1653:Lyst	UTSW	13	13635226	missense	probably damaging	1.00
R1669:Lyst	UTSW	13	13644087	missense	possibly damaging	0.90
R1686:Lyst	UTSW	13	13634705	missense	possibly damaging	0.81
R1694:Lyst	UTSW	13	13661161	missense	probably damaging	0.98
R1747:Lyst	UTSW	13	13757422	missense	probably benign	0.00
R1793:Lyst	UTSW	13	13647083	nonsense	probably null
R1871:Lyst	UTSW	13	13651712	missense	probably benign	0.00
R1905:Lyst	UTSW	13	13634134	missense	probably benign
R1958:Lyst	UTSW	13	13616618	missense	probably damaging	1.00
R1969:Lyst	UTSW	13	13730344	missense	probably damaging	0.99
R2040:Lyst	UTSW	13	13641222	missense	probably benign	0.00
R2109:Lyst	UTSW	13	13712820	missense	possibly damaging	0.46
R2116:Lyst	UTSW	13	13635701	missense	probably damaging	0.99
R2121:Lyst	UTSW	13	13660971	missense	probably damaging	1.00
R2127:Lyst	UTSW	13	13635262	missense	probably damaging	1.00
R2187:Lyst	UTSW	13	13709341	missense	possibly damaging	0.61
R2238:Lyst	UTSW	13	13743263	missense	probably benign	0.41
R2258:Lyst	UTSW	13	13637658	missense	probably benign	0.00
R2292:Lyst	UTSW	13	13740495	missense	probably damaging	1.00
R2368:Lyst	UTSW	13	13696663	missense	probably damaging	0.96
R2908:Lyst	UTSW	13	13669873	missense	probably benign	0.03
R3001:Lyst	UTSW	13	13696705	missense	probably benign
R3002:Lyst	UTSW	13	13696705	missense	probably benign
R3024:Lyst	UTSW	13	13658687	missense	probably benign
R3113:Lyst	UTSW	13	13669927	missense	probably benign	0.12
R3406:Lyst	UTSW	13	13635230	missense	possibly damaging	0.56
R3972:Lyst	UTSW	13	13706625	missense	possibly damaging	0.67
R3978:Lyst	UTSW	13	13634168	missense	possibly damaging	0.82
R4032:Lyst	UTSW	13	13616665	missense	probably damaging	1.00
R4192:Lyst	UTSW	13	13740513	missense	probably damaging	1.00
R4206:Lyst	UTSW	13	13635989	missense	probably benign	0.03
R4298:Lyst	UTSW	13	13634887	missense	probably damaging	1.00
R4344:Lyst	UTSW	13	13698466	missense	probably benign	0.06
R4441:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4445:Lyst	UTSW	13	13709564	missense	probably benign	0.42
R4477:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4493:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4494:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4495:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4622:Lyst	UTSW	13	13674398	missense	probably benign	0.01
R4638:Lyst	UTSW	13	13696794	splice site	probably null
R4658:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4675:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4719:Lyst	UTSW	13	13650350	missense	probably benign
R4729:Lyst	UTSW	13	13637901	missense	probably damaging	1.00
R4774:Lyst	UTSW	13	13740597	missense	probably damaging	1.00
R4811:Lyst	UTSW	13	13777100	missense	probably benign	0.33
R4877:Lyst	UTSW	13	13683149	missense	probably damaging	1.00
R4920:Lyst	UTSW	13	13647060	missense	possibly damaging	0.79
R4933:Lyst	UTSW	13	13637764	missense	probably damaging	0.98
R4933:Lyst	UTSW	13	13759378	missense	probably benign	0.12
R4958:Lyst	UTSW	13	13635463	missense	probably benign	0.00
R4982:Lyst	UTSW	13	13725954	missense	probably damaging	1.00
