Phenotypic Mutation 'hallasan'

• Allele: hallasan
• Mutation Type: critical splice acceptor site
• Chromosome: 11
• Coordinate: 106,203,267 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Cd79b
• Gene Name: CD79B antigen
• Synonym(s): Igbeta, B29, Ig-beta, Igb
• Chromosomal Location: 106,202,167-106,205,388 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2015] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of B cells at the pro-B cell stage due to diminished signaling of the B cell receptor. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000048239 ^†] [ENSMUSP00000129029 ^†] † probably from a misspliced transcript
• AlphaFold: P15530
• SMART Domains: Protein: ENSMUSP00000048239; Gene: ENSMUSG00000040592

Domain	Start	End	E-Value	Type
low complexity region	29	40	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
IG	110	202	3.56e-9	SMART
transmembrane domain	220	239	N/A	INTRINSIC
ITAM	252	272	2.41e-4	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000048239; Gene: ENSMUSG00000040592

Domain	Start	End	E-Value	Type
low complexity region	29	40	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
IG	110	202	3.56e-9	SMART
transmembrane domain	220	239	N/A	INTRINSIC
ITAM	252	272	2.41e-4	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000129029; Gene: ENSMUSG00000040592

Domain	Start	End	E-Value	Type
low complexity region	14	21	N/A	INTRINSIC
IG	50	142	3.56e-9	SMART
transmembrane domain	160	179	N/A	INTRINSIC
ITAM	192	212	2.41e-4	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000129029; Gene: ENSMUSG00000040592

Domain	Start	End	E-Value	Type
low complexity region	14	21	N/A	INTRINSIC
IG	50	142	3.56e-9	SMART
transmembrane domain	160	179	N/A	INTRINSIC
ITAM	192	212	2.41e-4	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9493
• Is this an essential gene?: Probably nonessential (E-score: 0.083)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:35 PM by Diantha La Vine
• Record Created: 2018-06-27 8:53 PM by Xue Zhong
• Record Posted: 2018-10-25
• Science Writers: Eva Marie Y. Moresco, Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, Bruce Beutler

Accession Number

NCBI RefSeq: NM_008339, NM_001313939; MGI:96431

Alleles Listed at MGI

All Mutations and Alleles(16) : Gene trapped(2) Spontaneous(1) Targeted(10) Transgenic(3)

Phenotypic Description

Figure 1. Hallasan mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Hallasan mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Hallasan mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Hallasan mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Hallasan mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Hallasan mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Hallasan mice exhibit increased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Hallasan mice exhibit increased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Hallasan mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Hallasan mice exhibit reduced frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Hallasan mice exhibit reduced B220 expression on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The hallasan phenotype was identified among G3 mice of the pedigree R6215, some of which showed reduced B to T cell ratios (Figure 1) due to reduced frequencies of B cells (Figure 2) and B1 cells (Figure 3) with concomitant increased frequencies of T cells (Figure 4), CD4+ T cells (Figure 5), CD8+ T cells (Figure 6), CD44+ T cells (Figure 7), CD44+ CD4 T cells (Figure 8), and CD44+ CD8 T cells (Figure 9), all in the peripheral blood. The frequency of peripheral blood NK cells was also reduced (Figure 10). Expression of B220 on peripheral blood B cells was reduced (Figure 11).

Nature of Mutation

Figure 12. Linkage mapping of the increased T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 45 mutations (X-axis) identified in the G1 male of pedigree R6215. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 45 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Cd79b:  a G to T transversion at base pair 106,312,441 (v38) on chromosome 11, or base pair 2,122 in the GenBank genomic region NC_000077 within the splice acceptor site of intron 3. The strongest association was found with a recessive model of inheritance to the normalized T cell frequency, wherein seven variant homozygotes departed phenotypically from 24 homozygous reference mice and 28 heterozygous mice with a P value of 5.7 x 10^-35 (Figure 12).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in the use of a cryptic splice site in exon 4. The resulting transcript would have a 7-base pair deletion of exon 4, which would cause a frame-shifted protein product beginning after amino acid 142 of the protein, which is normally 228 amino acids in length, and termination after the inclusion of five aberrant amino acids.

<--exon 3          <--intron 3 exon 4--> 490 ……GAACTTCTAGTCTTAG ……tctcccctgctcccccag GATTCAGCACGTTGGACCAACTGA…… 138 ……-E--L--L--V--L--                      -------A--R--W--T--N--*-           correct                                   aberrant

The acceptor splice site of intron 3, which is destroyed by the hallasan mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 3. Domain structure of Igβ. The hallasan mutation destroys the acceptor site of intron 3. Abbreviations: SP, signal peptide; TM, transmembrane domain; ITAM, immunoreceptor tyrosine-based activation motif. See the text for more details. This image is interactive. Other mutations found in Igβ are noted in red. Click on each allele for more information.

