Phenotypic Mutation 'earthquake' (pdf version)
Mutation Type nonsense
Coordinate85,628,735 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Alms1
Gene Name ALMS1, centrosome and basal body associated
Chromosomal Location 85,587,531-85,702,753 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_145223; MGI:1934606

Mapped Yes 
Amino Acid Change Lysine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000071904] [ENSMUSP00000148796]
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: K1987*

coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect probably null
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - increased
Body Weight (BP Female) - increased
Body Weight (BP) - increased
Body Weight (Female) - increased
Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (ENU) (3) Gene trapped(9) Spontaneous(2) Targeted(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85677964 missense probably damaging 1.00
IGL00331:Alms1 APN 6 85641371 missense possibly damaging 0.94
IGL00658:Alms1 APN 6 85628961 missense probably damaging 1.00
IGL00835:Alms1 APN 6 85622134 missense probably damaging 1.00
IGL00930:Alms1 APN 6 85601310 missense probably damaging 0.98
IGL01446:Alms1 APN 6 85696701 missense probably damaging 1.00
IGL01448:Alms1 APN 6 85677899 missense possibly damaging 0.93
IGL01563:Alms1 APN 6 85627983 missense probably damaging 1.00
IGL01632:Alms1 APN 6 85627946 missense probably benign 0.07
IGL01651:Alms1 APN 6 85656476 missense probably benign 0.05
IGL01670:Alms1 APN 6 85678150 missense probably benign 0.00
IGL01716:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01719:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01720:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01723:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01877:Alms1 APN 6 85622411 missense possibly damaging 0.55
IGL01919:Alms1 APN 6 85628004 missense possibly damaging 0.77
IGL01976:Alms1 APN 6 85622665 missense possibly damaging 0.73
IGL02003:Alms1 APN 6 85622223 missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85628823 missense probably benign 0.12
IGL02070:Alms1 APN 6 85651403 missense possibly damaging 0.74
IGL02079:Alms1 APN 6 85628634 missense probably damaging 0.98
IGL02081:Alms1 APN 6 85620303 missense possibly damaging 0.55
IGL02379:Alms1 APN 6 85629633 missense probably damaging 0.98
IGL02412:Alms1 APN 6 85628872 missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85599967 missense probably benign
IGL02636:Alms1 APN 6 85628654 missense probably benign 0.28
IGL02702:Alms1 APN 6 85599849 missense probably benign 0.12
IGL02815:Alms1 APN 6 85667957 critical splice donor site probably null
IGL02926:Alms1 APN 6 85641450 missense probably damaging 1.00
IGL02945:Alms1 APN 6 85620933 missense probably damaging 0.96
IGL02959:Alms1 APN 6 85629052 nonsense probably null
IGL03124:Alms1 APN 6 85678419 missense probably benign 0.03
IGL03199:Alms1 APN 6 85622497 missense possibly damaging 0.68
IGL03209:Alms1 APN 6 85599973 splice site probably benign
IGL03247:Alms1 APN 6 85678597 missense possibly damaging 0.85
ares UTSW 6 85621275 nonsense probably null
ares2 UTSW 6 85677990 nonsense probably null
fatty UTSW 6 85627934 nonsense probably null
portly UTSW 6 85619712 missense probably benign 0.00
R0003:Alms1 UTSW 6 85629210 missense possibly damaging 0.90
R0095:Alms1 UTSW 6 85620253 missense possibly damaging 0.90
R0110:Alms1 UTSW 6 85620369 nonsense probably null
R0114:Alms1 UTSW 6 85619803 missense probably benign 0.00
R0153:Alms1 UTSW 6 85641381 missense possibly damaging 0.94
R0217:Alms1 UTSW 6 85622930 missense probably damaging 0.99
R0328:Alms1 UTSW 6 85610814 splice site probably null
R0410:Alms1 UTSW 6 85587803 missense unknown
R0469:Alms1 UTSW 6 85620369 nonsense probably null
R0491:Alms1 UTSW 6 85702600 missense probably damaging 0.98
R0510:Alms1 UTSW 6 85620369 nonsense probably null
R0522:Alms1 UTSW 6 85621615 missense probably benign
R0525:Alms1 UTSW 6 85587760 missense unknown
R0611:Alms1 UTSW 6 85678671 missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85623033 missense possibly damaging 0.85
R0718:Alms1 UTSW 6 85621821 missense probably benign 0.00
R0831:Alms1 UTSW 6 85628520 missense probably benign 0.00
R1318:Alms1 UTSW 6 85628549 missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85667957 critical splice donor site probably null
