Phenotypic Mutation 'Poorly'

• Allele: Poorly
• Mutation Type: nonsense
• Chromosome: 9
• Coordinate: 71,851,298 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Tcf12
• Gene Name: transcription factor 12
• Synonym(s): REB, HTF-4, HTF4, HEB, ALF1, HEBAlt, bHLHb20, ME1
• Chromosomal Location: 71,751,534-72,019,611 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a targeted null mutation exhibit postnatal lethality within two weeks of birth and a 50% reduction in the number of pro-B cells. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Lysine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000034755] [ENSMUSP00000139365] [ENSMUSP00000138939] [ENSMUSP00000138952 ^†] [ENSMUSP00000139084] [ENSMUSP00000139284] [ENSMUSP00000138832] [ENSMUSP00000139364] [ENSMUSP00000138925] [ENSMUSP00000139248 ^†] [ENSMUSP00000139233] [ENSMUSP00000139008] † probably from a misspliced transcript
• AlphaFold: Q61286
• SMART Domains: Protein: ENSMUSP00000034755; Gene: ENSMUSG00000032228; AA Change: K110*

Domain	Start	End	E-Value	Type
PDB:4JOL|H	177	200	7e-8	PDB
low complexity region	208	219	N/A	INTRINSIC
low complexity region	256	272	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
low complexity region	558	572	N/A	INTRINSIC
HLH	607	660	7.54e-10	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000139365; Gene: ENSMUSG00000032228; AA Change: K110*

Domain	Start	End	E-Value	Type
PDB:4JOL|H	177	200	7e-8	PDB
low complexity region	208	219	N/A	INTRINSIC
low complexity region	256	272	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
low complexity region	558	572	N/A	INTRINSIC
HLH	607	660	7.54e-10	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000138939; Gene: ENSMUSG00000032228

Domain	Start	End	E-Value	Type
low complexity region	89	100	N/A	INTRINSIC

• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000139084; Gene: ENSMUSG00000032228; AA Change: K110*

Domain	Start	End	E-Value	Type
PDB:4JOL|H	177	200	5e-8	PDB
low complexity region	208	219	N/A	INTRINSIC
low complexity region	256	272	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000139284; Gene: ENSMUSG00000032228; AA Change: K18*

Domain	Start	End	E-Value	Type
PDB:4JOL|H	85	108	4e-8	PDB
low complexity region	116	127	N/A	INTRINSIC
low complexity region	164	180	N/A	INTRINSIC
low complexity region	260	271	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000138832; Gene: ENSMUSG00000032228; AA Change: K106*

Domain	Start	End	E-Value	Type
PDB:4JOL|H	173	196	6e-8	PDB
low complexity region	204	215	N/A	INTRINSIC
low complexity region	252	268	N/A	INTRINSIC
low complexity region	348	359	N/A	INTRINSIC
low complexity region	554	568	N/A	INTRINSIC
HLH	603	656	7.54e-10	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000139364; Gene: ENSMUSG00000032228; AA Change: K110*

Domain	Start	End	E-Value	Type
PDB:4JOL|H	177	200	7e-8	PDB
low complexity region	208	219	N/A	INTRINSIC
low complexity region	256	272	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
low complexity region	558	572	N/A	INTRINSIC
HLH	607	660	7.54e-10	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000138925; Gene: ENSMUSG00000032228; AA Change: K110*

Domain	Start	End	E-Value	Type
PDB:4JOL|H	177	200	7e-8	PDB
low complexity region	208	219	N/A	INTRINSIC
low complexity region	256	272	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
low complexity region	534	548	N/A	INTRINSIC
HLH	583	636	7.54e-10	SMART

• Predicted Effect: probably null
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:35 PM by Diantha La Vine
• Record Created: 2018-07-18 2:32 PM by Bruce Beutler
• Record Posted: 2018-12-05
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_011544 (variant 1), NM_001253862 (variant 2), NM_001253863 (variant 3), NM_001253864 (variant 4), NM_001253865 (variant 5); MGI:101877