Figure 4. Crystal structure of murine Igβ. Cysteine residues (C65 and C120) that form an intrachain disulfide bond are indicated in pink. C135 is in an unsolved portion of the protein. UCSF Chimera model is based on PDB 3KHQ, Radaev et al. Structure. 18, 934-943 (2010). Click on the 3D structure to view it rotate.

B cell antigen receptors (BCR) consist of two functional components [reviewed in (1)]. The antigen binding component is a membrane bound form of immunoglobulin (mIg), which consists of two transmembrane spanning heavy (H) chains and two associated light (L) chains. A heterodimer of Igα (see the record for crab) and Igβ constitutes the signaling component of the BCR (2-4). Because the cytoplasmic portion of mIg H chains is very short (three amino acids for IgM and IgD), BCR signaling depends on the interactions of the cytoplasmic domains of Igα and Igβ with downstream signaling molecules. The Igα/Igβ heterodimer associates noncovalently with all mIg isotypes (IgM, IgD, IgG, IgA, and IgE) (5), and is found in each BCR complex in a 1:1 stoichiometry with mIg (6).

Igα and Igβ are type I transmembrane glycoproteins of approximately 34 kD and 40 kD in mice, respectively (Figure 3). Igβ consists of 228 and 229 amino acids in mice and humans, respectively, and are 68% identical. The level of glycosylation of Igα and Igβ has been observed to vary between B cells of different lymphoid organs, resulting in molecular weight variations (7).

The cytoplasmic tails of Igα and Igβ are 61 and 48 amino acids in length, respectively, and each contains a single immunoreceptor tyrosine-based activation motif (ITAM) (8), a conserved domain containing two tyrosines that upon phosphorylation act as a binding site for SH2 domain-containing effectors (D/ExxxxxxxD/ExxYxxL/IxxxxxxxYxxL/I). BCR activation results in the phosphorylation of ITAM tyrosines in both Igα and Igβ by membrane-localized Src family kinases, which are subsequently recruited to the receptor through binding of the phosphorylated ITAMs to Src SH2 domains, thereby amplifying signaling (9). ITAM phosphorylation occurs largely on the membrane-proximal tyrosine (10), but doubly phosphorylated ITAMs also occur and serve as a binding site for the tandem SH2 domains of Syk, which initiates several signaling pathways (11;12) (see Background).

One side of the helical transmembrane segment of mIgs is highly conserved between isotypes and interacts closely with the transmembrane segment of the Igα/Igβ heterodimer, although it remains unknown whether contact between mIg and Igα/Igβ is through Igα or Igβ. Igα contains a negatively charged amino acid (glutamic acid) at the fifth position of the transmembrane segment that was hypothesized to interact directly with positively charged transmembrane residues in mIg (1;2). However, mIgM contains several polar but no charged amino acids in its transmembrane domain, and mutation of the central YS to VV abolished association with the Igα/Igβ heterodimer (13). More recent studies using fluorescence resonance energy transfer (FRET) indicated that the cytoplasmic domain of Igβ lies physically closer to mIg than Igα (14). Since Igβ contains a polar amino acid (glutamine) in its transmembrane region, polar interactions may mediate association between mIg and Igβ.

Based on its amino acid sequence, the extracellular N-terminus of Igβ would form a V-type Ig fold  (15). The extracellular domains of Igα and Igβ each contain features that are highly conserved in Ig superfamily proteins, including two cysteine residues that form an intrachain disulfide bond (Cys50 and Cys101 in Igα; Cys65 and Cys120 in Igβ), as well as several other conserved residues (16;17). The predicted Ig fold of Igβ was confirmed by X-ray crystallographic analysis, which demonstrated an I-type rather than a V-type fold [Figure 4; PDB: 3KHQ] (24). Igα and Igβ each contain an additional extracellular cysteine residue (Cys113 and Cys135, respectively); these form an interchain disulfide bond that mediates heterodimerization of the proteins (18;19). The function of the extracellular domains of Igα/Igβ in BCR signaling is not well understood. They contribute to interactions with mIg (3;18;20), and may be required for transport of mIgM to the cell surface (21).

Expression/Localization

Expression of Igβ mRNA and protein is restricted to cells of the B lineage, including B lineage progenitors, pre-B, and mature B cells (4;16). Both resting and activated B cells express Igβ.