R1561:Alms1 UTSW 6 85629052 nonsense probably null
R1648:Alms1 UTSW 6 85678402 missense probably damaging 0.99
R1697:Alms1 UTSW 6 85622454 missense possibly damaging 0.94
R1699:Alms1 UTSW 6 85622880 missense possibly damaging 0.46
R1715:Alms1 UTSW 6 85629052 nonsense probably null
R1723:Alms1 UTSW 6 85628753 missense probably damaging 1.00
R1734:Alms1 UTSW 6 85641550 critical splice donor site probably null
R1758:Alms1 UTSW 6 85628505 missense probably damaging 0.99
R1804:Alms1 UTSW 6 85621275 nonsense probably null
R1835:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R1836:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R2077:Alms1 UTSW 6 85622309 missense possibly damaging 0.93
R2246:Alms1 UTSW 6 85622967 missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85619848 missense probably damaging 1.00
R2280:Alms1 UTSW 6 85677973 missense probably damaging 0.99
R2516:Alms1 UTSW 6 85667963 splice site probably benign
R2519:Alms1 UTSW 6 85667963 splice site probably benign
R2566:Alms1 UTSW 6 85622482 missense possibly damaging 0.84
R2850:Alms1 UTSW 6 85621299 missense probably benign 0.00
R2850:Alms1 UTSW 6 85667963 splice site probably benign
R2932:Alms1 UTSW 6 85620562 missense possibly damaging 0.89
R2944:Alms1 UTSW 6 85628391 missense probably damaging 1.00
R2980:Alms1 UTSW 6 85628835 missense probably damaging 1.00
R3084:Alms1 UTSW 6 85678140 missense probably benign
R3086:Alms1 UTSW 6 85678140 missense probably benign
R3122:Alms1 UTSW 6 85667963 splice site probably benign
R3404:Alms1 UTSW 6 85667963 splice site probably benign
R3405:Alms1 UTSW 6 85667963 splice site probably benign
R3804:Alms1 UTSW 6 85619647 missense probably damaging 1.00
R3904:Alms1 UTSW 6 85621678 missense probably benign 0.00
R4014:Alms1 UTSW 6 85678352 missense probably benign 0.41
R4056:Alms1 UTSW 6 85587803 missense unknown
R4067:Alms1 UTSW 6 85621289 missense probably damaging 1.00
R4110:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4111:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4112:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4194:Alms1 UTSW 6 85677990 nonsense probably null
R4464:Alms1 UTSW 6 85620021 missense possibly damaging 0.66
R4539:Alms1 UTSW 6 85620478 missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85624617 missense probably benign
R4696:Alms1 UTSW 6 85620522 missense probably damaging 1.00
R4825:Alms1 UTSW 6 85678245 missense probably damaging 0.99
R4921:Alms1 UTSW 6 85628546 missense probably benign 0.13
R5030:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R5051:Alms1 UTSW 6 85627934 nonsense probably null
R5085:Alms1 UTSW 6 85620732 missense possibly damaging 0.55
R5141:Alms1 UTSW 6 85621432 missense probably benign 0.01
R5233:Alms1 UTSW 6 85656371 intron probably null
R5310:Alms1 UTSW 6 85615368 missense possibly damaging 0.79
R5344:Alms1 UTSW 6 85696789 missense probably benign 0.04
R5394:Alms1 UTSW 6 85623088 missense probably benign 0.01
R5460:Alms1 UTSW 6 85696731 missense probably benign 0.08
R5558:Alms1 UTSW 6 85641329 nonsense probably null
R5650:Alms1 UTSW 6 85620271 missense probably damaging 1.00
R5667:Alms1 UTSW 6 85696771 missense probably damaging 0.99
R5671:Alms1 UTSW 6 85629208 missense possibly damaging 0.87
R5688:Alms1 UTSW 6 85599895 missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85622838 missense probably damaging 0.99
R5892:Alms1 UTSW 6 85620903 missense probably damaging 0.99
R5947:Alms1 UTSW 6 85619712 missense probably benign 0.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6144:Alms1 UTSW 6 85623074 missense probably damaging 0.98
R6258:Alms1 UTSW 6 85628735 nonsense probably null
R6260:Alms1 UTSW 6 85628735 nonsense probably null
R6455:Alms1 UTSW 6 85696657 missense probably damaging 0.99
R6569:Alms1 UTSW 6 85641339 missense probably benign 0.07
R6637:Alms1 UTSW 6 85619734 missense possibly damaging 0.78
R6866:Alms1 UTSW 6 85621098 missense possibly damaging 0.85
R6918:Alms1 UTSW 6 85622661 missense possibly damaging 0.87
X0013:Alms1 UTSW 6 85656455 missense probably damaging 1.00
X0025:Alms1 UTSW 6 85620210 missense probably damaging 0.96
Mode of Inheritance Unknown
Local Stock
Last Updated 2018-12-18 8:52 AM by Anne Murray
Record Created 2018-07-11 3:52 PM by Bruce Beutler
Record Posted 2018-12-18
Phenotypic Description