Alleles Listed at MGI

All Mutations and Alleles(40) : Chemically induced (other)(1) Endonuclease-mediated(1) Gene trapped(35) Targeted(3)

Phenotypic Description

Figure 1. Poorly mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The poorly phenotype was identified among G3 mice of the pedigree R6240, some of which showed increased frequencies of CD8+ T cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased CD8+ T cell frequency using a dominant/additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 63 mutations (X-axis) identified in the G1 male of pedigree R6240. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 63 mutations. The increased CD8+ T cell frequency phenotype was linked by continuous variable mapping to a mutation in Tcf12:  an A to T transversion at base pair 71,944,016 (v38) on chromosome 9, or base pair 111,405 in the GenBank genomic region NC_000075.  Linkage was found with an additive/dominant model of inheritance, wherein 23 heterozygous mice departed phenotypically from 26 homozygous reference mice with a P value of 3.729 x 10^-7 (Figure 2); no homozygous variant mice were alive at time of screening.  

The mutation corresponds to residue 594 in the mRNA sequence NM_011544 within exon 6 of 21 total exons.

579 TCAAATCTGATAGGGAAAACATCAGAGAGAGGC 105 -S--N--L--I--G--K--T--S--E--R--G-

The mutated nucleotide is indicated in red. The mutation results in substitution of lysine 110 for a premature stop codon (K110*) in the HEB protein.

Protein Prediction

Figure 3. Domain organization of HEB. The Poorly mutation results in substitution of lysine 110 for a premature stop codon. Click on other mutations to view additional information. Abbreviations: AD1 and AD2, activation domain 1 and 2, respectively; LZ, leucine zipper; bHLH, basic helix-loop-helix

Figure 4. Crystal structure of basic-helix-loop-helix domains of the E47/NeuroD1 heterodimer bound to DNA. UCSF Chimera model is based on PDB 2QL2, Longo et al. Biochemistry. 47, 218-229 (2008). Click on the 3D structure to view it rotate.

Tcf12 encodes HeLa E-box binding protein (HEB; alternatively, helix-loop-helix transcription factor-4 [HTF4] or ME1), a member of the class I basic helix-loop-helix (bHLH) transcription factor family. The class I bHLH proteins also include E2A (E47/E12; alternatively, TCF-3) and E2-2 (alternatively, TCF-4). See the Background section for more information about E protein function. Class I bHLH transcription factors recognize the E box (sequence: CANNTG) in target DNA and are designated as E proteins. E box sites are found in several B and T lineage-specific genes, including the immunoglobulin loci, the T cell receptor (TCR) α and β loci, mb-1, λ5, and pre-Tα genes, and the CD4 silencer and enhancer elements.

E proteins have several similar domains, including a C-terminal bHLH domain and two transcriptional activation domains (AD1 and AD2) [Figure 3; (1); reviewed in (2)]. HEB also has a leucine zipper. The bHLH domains facilitate the dimerization of bHLH proteins, which is required for their transcriptional activity [reviewed in (2)]. The bHLH domain also facilitates interaction with p300, a component of the transcriptional machinery (3). P300 subsequently recruits histone acetyltransferases and RNA polymerase II to the promoter or enhancers of target genes. The crystal structure of the bHLH domain of an E47/NeuroD1 heterodimer has been solved [Figure 4; PDB:2QL2; (4;5)].  The E47/NeuroD1 dimer forms a parallel, four-helix bundle which allows the basic region to contact the major groove of DNA. Residues in the loop and helix two make contact with DNA. Each monomer interacts with either a CAC or CAG half-site within the E-box on the target DNA. A glutamate in the basic region of each monomer makes contact with cytosine and adenine bases in the DNA; an adjacent arginine stabilizes the glutamate. Both the glutamate and the arginine residues are conserved in most bHLH proteins (6).

