Phenotypic Mutation 'punk2' (pdf version)
Allelepunk2
Mutation Type missense
Chromosome11
Coordinate72,253,391 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Slc13a5
Gene Name solute carrier family 13 (sodium-dependent citrate transporter), member 5
Synonym(s) Indy, Nact, mINDY, NaC2/NaCT
Chromosomal Location 72,241,989-72,267,222 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the solute carrier family 13 group of proteins. This family member is a sodium-dependent citrate cotransporter that may regulate metabolic processes. Mutations in this gene cause early infantile epileptic encephalopathy 25. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a null allele display resistance to diet and age induced obesity, increased energy expenditure, improved glucose tolerance, and increased hepatic lipid oxidation. Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001004148; MGI:1919003

Mapped Yes 
Amino Acid Change Threonine changed to Isoleucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000021161] [ENSMUSP00000119417] [ENSMUSP00000146922] [ENSMUSP00000146762]
SMART Domains Protein: ENSMUSP00000021161
Gene: ENSMUSG00000020805
AA Change: T287I

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 8 558 1.3e-121 PFAM
Pfam:CitMHS 13 172 1.6e-14 PFAM
Pfam:CitMHS 202 498 6.4e-24 PFAM
Predicted Effect possibly damaging

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
(Using ENSMUST00000021161)
SMART Domains Protein: ENSMUSP00000119417
Gene: ENSMUSG00000020805
AA Change: T287I

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 7 115 1.3e-24 PFAM
Predicted Effect unknown
Predicted Effect probably benign

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
(Using ENSMUST00000208056)
Predicted Effect probably benign

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
(Using ENSMUST00000208912)
Meta Mutation Damage Score 0.1795 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased
Body Weight (Female) - decreased
Body Weight (Z-score) - decreased
Candidate Explorer Status CE: not good candidate; Verification probability: 0.347; ML prob: 0.372; human score: -3
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (other)(1)  Chemically induced (ENU)(1) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Slc13a5 APN 11 72258954 splice site probably null
IGL03392:Slc13a5 APN 11 72245178 missense probably damaging 1.00
Punk UTSW 11 72262076 missense probably damaging 1.00
R0018:Slc13a5 UTSW 11 72266475 missense probably benign
R0018:Slc13a5 UTSW 11 72266475 missense probably benign
R0042:Slc13a5 UTSW 11 72259114 missense probably benign 0.31
R0194:Slc13a5 UTSW 11 72245233 missense probably benign 0.22
R0194:Slc13a5 UTSW 11 72262130 missense possibly damaging 0.95
R0234:Slc13a5 UTSW 11 72250800 missense probably damaging 0.98
R1499:Slc13a5 UTSW 11 72250731 missense probably damaging 0.97
R1655:Slc13a5 UTSW 11 72257378 missense probably benign 0.00
R1728:Slc13a5 UTSW 11 72266459 splice site probably null
R1818:Slc13a5 UTSW 11 72253343 missense probably benign 0.02
R2304:Slc13a5 UTSW 11 72259039 missense probably damaging 1.00
R2352:Slc13a5 UTSW 11 72252321 missense probably benign 0.06
R2408:Slc13a5 UTSW 11 72262076 missense probably damaging 1.00
R2919:Slc13a5 UTSW 11 72247791 missense possibly damaging 0.92
R2920:Slc13a5 UTSW 11 72247791 missense possibly damaging 0.92
R3103:Slc13a5 UTSW 11 72257388 missense probably damaging 1.00
R4772:Slc13a5 UTSW 11 72250846 critical splice acceptor site probably null
R4906:Slc13a5 UTSW 11 72257418 missense probably damaging 0.99
R5385:Slc13a5 UTSW 11 72259077 missense probably benign 0.01
R5562:Slc13a5 UTSW 11 72262039 missense probably damaging 0.99
R5878:Slc13a5 UTSW 11 72253391 missense possibly damaging 0.65
R6173:Slc13a5 UTSW 11 72253197 missense probably benign 0.05
R6665:Slc13a5 UTSW 11 72260360 missense probably damaging 0.99
R7317:Slc13a5 UTSW 11 72245127 missense probably damaging 1.00
R7338:Slc13a5 UTSW 11 72266484 missense probably benign
R7908:Slc13a5 UTSW 11 72259064 missense probably benign 0.00
R8038:Slc13a5 UTSW 11 72253370 missense probably benign 0.31
R8420:Slc13a5 UTSW 11 72257384 missense probably damaging 1.00
R8679:Slc13a5 UTSW 11 72259093 missense probably benign
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:35 PM by Anne Murray
Record Created 2018-06-08 6:46 AM by Bruce Beutler
Record Posted 2018-06-19
Phenotypic Description