Background

Figure 5. BCR Signaling. In resting B cells (inset), BCRs are dispersed as monomers with one Igα/β heterodimer in a “closed” position. Upon stimulation, receptors translocate into lipid rafts and aggregate to form caps. The tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn), causing them to take an open conformation and serve as docking sites for the adapter protein BLNK and the SH2 domains of SYK. SYK phosphorylates a number of downstream targets including BLNK, PLC-γ2 and protein kinase C β (PKCβ). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of 3′-phosphorylated phosphoinositides. One of these lipids, phosphatidylinositol-3,4,5-triphosphate (PIP₃), binds selectively to the pleckstrin homology (PH) domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-γ2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of phosphatidylinositol-4,5-diphosphate (PIP₂) to inositol-1,4,5-trisphosphate (IP₃) and diacylglycerol (DAG). Soluble IP₃ and membrane-bound DAG initiate downstream signal transduction pathways involving calcium (Ca²⁺) mobilization and PKC, respectively. The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1 or CARD11), which are involved in NF-κB activation along with PKCβ. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

B cells induce numerous responses to microbial infections, including antigen internalization, proliferation, T cell-independent antibody production, and the T cell-dependent antibody response. These responses are initiated upon antigen binding by the BCR, which rapidly recruits a signaling complex through interactions with Src family kinases (SFK) and the tyrosine kinase Syk (Figure 5). These kinases recruit and activate other molecules, notably BLNK (see busy) and Pik3ap1 (also called BCAP) (see Sothe) followed by PI-3K and Btk, that lead to activation of PLC-γ2 (see queen), which hydrolyzes phosphatidylinositol-4,5-bisphosphate (PIP₂) to diacylglycerol (DAG) and inositol-1,4,5-triphosphate (IP₃). Ultimately, through activation of IP₃ receptors on the endoplasmic reticulum, IP₃ triggers a large influx of Ca²⁺ to the cytoplasm. Sustained elevation of cytosolic Ca²⁺ regulates the activity of transcription factors including NF-AT and NF-κB (see xander and panr2). BCR engagement also activates pathways regulated by PKCβ (see Untied), PI-3K, and Ras/MAPK, which further modulate B cell responses [see (22;23) for reviews of B cell antigen receptor signaling]. Signal transduction following antigen binding to the BCR absolutely requires Igα and Igβ. Below, the functions of Igα and Ig β in proximal BCR signaling are described.

BCR engagement triggers receptor translocation into lipid rafts (24;25), and aggregation into microclusters that move together along actin filaments to form a central synapse at one pole of the cell, termed ‘capping’ (26). Following these events, the ITAMs located on the cytoplasmic tails of Igα and Igβ become phosphorylated by SFKs, which are enriched in lipid rafts as a result of their myristoylation and/or palmitoylation. Four SFKs (Lyn [see the record for Lemon], Fyn, Blk, Lck [see the record for iconoclast]) are the earliest activated kinases upon BCR ligation [(27); reviewed in (28)]. Lyn and Fyn, but not Src, were shown to interact directly with the resting BCR through binding to Igα (29;30). Lyn is believed to be primarily responsible for phosphorylating the ITAMs of Igα/Igβ (28;31). 

Once phosphorylated on both tyrosines, the Igα/Igβ ITAMs serve as docking sites for the adapter protein BLNK (32) and the two SH2 domains of Syk (see the record for poppy), which is then activated by SFK-dependent trans-phosphorylation (33-36). Syk-deficient B cells are deficient in downstream BCR signaling responses, but display normal SFK activation and Igα/Igβ phosphorylation, indicating that Syk is essential for transmitting signals from the BCR to distal signaling molecules (37). Syk phosphorylates a number of targets including BLNK, PLC-γ2, and PKCβ. BLNK serves as a scaffold to bring together several important signaling molecules (38;39). In particular, phosphorylated BLNK provides docking sites for the tyrosine kinase Btk as well as PLC-γ2, resulting in phosphorylation and activation of PLC-γ2 by Btk (40;41).

In addition to phosphorylation of tyrosines within the Igα and Igβ ITAMs, BCR aggregation also results in phosphorylation of a non-ITAM tyrosine at the tip of the Igα cytoplasmic domain (Y204) (32;42). This non-ITAM phosphotyrosine binds to the C-terminal SH2 domain of BLNK (32;43), and has been proposed to recruit BLNK to the BCR where it can be phosphorylated by ITAM-bound Syk (44). Both Igα ITAM tyrosines and Y204 are necessary for chicken B cell development in the absence of Igβ (45). In mice, Igα Y204 is required for T cell-independent B cell activation, proliferation, and antibody production, but not BCR capping, antigen internalization, antigen presentation, or T cell-dependent antibody production (46) B cells from Cd79a^Y204F/Y204F mice exhibited normal levels of BCR-induced Syk phosphorylation, but reduced BLNK phosphorylation, calcium flux, and NF-κB, JNK, and ERK activation. These findings suggest that phosphorylation of Igα Y204 promotes T cell-independent B cell responses in a manner dependent on BLNK phosphorylation. Several other non-ITAM tyrosines in the cytoplasmic tail of Igα, which are not phosphorylated, mediate BCR internalization in a manner independent of BCR signaling (47;48).