Figure 1. Earthquake mice exhibited increased body weights compared to wild-type littermates. Scaled body weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The earthquake phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6260, some of which showed increased body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 80 mutations (X-axis) identified in the G1 male of pedigree R6260. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 80 mutations. The increased body weight phenotype was linked to mutations in two genes on chromosome 6: Fbxo41 and Alms1. The mutation in Alms1 was presumed causative as the body weight phenotype observed in earthquake mice mimics that of other Alms1 mutant mice (see ares and MGI). The mutation in Alms1 is an A to T transversion at base pair 85,628,735 (v38) on chromosome 6, or base pair 41,237 in the GenBank genomic region NC_000072 encoding Alms1. Linkage was found with a recessive model of inheritance, wherein five variant homozygotes departed phenotypically from 19 homozygous reference mice and 26 heterozygous mice with a P value of 3.84 x 10-5 (Figure 2).


The mutation corresponds to residue 6,074 in the mRNA sequence NM_145223 within exon 10 of 23 total exons.



1982 -N--V--S--N--F--K--G--V--Q--F--S-


The mutated nucleotide is indicated in red. The mutation results in substitution of lysine 1,987 for a premature stop codon (K1987*) in the ALMS1 protein.

Protein Prediction
Figure 3. Domain organization of ALMS1. See the text for more details. The earthquake mutation (K1987*) is indicated by an asterisk. This image is interactive; click to view additional mutations in Alms1.

Alms1 encodes Alström Syndrome 1 (ALMS1), which has a glutamine-rich segment (amino acids 2-80), a proline-rich segment (amino acids 90-113), a putative leucine zipper (amino acids), a large tandem repeat domain (TRD) comprised of 34 imperfect repeats of a 45-50-amino acid sequence (amino acids 440−1362), a histidine-rich region (amino acids 2582-2618), two putative nuclear localization signals, a serine-rich region, and an ALMS motif (amino acids 3124-3251) [Figure 3(1-4)]. The functional significance of the domains of ALMS1 is unknown. 


The earthquake mutation results in substitution of lysine 1,987 for a premature stop codon (K1987*) in the ALMS1 protein; Lys1987 is within the TRD.


Please see the record for ares for more information about Alms1.

Putative Mechanism

ALMS1 has putative roles in cell cycle regulation, cell migration, apoptosis, extracellular matrix production, ciliary assembly and/or function, adipogenesis, cytoplasmic microtubular organization, endosomal transport, and regulation of the transport of proteins between the cytoplasm and the ciliary axoneme (4-8). ALMS1 is proposed to be involved in intracellular trafficking of one or more uncharacterized receptors to the primary cilium membrane. ALMS1 may be involved in vesicle transport from the Golgi to the cilium and/or in intraflagellar transport. When ALMS1 is present, signals from the transported receptor regulate cellular homeostasis, neurogenesis, or organ function. In the absence of ALMS1, the receptor(s) are not transported within the cilia, resulting in defective signaling. In the absence of ALMS1 there is obesity, neurosensory deficit, and organ failure.


Homozygous or compound heterozygous mutations in ALMS1 that typically result in coding of a premature stop codon and coding of a truncated protein are linked to Alström syndrome (OMIM: #203800; (2;9)]. Alström syndrome has variable symptoms including childhood obesity due to an excess accumulation of subcutaneous adipose tissue, hyperinsulinemia, acanthosis nigricans (a marker of severe insulin resistance), type 2 diabetes mellitus, hypertriglyceridemia that can lead to acute pancreatitis, hypothyroidsism, growth hormone deficiency, sensorineural hearing loss, and progressive rod-cone dystrophy leading to blindness [(10); reviewed in (11;12)].


Several Alms1 mutant mouse models (fat aussie (foz), Alms1L2131X, and Alms1-/-) have been characterized (13-15). All of the mouse models exhibited rapid weight gain due to an increase in body fat and increased eating at weaning. In addition, all of the mutant Alms1 alleles also resulted in hyperinsulinemia, increased cholesterol levels (total and HDL), moderate late-onset (after ~16 weeks) diabetes only in the male mice, steatosis of the liver, hyperplastic pancreatic islets, and hypogonadism leading to infertility in the male mice. The phenotype of the earthquake mice indicate loss of ALMS1-associated function.

Primers PCR Primer

Sequencing Primer
earthquake_seq(R):5'- GGTGTGGCTTTCCTCAAAGAGC -3'
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsZhao Zhang and Bruce Beutler