The AD1 domain recruits the SAGA chromatin remodeling complex as well as the CBP and p300 histone acetyltransferases (7). The AD1 domain also represses transcription by recruiting a family of corepressors called ETO (8). The AD2 domain can drive the expression of reporter constructs containing bHLH target genes (7).

TCF12 has two transcription start sites and undergoes alternatively splicing to produce a shorter HEB variant, HEBalt (9). HEBalt lacks the AD1 domain, but shares the AD2 and bHLH domain with canonical HEB. HEBAlt has a unique domain, the Alt domain, upstream of AD2 compared to canonical HEB. HEBalt is expressed in pro-T cells and enhances the generation of T cell precursors. TCF12 also has two alternative acceptor sites preceding the second exon, which produces two distinct transcripts, HTF4a and HTF4b (10). HTF4a and HTF4b differ in their 5’-UTR, but share identical coding sequences. A cell-type specific protein, HTF4c, is produced by differential utilization of exon 15.

The poorly mutation results in substitution of lysine 110 for a premature stop codon (K110*) in the HEB protein; Lys110 is within the AD1 domain.

Expression/Localization

TCF12 is expressed at varying levels in several human cell lines and tissues (11). Tcf12 is expressed in the embryonic midbrain throughout development, but is not expressed in adult neurons (12).

Background

Figure 5. Regulation of T and B cell development by HEB.

Development of αβ thymocytes into mature T cells occurs in the thymus through a differentiation program characterized by the expression of certain cell-surface markers including CD4 (see the record for thoth), CD8 (see the record for alfalfa [Cd8a] and Carlsbad [Cd8b1]), CD44 (see the record for Jialin) and CD25 [Figure 5; reviewed in (13)].  The most immature stage of thymocyte development is known as the double negative (DN) stage due to the lack of expression of CD4 and CD8.  Differentiation proceeds through several stages known as DN1-4 that differentiate in the following order: CD44⁺CD25^- (DN1) to CD44⁺CD25⁺ (DN2) to CD44^-CD25⁺ (DN3) to CD44^-CD25^- (DN4).  The DN3 stage is the first critical checkpoint during thymocyte development.  Progression and expansion past DN3 requires surface expression of the product of a productive chromosomally rearranged TCRβ chain, which pairs with an invariant pre-TCRα chain and then forms a complex with CD3 and TCRζ.  This complex, known as the pre-TCR, produces a TCR-like signal that requires Lck (see the record for iconoclast) and Fyn and is necessary for continued survival (14;15).  Interestingly, this stage does not require CD4 or CD8 (16).  After progressing through the DN4 stage, αβ thymocytes express both CD4 and CD8 and are known as double positive (DP) cells.  Progression past this state to single positive CD4 or CD8 cells requires a TCR signal that occurs through a newly rearranged TCRα chain and the previously expressed TCRβ chain.  The strength of interaction of the final TCRαβ receptor to self-MHC molecules expressed on stromal or APCs in the thymus determines whether or not thymocytes are positively selected and survive to become a single positive (SP) CD4 or CD8 T cell.  Strong interactions and increased TCR signaling likely represents autoreactivity and results in negative selection, while moderate interactions indicates usefulness of the TCR and results in positive selection.  Cells that are unable to effectively bind MHC are eliminated.  Interestingly, CD4 associates more strongly with Lck than does CD8 and fusing the transmembrane/cytoplasmic domains of CD4 to the extracellular domain of CD8 diverted a transgenic MHC-I-restricted TCR into the CD4 lineage suggesting that the TCR signal in CD4⁺ T cells is different and stronger than the one in CD8⁺ T cells (17).  Increasing Lck activity in transgenic mice is sufficient to promote CD4 commitment and, conversely, decreasing Lck activity can promote CD8 commitment (18;19).  CD4⁺ cells become several distinct subsets of T cells including T helper cell subsets Th1, Th2, Th3, Th17 and follicular helper (T_FH) cells (please see the record for sanroque), as well as T_regs.  Th cells are involved in activating and directing other immune cells such as B cells, macrophages, and neutrophils by producing specific cytokines, while T_regs are important for suppressing autoimmune responses (20), and express the transcription factor FOXP3 (see the record for crusty) (21). 