Figure 1. Punk2 mice exhibited reduced body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The punk2 phenotype was identified among G3 mice of the pedigree R5878, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 66 mutations (X-axis) identified in the G1 male of pedigree R5878. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 66 mutations. The body weight phenotype was linked to a mutation in Slc13a5: a C to T transition at base pair 72,253,391 (v38) on chromosome 11, or base pair 13,666 in the GenBank genomic region NC_000077. Linkage was found with a recessive model of inheritance (P = 6.753 x 10-6), wherein five variant homozygotes departed phenotypically from 37 homozygous and 41 heterozygotes reference mice (Figure 2).

 

The mutation corresponds to residue 899 in the mRNA sequence NM_001004148 within exon 7 of 12 total exons.

 

883 CACAATTTAAAAAAAACTTGCATCTGCTGTGGG
282 -H--N--L--K--K--T--C--I--C--C--G-

 

The mutated nucleotide is indicated in red.  The mutation results in a threonine to isoleucine substitution at position 287 (T287I) in the NaCT protein, and is predicted by PolyPhen-2 to be damaging (score = 0.655).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 3. Domain organization and topology of NaCT. NaCT has 11 putative transmembrane domains (SMART). The location of the punk2 mutation results in a threonine to isoleucine substitution at position 287. Other mutations found in NaCT are noted. Click on each mutation to view more information. The topology of mouse NaCT was modeled after that of the Vibrio cholerae homolog of mouse NaCT (termed VcINDY); see Figure 4, PDB:4F35, and (1) for more information.

Slc13a5 encodes NaCT (Na+/citrate transporter; alternatively, mINDY (mouse I’m not dead yet) or NaC2), a member of the solute carrier 13 (SLC13) family of anion transporters. The members of the SLC13 family are members of a superfamily of anion transporters called divalent anion sodium symporters (DASS), which mediate sodium-coupled anion cotransport at the plasma membrane of epithelial cells of the kidney, small intestine, placenta, and liver.

 

The structure of the bacterial homolog of NaCT from Vibrio cholerae (VcINDY) has been solved by X-ray crystallography (1). VcINDY has 11 transmembrane domains and two opposing hairpin structures: HPin and HPout. The HPin structure inserts into the membrane from the cytosolic side and connects to TM4; the HPout structure inserts into the protein from the periplasm connecting to TM9. The N-terminus is in the cytosol, while the C-terminus is in the extracellular space (2). TM4, TM5, TM9, and TM10 of VcINDY are each broken into two segments within the membrane; each pair are named “a” and “b”. The loops that connect TM5a and TM5b as well as the loop that connects TM10a and TM10b are eight amino acids long. 

 

The Punk mutation results in a threonine to isoleucine substitution at position 287 (T287I); Thr287 is within the lumenal loop between transmembranes six and seven.

 

Please see the record Punk for more information about Slc13a5.

Putative Mechanism

NaCT is a member of the Na+-carboxylate (NaC; alternatively, Na+-dicarboxylate [NaDC]) cotransporter subfamily of the SLC13 family, which mediate the transportation of Krebs cycle intermediates including succinate citrate, succinate, and α-ketoglutarate. NaCT exhibits highest affinity for citrate (3;4). NaCT has lower affinities to other Krebs cycle intermediates including succinate, malate, and formate (3;5;6). NaCT mediates inward electrgenic sodium-coupled substrate cotransport with a sodium:substrate coupling ratio of 4:1 (3;5;7).