R4992:Lyst	UTSW	13	13661163	missense	probably damaging	1.00
R5024:Lyst	UTSW	13	13634404	missense	probably benign
R5049:Lyst	UTSW	13	13636064	missense	probably damaging	1.00
R5079:Lyst	UTSW	13	13757353	missense	probably benign	0.08
R5254:Lyst	UTSW	13	13683070	missense	probably benign	0.00
R5266:Lyst	UTSW	13	13660970	missense	probably damaging	1.00
R5279:Lyst	UTSW	13	13648802	nonsense	probably null
R5285:Lyst	UTSW	13	13634426	missense	probably benign	0.01
R5364:Lyst	UTSW	13	13656854	missense	probably benign	0.35
R5435:Lyst	UTSW	13	13777064	missense	possibly damaging	0.64
R5516:Lyst	UTSW	13	13644122	missense	probably benign	0.10
R5524:Lyst	UTSW	13	13746779	missense	probably benign	0.03
R5591:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5592:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5593:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5594:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5594:Lyst	UTSW	13	13759397	missense	probably benign	0.00
R5644:Lyst	UTSW	13	13637496	missense	possibly damaging	0.58
R5659:Lyst	UTSW	13	13634627	missense	possibly damaging	0.58
R5741:Lyst	UTSW	13	13634030	missense	probably benign	0.44
R5908:Lyst	UTSW	13	13696761	nonsense	probably null
R5969:Lyst	UTSW	13	13687813	splice site	probably null
R6128:Lyst	UTSW	13	13759379	missense	possibly damaging	0.67
R6271:Lyst	UTSW	13	13658754	missense	probably benign	0.30
R6315:Lyst	UTSW	13	13643504	missense	probably benign
R6318:Lyst	UTSW	13	13743311	missense	possibly damaging	0.88
R6555:Lyst	UTSW	13	13648925	missense	probably benign	0.01
R6663:Lyst	UTSW	13	13664116	splice site	probably null
R6701:Lyst	UTSW	13	13681485	missense	probably benign	0.06
R6711:Lyst	UTSW	13	13635235	missense	possibly damaging	0.80
R6909:Lyst	UTSW	13	13743375	missense	probably damaging	1.00
R6915:Lyst	UTSW	13	13726044	missense	probably benign	0.01
R6929:Lyst	UTSW	13	13743324	missense	probably damaging	1.00
R6960:Lyst	UTSW	13	13634078	missense	probably benign	0.12
R7018:Lyst	UTSW	13	13743459	critical splice donor site	probably null
R7037:Lyst	UTSW	13	13616666	missense	probably damaging	1.00
R7045:Lyst	UTSW	13	13634900	missense	probably benign	0.34
R7045:Lyst	UTSW	13	13637708	missense	probably damaging	1.00
R7070:Lyst	UTSW	13	13757444	missense	probably benign	0.23
R7188:Lyst	UTSW	13	13752090	missense	possibly damaging	0.66
R7201:Lyst	UTSW	13	13709300	nonsense	probably null
R7210:Lyst	UTSW	13	13656983	missense	probably damaging	1.00
R7229:Lyst	UTSW	13	13643509	missense	probably benign	0.00
R7293:Lyst	UTSW	13	13680237	missense	probably benign	0.01
R7318:Lyst	UTSW	13	13757443	missense	probably benign	0.13
R7344:Lyst	UTSW	13	13706555	missense	probably benign
R7426:Lyst	UTSW	13	13637524	missense	probably benign
R7522:Lyst	UTSW	13	13647083	nonsense	probably null
R7583:Lyst	UTSW	13	13635887	missense	probably damaging	1.00
R7606:Lyst	UTSW	13	13637475	missense	probably damaging	1.00
R7636:Lyst	UTSW	13	13616747	critical splice donor site	probably null
R7658:Lyst	UTSW	13	13730476	missense	possibly damaging	0.63
R7685:Lyst	UTSW	13	13669865	missense	probably benign	0.00
R7689:Lyst	UTSW	13	13683223	critical splice donor site	probably null