HEB and E2A regulate lymphocyte development and differentiation. E2A and HEB form homo- or heterodimers to activate the transcription of target genes. E2A homodimers are essential for B cell development, while E2A-HEB heterodimers are essential for T cell development (22). E2A and HEB cooperate to maintain DP T cell fate and to control the DP to SP transition until a functional alphabetaTCR is produced (23;24). HEB functions in TCRα and TCRβ gene rearrangement (25;26) as well as in the regulation of pTα (24;27;28) and CD4 (22) gene expression. HEB also putatively assists in the downregulation of IL7R signaling after β-selection. HEB is required for the development of CD73⁺ and CD73⁻ γδT17 cells in the fetal thymus (29). In addition HEB is required for the expression of Sox4, Sox13, and Rorc in immature CD24⁺CD73⁻ γδ T cells (29). HEB interacts with Notch1 and GATA3 to regulate T cell fate choice in developing thymocytes (30). HEB-deficient T cell precursors show compromised Notch1 function and lose T cell potential. After reconstitution of the HEB-deficient T cell precursors with Notch1, the cells adopted a DN1-like phenotype and could be induced to differentiate into thymic NK cells.

Although E2A primarily functions in B cell development, HEB and E2-2 also have roles in B cell development. Mice lacking either E2-2 or HEB can produce mature B cells, but they have reduced numbers of pro-B cells. This indicates that E2-2 and HEB promote cell survival at the pro-B stage (31).  HEB and E2A also work together to activate the expression of FOXO1 in common lymphoid progenitors (32). E2A and FOXO1 subsequently induce the expression of EBF1. EBF1 and FOXO1 establish a positive intergenic feedback circuitry to establish B cell identity (33). E2A, EBF1 and FOXO1 coordinately activate the expression of PAX5.

B cell progenitors first arise in fetal liver, then in bone marrow shortly after birth, and give rise to three major mature populations (34). Marginal zone (MZ) B cells localize to the splenic marginal zone and respond to blood-borne antigens independently of T cell help (35).  Follicular B cells, by contrast, respond to protein antigens in a T cell-dependent manner, and progressively undergo immunoglobulin isotype switching and affinity maturation. B-1 B cells comprise a much smaller population, which predominates in the pleural and peritoneal cavities and contributes most of the serum IgM during the early phases of infection (36).  Whereas MZ and B-1 B cells are predominantly self-renewing, follicular B cells require constant replenishment from bone marrow.  The development of B cells is characterized by the differential expression of marker proteins, and by the sequential recombination of the immunoglobulin gene loci [reviewed in (37)].  In the bone marrow, lymphoid progenitor cells or prepro-B cells receive signals from bone marrow stromal cells, such as interleukin 7 (IL-7) to begin B cell development.  The developmental of early B lymphopoiesis is regulated by a network of key transcription factors that include PU.1, Ikaros (see the record for star_lord), Bcl11a (a zinc finger transcription factor), E2A, EBF1 (early B cell factor; see the record for crater_lake) and the paired boxprotein, Pax5 (see the record for glacier) (38). Prepro-B cells become pro-B cells as they begin to rearrange their immunoglobulin heavy (IgH) chains in a process known as V(D)J recombination mediated by the RAG1 (recombination activating gene 1)-RAG2 complex (see the record for maladaptive [Rag1] and snowcock [Rag2]).  On the H chromosome, the diversity (D) and joining (J) gene segments are recombined together, and the cells transition into the early pro-B stage and express the CD45 (B220) marker (see the record for belittle).  Joining of a variable (V) segment to the D-J segment completes the late pro-B cell stage.  Successful VDJ recombination gives rise to the Igμ chain.  Two Igμ chains combine with two surrogate light chains (SLCs), composed of λ-5 and Vpre5.  Association with the signaling subunits Igα and Igβ completes the pre-B cell receptor (BCR) complex.  Cells expressing the pre-BCR are competent for pre-BCR signaling, which initiates proliferation, further differentiation, and eventually downregulates expression of the pre-BCR.  Cycling B cells expressing the pre-BCR complex are known as large pre-B cells.  Large pre-B cells downregulate both the B cell marker CD43 as well as the pre-BCR to become non-cycling small pre-B cells.  At this stage rearrangement of the immunologlobin light (IgL) chain by the RAG1-RAG2 complex occurs to form the BCR (or surface IgM) characteristic of immature B cells.  These cells leave the bone marrow to further mature in the spleen. 