BCR signaling is essential for progression through the early stages of B cell development. Signaling-competent Igα and Igβ have been detected in a complex with the ER chaperone calnexin on the surface of mouse progenitor B (pro-B) cells, which do not yet express the Ig heavy chain (49;50). In this context, Igα and Igβ were proposed to promote V(D)J recombination (see maladaptive). However, pro-B cells from Igα- and Igβ-deficient mice initiated and completed V(D)J recombination as well wild type cells (51). Despite normal V(D)J recombination, these cells failed to express the pre-BCR (a complex composed of the recombined mIgM heavy chain, the surrogate light chains λ5 and VpreB, and the Igα/Igβ heterodimer) on the cell surface, and B cell development was blocked at the pro-B cell stage (51;52). Similarly, mutations of Igβ in humans cause agammaglobulinemia-6  leading to recurrent infections (OMIM: #612692). Pro-B cells in mice expressing chimeric receptors with the extracellular domain of mIgM and the cytoplasmic domain of either Igβ or Igα on a Rag1^-/- background transitioned to the pre-B cell stage and generated immature B cells (53;54). In addition, targeting the cytoplasmic domains of the Igα/Igβ heterodimer to the cell surface in the absence of any other BCR extracellular domains in pro-B cells lacking μ heavy chain expression was sufficient to generate immature B cells (55). Thus, basal signals generated by membrane-localized Igα/Igβ cytoplasmic domains are necessary and sufficient to support B cell differentiation.

In mature B cells, signaling through Igα/Igβ is required for cell survival. Cre-mediated deletion of the Igα locus in mature B cells resulted in apoptosis within a period of two weeks (56), a situation that also results from Ig heavy chain inactivation in mature B cells (57). Interestingly, when the BCR was altered to express two Igα cytoplasmic domains, mutant B cells developed to maturity but were anergic to T-independent and T-dependent antigens in vivo (58).

The distinct phenotypes of mice expressing either cytoplasmically truncated Igα or Igβ demonstrated that although Igα and Igβ are covalently linked and function together to transmit BCR signals, they are not equivalent in their signaling roles. In mice expressing Igβ truncated after the third amino acid of the cytoplasmic domain, B cell development proceeds up through the immature B stage (59). In contrast, B cell progression is impaired before the pre-B stage (50% reduction of pre-B cells) and severely impaired beyond it (80% reduction of immature B cells) in mice with a deletion of 40 of the 61 amino acids of the Igα cytoplasmic domain (60).

As further support that Igα and Igβ mediate different signals, several BCR signaling proteins were found to associate differentially with either Igα or Igβ. In particular, the cytoplasmic tail of Igα preferentially or exclusively bound to the tyrosine kinases Lyn, Fyn, and Syk over Igβ (61;62). Igα also bound preferentially to PI-3K and to p52Shc, an adapter that couples BCR signaling to Ras activation. Consistent with these data, tyrosine kinase activity was strongly activated in B cells expressing a fusion protein containing the CD8α extracellular domain and the Igα cytoplasmic domain, but not the Igβ cytoplasmic domain (63). Similar data were obtained with a fusion of Igα to a mutant form of mIgM defective for association with either Igα or Igβ (64). Distinct patterns of calcium signaling have also been observed in response to signaling from Igα or Igβ (65).

Putative Mechanism

The phenotype of hallasan mice is consistent with a loss of function of Igβ.

Primers

PCR Primer
hallasan_pcr_F: CTCAGAATATGGAGACCCTGCC
hallasan_pcr_R: GTGCAAGGTAGATTGTGTAGCC

Sequencing Primer
hallasan_seq_F: GAATATGGAGACCCTGCCCATGTC
hallasan_seq_R: GGTAGATTGTGTAGCCATCCACAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 11, - strand):

1   gtgcaaggta gattgtgtag ccatccacac ccactcccca gctcagccta cctaccaggg
61  gaagtggcta tgattctaga gtccccagga gagctgctaa gcagtagttt ctgatggtgt
121 ccaaagatcc accatgttta accttcaacg ccagtcttat gccctgccct tctcccctgc
181 tcccccagga ttcagcacgt tggaccaact gaagcggcgg aacacactga aagatggcat
241 tatcttgatc cagaccctcc tcatcatcct cttcatcatt gtgcccatct tcctgctact
301 tgacaaggtg cccacaggag ctgggggagg ggggtccttg ggaaggctgg gaggttggca
361 cagggaagac aggacatggg cagggtctcc atattctgag 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Reth, M. (1992) Antigen Receptors on B Lymphocytes. Annu. Rev. Immunol.. 10, 97-121.

  2. Campbell, K. S., Hager, E. J., Friedrich, R. J., and Cambier, J. C. (1991) IgM Antigen Receptor Complex Contains Phosphoprotein Products of B29 and Mb-1 Genes. Proc. Natl. Acad. Sci. U. S. A.. 88, 3982-3986.