R7765:Lyst	UTSW	13	13709532	missense	possibly damaging	0.75
R7779:Lyst	UTSW	13	13634543	missense	probably damaging	1.00
R7871:Lyst	UTSW	13	13636052	nonsense	probably null
R7872:Lyst	UTSW	13	13635865	missense	probably benign	0.14
R7884:Lyst	UTSW	13	13707683	missense	probably benign	0.09
R7890:Lyst	UTSW	13	13740569	missense	probably damaging	0.99
R7916:Lyst	UTSW	13	13647072	missense	possibly damaging	0.64
R7948:Lyst	UTSW	13	13746589	missense	possibly damaging	0.59
R7956:Lyst	UTSW	13	13641203	missense	possibly damaging	0.80
R8048:Lyst	UTSW	13	13687645	missense	probably benign	0.12
R8085:Lyst	UTSW	13	13634309	missense	probably damaging	0.98
R8165:Lyst	UTSW	13	13698360	missense	probably damaging	0.99
R8235:Lyst	UTSW	13	13760738	missense	possibly damaging	0.69
R8237:Lyst	UTSW	13	13651732	missense	probably benign	0.00
R8275:Lyst	UTSW	13	13776082	missense	probably benign	0.02
R8300:Lyst	UTSW	13	13664058	missense	possibly damaging	0.79
R8350:Lyst	UTSW	13	13650388	nonsense	probably null
R8526:Lyst	UTSW	13	13760806	missense	probably damaging	0.99
R8551:Lyst	UTSW	13	13634060	missense	possibly damaging	0.77
R8723:Lyst	UTSW	13	13712757	missense	possibly damaging	0.89
R8772:Lyst	UTSW	13	13637492	nonsense	probably null
R8778:Lyst	UTSW	13	13635776	missense	possibly damaging	0.89
R8778:Lyst	UTSW	13	13728567	missense	possibly damaging	0.89
R8801:Lyst	UTSW	13	13661010	missense	probably benign	0.10
R8837:Lyst	UTSW	13	13677963	missense	probably benign
R8874:Lyst	UTSW	13	13637562	missense	probably benign
R8878:Lyst	UTSW	13	13641076	missense	probably benign	0.00
R8891:Lyst	UTSW	13	13712850	missense	possibly damaging	0.67
R9077:Lyst	UTSW	13	13683108	missense	probably benign	0.02
R9127:Lyst	UTSW	13	13634242	missense	probably damaging	1.00
R9143:Lyst	UTSW	13	13661165	missense	probably damaging	0.98
R9216:Lyst	UTSW	13	13648603	missense	probably benign
R9217:Lyst	UTSW	13	13696660	missense	probably benign	0.01
R9291:Lyst	UTSW	13	13709353	missense	probably benign	0.01
R9302:Lyst	UTSW	13	13730362	missense	possibly damaging	0.46
R9370:Lyst	UTSW	13	13760748	missense	probably damaging	1.00
R9402:Lyst	UTSW	13	13637878	missense	probably benign
R9457:Lyst	UTSW	13	13687745	missense	possibly damaging	0.83
R9481:Lyst	UTSW	13	13683068	missense	possibly damaging	0.68
R9563:Lyst	UTSW	13	13637823	missense	probably benign	0.36
R9623:Lyst	UTSW	13	13678002	missense	probably benign
R9661:Lyst	UTSW	13	13634194	missense	probably benign	0.01
R9682:Lyst	UTSW	13	13656941	missense	probably benign	0.21
R9743:Lyst	UTSW	13	13634738	missense	possibly damaging	0.67
R9801:Lyst	UTSW	13	13634705	missense	probably damaging	0.97
RF001:Lyst	UTSW	13	13635841	missense	probably benign
RF002:Lyst	UTSW	13	13634363	missense	probably benign	0.05
X0024:Lyst	UTSW	13	13634448	missense	probably benign	0.00
X0026:Lyst	UTSW	13	13751970	missense	probably damaging	0.99
Z1088:Lyst	UTSW	13	13743433	missense	probably benign	0.09
Z1176:Lyst	UTSW	13	13640107	missense	probably damaging	1.00
Z1176:Lyst	UTSW	13	13777079	missense	probably benign	0.27
Z1177:Lyst	UTSW	13	13680134	missense	possibly damaging	0.73