 

Mutations in SLC13A5 are linked to early-onset epileptic encephalopathy-25 (EOEE25; OMIM: #615905) (8;9). EOEE is a genetically heterogenous group of disorders. EOEE25 is an autosomal recessive condition marked by frequent tonic seizures or spasms starting in infancy. EOEE25 patients exhibit abnormal interictal (between seizures) electro-encephalogram, psychomotor delay, and/or cognitive deterioration. Approximately 75% of EOEE patients progress to West syndrome, which is a condition characterized by tonic spasms with clustering, arrest of psychomotor development, and hypsarrhythmia. The disease-causing SLC13A5 mutations in patients with EOEE25 are proposed to affect the ability of NaCT to transport citrate across the plasma membrane to the cytosol by preventing its ability to bind sodium (8).

 

Slc13a5-deficient (Slc13a5-/-) mice exhibit metabolic defects and changes in energy balance-regulating pathways. The Slc13a5-/- mice were smaller in size, have lower plasma glucose levels than wild-type mice, and are resistant to the effects (i.e., weight gain and insulin resistance) of high fat feeding (10). Citrate and malate levels in the plasma of Slc13a5-/- mice are slightly increased compared to that in wild-type mice; the levels of succinate or fumarate were not significantly changed upon loss of Slc13a5. The Slc13a5-/- mice exhibited reduced uptake of citrate from the circulation into the liver, but not the kidney or adipose tissue (10). The Slc13a5-/- mice also exhibited increased oxygen consumption, carbon dioxide generation, and resting energy expenditure. After a glucose tolerance test, plasma glucose and insulin concentrations were reduced in the Slc13a5-/- mice. The Slc13a5-/- mice had improved insulin sensitivity after hyperinsulinemic euglycemic clamp with reduced basal hepatic glucose production. The resistance to diet-induced obesity and insulin resistance is mediated by the function of NaCT on mitochondrial metabolism as the hepatocellular ATP/ADP ratio was reduced and induction of PGC-1α, inhibition of ACC-2, and reduction of SREBP-1c levels were observed (10).

 

NaCT-mediated uptake of circulating citrate mediates the generation of metabolic energy as well as the synthesis of fatty acids and cholesterol (5;6). Citrate generated in the mitochondria by the tricarboxylic acid (TCA) cycle enters the cytoplasm when intracellular energy stores are abundant. Cytoplasmic citrate is subsequently converted to acetyl-CoA. Conversion of acetyl-CoA to malonyl-CoA by acetyl-CoA carboxylase is the first step in fatty acid synthesis. Similar to the Slc13a5-/- mice, the punk2 mice are smaller in size compared to their wild-type littermates, indicating that NaCTpunk2 has lost citrate uptake function.

Primers PCR Primer
punk2_pcr_F: TACACGGTGTTTCCCTCGAC
punk2_pcr_R: CCAGTTTGAGATGGTGGCAC

Sequencing Primer
punk2_seq_F: TCGACCCAGGCGAATGACAG
punk2_seq_R: AGCTCTGGAAGTGCCCTAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 488 nucleotides is amplified (chromosome 11, - strand):


1   ccagtttgag atggtggcac accccttttg tatcacctca ccccctgccc ccagctctgg
61  aagtgcccta ggccctcagt ctctacttct caacagtctc tctgtaaggt gatgtggggg
121 tggggtggag agaggagctg atggaaatca gaagaagaaa gagggagggt gggaccctca
181 ggctctatcc cagaagcccc ccacccccac ttctcccaca agtcgttcca tctgccttgc
241 ccttctctta ccattacatg gtctagttta aaaaaaactt gcatctgctg tggggagaag
301 aagagggaca ccgagaagat tgcctacaaa gtgctgaacg aggagtacca gaagctgggg
361 tccttgagct accctgaatg caacgtgctc ttttgcttca ccctacttgt catcctgtgg
421 ttctcccgag accccggctt catgcctggc tggctgtcat tcgcctgggt cgagggaaac
481 accgtgta


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsZhao Zhang, Emre Turer, and Bruce Beutler