  3. Hombach, J., Tsubata, T., Leclercq, L., Stappert, H., and Reth, M. (1990) Molecular Components of the B-Cell Antigen Receptor Complex of the IgM Class. Nature. 343, 760-762.

  4. Campbell, K. S., and Cambier, J. C. (1990) B Lymphocyte Antigen Receptors (mIg) are Non-Covalently Associated with a Disulfide Linked, Inducibly Phosphorylated Glycoprotein Complex. EMBO J.. 9, 441-448.

  5. Venkitaraman, A. R., Williams, G. T., Dariavach, P., and Neuberger, M. S. (1991) The B-Cell Antigen Receptor of the Five Immunoglobulin Classes. Nature. 352, 777-781.

  6. Schamel, W. W., and Reth, M. (2000) Monomeric and Oligomeric Complexes of the B Cell Antigen Receptor. Immunity. 13, 5-14.

  7. Chen, J. Z., Stall, A. M., Herzenberg, L. A., and Herzenberg, L. A. (1990) Differences in Glycoprotein Complexes Associated with IgM and IgD on Normal Murine B Cells Potentially Enable Transduction of Different Signals. EMBO J.. 9, 2117-2124.

  8. Flaswinkel, H., and Reth, M. (1994) Dual Role of the Tyrosine Activation Motif of the Ig-Alpha Protein during Signal Transduction Via the B Cell Antigen Receptor. EMBO J.. 13, 83-89.

  9. Kurosaki, T. (1999) Genetic Analysis of B Cell Antigen Receptor Signaling. Annu. Rev. Immunol.. 17, 555-592.

  10. Pao, L. I., Famiglietti, S. J., and Cambier, J. C. (1998) Asymmetrical Phosphorylation and Function of Immunoreceptor Tyrosine-Based Activation Motif Tyrosines in B Cell Antigen Receptor Signal Transduction. J. Immunol.. 160, 3305-3314.

  11. Rowley, R. B., Burkhardt, A. L., Chao, H. G., Matsueda, G. R., and Bolen, J. B. (1995) Syk Protein-Tyrosine Kinase is Regulated by Tyrosine-Phosphorylated Ig alpha/Ig Beta Immunoreceptor Tyrosine Activation Motif Binding and Autophosphorylation. J. Biol. Chem.. 270, 11590-11594.

  12. Kurosaki, T., Johnson, S. A., Pao, L., Sada, K., Yamamura, H., and Cambier, J. C. (1995) Role of the Syk Autophosphorylation Site and SH2 Domains in B Cell Antigen Receptor Signaling. J. Exp. Med.. 182, 1815-1823.

  13. Grupp, S. A., Campbell, K., Mitchell, R. N., Cambier, J. C., and Abbas, A. K. (1993) Signaling-Defective Mutants of the B Lymphocyte Antigen Receptor Fail to Associate with Ig-Alpha and Ig-beta/gamma. J. Biol. Chem.. 268, 25776-25779.

  14. Tolar, P., Sohn, H. W., and Pierce, S. K. (2005) The Initiation of Antigen-Induced B Cell Antigen Receptor Signaling Viewed in Living Cells by Fluorescence Resonance Energy Transfer. Nat. Immunol.. 6, 1168-1176.

  15. Hermanson, G. G., Eisenberg, D., Kincade, P. W., and Wall, R. (1988) B29: A Member of the Immunoglobulin Gene Superfamily Exclusively Expressed on Beta-Lineage Cells. Proc. Natl. Acad. Sci. U. S. A.. 85, 6890-6894.

  16. Sakaguchi, N., Kashiwamura, S., Kimoto, M., Thalmann, P., and Melchers, F. (1988) B Lymphocyte Lineage-Restricted Expression of Mb-1, a Gene with CD3-Like Structural Properties. EMBO J.. 7, 3457-3464.

  17. Williams, A. F., and Barclay, A. N. (1988) The Immunoglobulin Superfamily--Domains for Cell Surface Recognition. Annu. Rev. Immunol.. 6, 381-405.

  18. Radaev, S., Zou, Z., Tolar, P., Nguyen, K., Nguyen, A., Krueger, P. D., Stutzman, N., Pierce, S., and Sun, P. D. (2010) Structural and Functional Studies of Igalphabeta and its Assembly with the B Cell Antigen Receptor. Structure. 18, 934-943.

  19. Siegers, G. M., Yang, J., Duerr, C. U., Nielsen, P. J., Reth, M., and Schamel, W. W. (2006) Identification of Disulfide Bonds in the Ig-alpha/Ig-Beta Component of the B Cell Antigen Receptor using the Drosophila S2 Cell Reconstitution System. Int. Immunol.. 18, 1385-1396.

  20. Dylke, J., Lopes, J., Dang-Lawson, M., Machtaler, S., and Matsuuchi, L. (2007) Role of the Extracellular and Transmembrane Domain of Ig-alpha/beta in Assembly of the B Cell Antigen Receptor (BCR). Immunol. Lett.. 112, 47-57.