Mode of Inheritance

Autosomal Recessive

Local Stock

Sperm, gDNA

Repository

none

Last Updated

2018-08-02 11:36 AM by Diantha La Vine

Record Created

unknown

Record Posted

2009-01-09

Phenotypic Description

Charlotte gray was discovered as a hypopigmented mutant in a screen of ENU-mutagenized G3 mice. Charlotte gray was found to be allelic with souris, in which a mutation in the Lyst gene was identified (1;2). Charlotte gray mice display normal type I interferon (IFN) responses to CpG DNA challenge in vivo.

Nature of Mutation

The charlotte gray mutation was mapped to Chromosome 13, and corresponds to a T to G transversion at position 8521 of the Lyst transcript, in exon 33 of 53 total exons.

8504 GCCAAGTTGGTTTTGTATTTGTCAGAGTTGATA

2776 -A--K--L--V--L--Y--L--S--E--L--I-

Figure 1. Domain structure of the Lyst protein. The Lyst protein is a 3788-amino acid protein whose biochemical functions remain unknown. The N-terminal portion of the protein contains approximately twenty repeats with homology to ARM and HEAT repeat motifs and a perilipin domain (PD). The C-terminal portion of Lyst contains a BEACH domain and seven WD40 motifs. The charlotte gray mutation results in the substitution of a tyrosine to a premature stop codon at amino acid 2780. This image is interactive. This image is interactive. Click on the mutations (red) for more specific information.

The mutated nucleotide is indicated in red lettering, and creates a premature stop codon at codon 2780 (normally a tyrosine) deleting 1007 amino acids from the C-terminus of the protein (Figure 1). This would delete two of the ARM/HEAT motifs, the BEACH domain and the WD40 motifs. Expression of the mutated Lyst protein has not been tested.

Please see the record for souris for information about Lyst.

Illustration of Mutations in
Gene & Protein

Primers

Primers cannot be located by automatic search.

Genotyping

Charlotte gray genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

Primers for PCR amplification

Cgray(F): 5’- ACCTAATACATTATTAAATTTCACCTACTGTATTGTCGTG -3’

Cgray(R): 5’- CTCAGATCTCCAAGGTTACTGCACAC -3’

PCR program

1) 94°C 2:00

2) 94°C 0:30

3) 56°C 0:30

4) 72°C 1:00

5) repeat steps (2-4) 29X

6) 72°C 7:00

7) 4°C ∞

Primers for sequencing

Cgray_seq(F): 5’- ACCTACTGTATTGTCGTGTCTTTTAC -3’

Cgray_seq(R): 5’- CCTTTCCTGATCAAAAACTCATTAGC -3’

The following sequence of 702 nucleotides (from Genbank genomic region NC_000079 for linear genomic sequence of Lyst) is amplified:

115881 acctaataca ttattaaatt tcacctactg tattgtcgtg

115921 tcttttacag ttgtaataaa tcttacccaa ccaactaact ttagaaatat atttaaatta

115981 tcattaaata atttaaaatc aaaactacaa atataattaa atttattatt aaataattta

116041 aacagaagaa ataaaattct ttataactaa aaccttatta cttattttta aagcatggag

116101 ccaagttggt tttgtatttg tcagagttga tacataatca tcaggatgag ttaagtgaag

116161 aagaaatgga cacagcagaa ctgcttatga atgctctaaa gttatgtggc cacaagtgca

116221 tcccgcccag tgccccttcc aaaccagagc tcattaagat catcagagag gtgagtctac

116281 caatcagagt tgttttttag gaaatccttt tgagtacact taacacagtg actgaaagat

116341 tgttttacta ttgataatat cttgcaatta ttaatttttg ctaatgagtt tttgatcagg

116401 aaaggaaaaa tagagttatt tagggtaact ttctattctc tttggttttt gtcatccatt

116461 atctatagac ttcaatgaag gaaggattat tattgagatt tatttatctt atgtatatgt

116521 atatgttttg tctacatata agtctattta tcacatgtgt gcagtaacct tggagatctg

116581 ag

Primer binding sites are underlined; the mutated T is highlighted in red.

References

1. Barbosa, M. D., Nguyen, Q. A., Tchernev, V. T., Ashley, J. A., Detter, J. C., Blaydes, S. M., Brandt, S. J., Chotai, D., Hodgman, C., Solari, R. C., Lovett, M., and Kingsmore, S. F. (1996) Identification of the homologous beige and Chediak-Higashi syndrome genes, Nature 382, 262-265.

2. Perou, C. M., Moore, K. J., Nagle, D. L., Misumi, D. J., Woolf, E. A., McGrail, S. H., Holmgren, L., Brody, T. H., Dussault, B. J., Jr., Monroe, C. A., Duyk, G. M., Pryor, R. J., Li, L., Justice, M. J., and Kaplan, J. (1996) Identification of the murine beige gene by YAC complementation and positional cloning, Nat. Genet. 13, 303-308.

Science Writers

Nora G. Smart

Illustrators

Katherine Timer

Authors

Amanda L. Blasius, Bruce Beutler

Edit History

	Eva Marie Y. Moresco	2011-01-07 8:57 AM (current)
	Nora G. Smart	2010-11-12 12:28 PM
	Diantha La Vine	2010-07-22 10:14 AM
	Eva Marie Y. Moresco	2010-02-03 5:32 PM