  21. Indraccolo, S., Minuzzo, S., Zamarchi, R., Calderazzo, F., Piovan, E., and Amadori, A. (2002) Alternatively Spliced Forms of Igalpha and Igbeta Prevent B Cell Receptor Expression on the Cell Surface. Eur. J. Immunol.. 32, 1530-1540.

  22. Dal Porto, J. M., Gauld, S. B., Merrell, K. T., Mills, D., Pugh-Bernard, A. E., and Cambier, J. (2004) B Cell Antigen Receptor Signaling 101. Mol. Immunol.. 41, 599-613.

  23. Niiro, H., and Clark, E. A. (2002) Regulation of B-Cell Fate by Antigen-Receptor Signals. Nat. Rev. Immunol.. 2, 945-956.

  24. Cheng, P. C., Dykstra, M. L., Mitchell, R. N., and Pierce, S. K. (1999) A Role for Lipid Rafts in B Cell Antigen Receptor Signaling and Antigen Targeting. J. Exp. Med.. 190, 1549-1560.

  25. Cheng, P. C., Brown, B. K., Song, W., and Pierce, S. K. (2001) Translocation of the B Cell Antigen Receptor into Lipid Rafts Reveals a Novel Step in Signaling. J. Immunol.. 166, 3693-3701.

  26. Fleire, S. J., Goldman, J. P., Carrasco, Y. R., Weber, M., Bray, D., and Batista, F. D. (2006) B Cell Ligand Discrimination through a Spreading and Contraction Response. Science. 312, 738-741.

  27. Saouaf, S. J., Mahajan, S., Rowley, R. B., Kut, S. A., Fargnoli, J., Burkhardt, A. L., Tsukada, S., Witte, O. N., and Bolen, J. B. (1994) Temporal Differences in the Activation of Three Classes of Non-Transmembrane Protein Tyrosine Kinases Following B-Cell Antigen Receptor Surface Engagement. Proc. Natl. Acad. Sci. U. S. A.. 91, 9524-9528.

  28. Kurosaki, T., and Hikida, M. (2009) Tyrosine Kinases and their Substrates in B Lymphocytes. Immunol. Rev.. 228, 132-148.

  29. Pleiman, C. M., Abrams, C., Gauen, L. T., Bedzyk, W., Jongstra, J., Shaw, A. S., and Cambier, J. C. (1994) Distinct p53/56lyn and p59fyn Domains Associate with Nonphosphorylated and Phosphorylated Ig-Alpha. Proc. Natl. Acad. Sci. U. S. A.. 91, 4268-4272.

  30. Clark, M. R., Campbell, K. S., Kazlauskas, A., Johnson, S. A., Hertz, M., Potter, T. A., Pleiman, C., and Cambier, J. C. (1992) The B Cell Antigen Receptor Complex: Association of Ig-Alpha and Ig-Beta with Distinct Cytoplasmic Effectors. Science. 258, 123-126.

  31. Sohn, H. W., Tolar, P., Jin, T., and Pierce, S. K. (2006) Fluorescence Resonance Energy Transfer in Living Cells Reveals Dynamic Membrane Changes in the Initiation of B Cell Signaling. Proc. Natl. Acad. Sci. U. S. A.. 103, 8143-8148.

  32. Kabak, S., Skaggs, B. J., Gold, M. R., Affolter, M., West, K. L., Foster, M. S., Siemasko, K., Chan, A. C., Aebersold, R., and Clark, M. R. (2002) The Direct Recruitment of BLNK to Immunoglobulin Alpha Couples the B-Cell Antigen Receptor to Distal Signaling Pathways. Mol. Cell. Biol.. 22, 2524-2535.

  33. Chen, T., Repetto, B., Chizzonite, R., Pullar, C., Burghardt, C., Dharm, E., Zhao, Z., Carroll, R., Nunes, P., Basu, M., Danho, W., Visnick, M., Kochan, J., Waugh, D., and Gilfillan, A. M. (1996) Interaction of Phosphorylated FcepsilonRIgamma Immunoglobulin Receptor Tyrosine Activation Motif-Based Peptides with Dual and Single SH2 Domains of p72syk. Assessment of Binding Parameters and Real Time Binding Kinetics. J. Biol. Chem.. 271, 25308-25315.

  34. Kurosaki, T., Johnson, S. A., Pao, L., Sada, K., Yamamura, H., and Cambier, J. C. (1995) Role of the Syk Autophosphorylation Site and SH2 Domains in B Cell Antigen Receptor Signaling. J. Exp. Med.. 182, 1815-1823.

  35. Johnson, S. A., Pleiman, C. M., Pao, L., Schneringer, J., Hippen, K., and Cambier, J. C. (1995) Phosphorylated Immunoreceptor Signaling Motifs (ITAMs) Exhibit Unique Abilities to Bind and Activate Lyn and Syk Tyrosine Kinases. J. Immunol.. 155, 4596-4603.

  36. Rowley, R. B., Burkhardt, A. L., Chao, H. G., Matsueda, G. R., and Bolen, J. B. (1995) Syk Protein-Tyrosine Kinase is Regulated by Tyrosine-Phosphorylated Ig alpha/Ig Beta Immunoreceptor Tyrosine Activation Motif Binding and Autophosphorylation. J. Biol. Chem.. 270, 11590-11594.

  37. Takata, M., Sabe, H., Hata, A., Inazu, T., Homma, Y., Nukada, T., Yamamura, H., and Kurosaki, T. (1994) Tyrosine Kinases Lyn and Syk Regulate B Cell Receptor-Coupled Ca2+ Mobilization through Distinct Pathways. EMBO J.. 13, 1341-1349.

  38. Chiu, C. W., Dalton, M., Ishiai, M., Kurosaki, T., and Chan, A. C. (2002) BLNK: Molecular Scaffolding through 'Cis'-Mediated Organization of Signaling Proteins. EMBO J.. 21, 6461-6472.

  39. Wienands, J., Schweikert, J., Wollscheid, B., Jumaa, H., Nielsen, P. J., and Reth, M. (1998) SLP-65: A New Signaling Component in B Lymphocytes which Requires Expression of the Antigen Receptor for Phosphorylation. J. Exp. Med.. 188, 791-795.

  40. Baba, Y., Hashimoto, S., Matsushita, M., Watanabe, D., Kishimoto, T., Kurosaki, T., and Tsukada, S. (2001) BLNK Mediates Syk-Dependent Btk Activation. Proc. Natl. Acad. Sci. U. S. A.. 98, 2582-2586.

  41. Ishiai, M., Kurosaki, M., Pappu, R., Okawa, K., Ronko, I., Fu, C., Shibata, M., Iwamatsu, A., Chan, A. C., and Kurosaki, T. (1999) BLNK Required for Coupling Syk to PLC Gamma 2 and Rac1-JNK in B Cells. Immunity. 10, 117-125.

  42. Kraus, M., Pao, L. I., Reichlin, A., Hu, Y., Canono, B., Cambier, J. C., Nussenzweig, M. C., and Rajewsky, K. (2001) Interference with Immunoglobulin (Ig)Alpha Immunoreceptor Tyrosine-Based Activation Motif (ITAM) Phosphorylation Modulates Or Blocks B Cell Development, Depending on the Availability of an Igbeta Cytoplasmic Tail. J. Exp. Med.. 194, 455-469.

  43. Engels, N., Wollscheid, B., and Wienands, J. (2001) Association of SLP-65/BLNK with the B Cell Antigen Receptor through a Non-ITAM Tyrosine of Ig-Alpha. Eur. J. Immunol.. 31, 2126-2134.

  44. Kohler, F., Storch, B., Kulathu, Y., Herzog, S., Kuppig, S., Reth, M., and Jumaa, H. (2005) A Leucine Zipper in the N Terminus Confers Membrane Association to SLP-65. Nat. Immunol.. 6, 204-210.

  45. Pike, K. A., and Ratcliffe, M. J. (2005) Dual Requirement for the Ig Alpha Immunoreceptor Tyrosine-Based Activation Motif (ITAM) and a Conserved Non-Ig Alpha ITAM Tyrosine in Supporting Ig Alpha Beta-Mediated B Cell Development. J. Immunol.. 174, 2012-2020.

  46. Patterson, H. C., Kraus, M., Kim, Y. M., Ploegh, H., and Rajewsky, K. (2006) The B Cell Receptor Promotes B Cell Activation and Proliferation through a Non-ITAM Tyrosine in the Igalpha Cytoplasmic Domain. Immunity. 25, 55-65.

  47. Hou, P., Araujo, E., Zhao, T., Zhang, M., Massenburg, D., Veselits, M., Doyle, C., Dinner, A. R., and Clark, M. R. (2006) B Cell Antigen Receptor Signaling and Internalization are Mutually Exclusive Events. PLoS Biol.. 4, e200.

  48. Cassard, S., Salamero, J., Hanau, D., Spehner, D., Davoust, J., Fridman, W. H., and Bonnerot, C. (1998) A Tyrosine-Based Signal Present in Ig Alpha Mediates B Cell Receptor Constitutive Internalization. J. Immunol.. 160, 1767-1773.

  49. Nagata, K., Nakamura, T., Kitamura, F., Kuramochi, S., Taki, S., Campbell, K. S., and Karasuyama, H. (1997) The Ig alpha/Igbeta Heterodimer on Mu-Negative proB Cells is Competent for Transducing Signals to Induce Early B Cell Differentiation. Immunity. 7, 559-570.

  50. Koyama, M., Ishihara, K., Karasuyama, H., Cordell, J. L., Iwamoto, A., and Nakamura, T. (1997) CD79 alpha/CD79 Beta Heterodimers are Expressed on Pro-B Cell Surfaces without Associated Mu Heavy Chain. Int. Immunol.. 9, 1767-1772.

  51. Pelanda, R., Braun, U., Hobeika, E., Nussenzweig, M. C., and Reth, M. (2002) B Cell Progenitors are Arrested in Maturation but have Intact VDJ Recombination in the Absence of Ig-Alpha and Ig-Beta. J. Immunol.. 169, 865-872.

  52. Gong, S., and Nussenzweig, M. C. (1996) Regulation of an Early Developmental Checkpoint in the B Cell Pathway by Ig Beta. Science. 272, 411-414.

  53. Papavasiliou, F., Jankovic, M., Suh, H., and Nussenzweig, M. C. (1995) The Cytoplasmic Domains of Immunoglobulin (Ig) Alpha and Ig Beta can Independently Induce the Precursor B Cell Transition and Allelic Exclusion. J. Exp. Med.. 182, 1389-1394.

  54. Teh, Y. M., and Neuberger, M. S. (1997) The Immunoglobulin (Ig)Alpha and Igbeta Cytoplasmic Domains are Independently Sufficient to Signal B Cell Maturation and Activation in Transgenic Mice. J. Exp. Med.. 185, 1753-1758.

  55. Bannish, G., Fuentes-Panana, E. M., Cambier, J. C., Pear, W. S., and Monroe, J. G. (2001) Ligand-Independent Signaling Functions for the B Lymphocyte Antigen Receptor and their Role in Positive Selection during B Lymphopoiesis. J. Exp. Med.. 194, 1583-1596.

  56. Kraus, M., Alimzhanov, M. B., Rajewsky, N., and Rajewsky, K. (2004) Survival of Resting Mature B Lymphocytes Depends on BCR Signaling Via the Igalpha/beta Heterodimer. Cell. 117, 787-800.

  57. Lam, K. P., Kuhn, R., and Rajewsky, K. (1997) In Vivo Ablation of Surface Immunoglobulin on Mature B Cells by Inducible Gene Targeting Results in Rapid Cell Death. Cell. 90, 1073-1083.

  58. Reichlin, A., Gazumyan, A., Nagaoka, H., Kirsch, K. H., Kraus, M., Rajewsky, K., and Nussenzweig, M. C. (2004) A B Cell Receptor with Two Igalpha Cytoplasmic Domains Supports Development of Mature but Anergic B Cells. J. Exp. Med.. 199, 855-865.

  59. Reichlin, A., Hu, Y., Meffre, E., Nagaoka, H., Gong, S., Kraus, M., Rajewsky, K., and Nussenzweig, M. C. (2001) B Cell Development is Arrested at the Immature B Cell Stage in Mice Carrying a Mutation in the Cytoplasmic Domain of Immunoglobulin Beta. J. Exp. Med.. 193, 13-23.

  60. Torres, R. M., Flaswinkel, H., Reth, M., and Rajewsky, K. (1996) Aberrant B Cell Development and Immune Response in Mice with a Compromised BCR Complex. Science. 272, 1804-1808.

  61. Johnson, S. A., Pleiman, C. M., Pao, L., Schneringer, J., Hippen, K., and Cambier, J. C. (1995) Phosphorylated Immunoreceptor Signaling Motifs (ITAMs) Exhibit Unique Abilities to Bind and Activate Lyn and Syk Tyrosine Kinases. J. Immunol.. 155, 4596-4603.

  62. Clark, M. R., Campbell, K. S., Kazlauskas, A., Johnson, S. A., Hertz, M., Potter, T. A., Pleiman, C., and Cambier, J. C. (1992) The B Cell Antigen Receptor Complex: Association of Ig-Alpha and Ig-Beta with Distinct Cytoplasmic Effectors. Science. 258, 123-126.

  63. Kim, K. M., Alber, G., Weiser, P., and Reth, M. (1993) Differential Signaling through the Ig-Alpha and Ig-Beta Components of the B Cell Antigen Receptor. Eur. J. Immunol.. 23, 911-916.

  64. Sanchez, M., Misulovin, Z., Burkhardt, A. L., Mahajan, S., Costa, T., Franke, R., Bolen, J. B., and Nussenzweig, M. (1993) Signal Transduction by Immunoglobulin is Mediated through Ig Alpha and Ig Beta. J. Exp. Med.. 178, 1049-1055.

  65. Choquet, D., Ku, G., Cassard, S., Malissen, B., Korn, H., Fridman, W. H., and Bonnerot, C. (1994) Different Patterns of Calcium Signaling Triggered through Two Components of the B Lymphocyte Antigen Receptor. J. Biol. Chem.. 269, 6491-6497.