HEB has several functions in addition to its function in lymphocyte development: (i) HEB functions in early cell-fate determination and subset specification of midbrain dopamine neurons (12). (ii) HEB is a signaling cofactor with SMAD2/3 and FOXH1 during mesendoderm differentiation (39). Loss of HEB expression in human embryonic stem cells resulted in mesodermal development defects as well as reduced expression of regulators of mesoendodermal fate choices (40). Mesoderm-derived hemogenic endothelium formation and T cell development were aberrant. (iii) HEB mediates bone marrow mesenchymal stem cell osteogenic differentiation (41). HEB downregulation is essential for osteoblast differentiation via the bone morphogenetic protein (BMP) and ERK1/2 signaling pathways. (iv) HEB synergizes with the bHLH transcription factors MyoD, ITF2, and E12 to induce myogenic differentiation through the regulation of myogenin expression in proliferating myoblasts (42;43).

Mutations in TCF12 are linked to craniosynostosis-3 (OMIM: # 615314) (44). Craniosynostosis is a skull growth abnormality in which the cranial sutures prematurely fuse. As a result, the growth velocity of the skull often cannot match that of the developing brain. Craniosynostosis-3 includes coronal, sagittal, and multisuture forms.

Putative Mechanism

Tcf12-deficient (Tcf12^-/-) mice on the 129/Sv * C57BL/6 genetic background exhibited postnatal lethality within two weeks of birth (31). Tcf12^-/- mice showed a 50 percent reduction in the number of pro-B cells (31). Tcf12^-/- mice on the 129S7/SvEvBrd genetic background showed reduced thymocyte numbers due to a block in T cell development at the immature single positive stage (45). Tcf12^-/- mice on the 129S7/SvEvBrd * C57BL/6J genetic background showed thymus hypoplasia, increased numbers of double-negative T cells and CD8+ T cells with a concomitant reduction in the number of double-positive T cells (46). A Tcf12 mutant (HEB^bm/bm) mouse with point mutations within the basic DNA-binding region (R611G, L612H, R613G) showed postnatal lethality within two weeks of birth and postnatal growth retardation (45). Some fetuses showed exencephaly. The HEB^bm/bm mice also showed thymus hypoplasia; reduced thymocyte numbers; impaired B cell differentiation with reduced immature B cell, pro-B cell, and pre-B cell numbers; and aberrant T cell differentiation (i.e., severe block at the DN3 stage of T-cell development) with increased double-negative T cell number, reduced double-positive T cell number, and loss of single-positive T cells in the thymus (45). Approximately 10 to 20 percent of HEB^bm/+ mice showed seizure episodes upon handling by the tail (45).

The phenotypes observed in the Poorly mice mimic that of the HEB^bm/bm mice, indicating loss of HEB-associated function in B and T cell development.

Primers

PCR Primer
Poorly_pcr_F: GGAATAGGTGAGAACTTATTTCCAGAC
Poorly_pcr_R: TGCTTCAGTGTTCAGTCGTC

Sequencing Primer
Poorly_seq_F: CCAGACATAAGATGCATTTAGAAAGC
Poorly_seq_R: AAATATGTGTGAATGTCCTCTGTGAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 603 nucleotides is amplified (chromosome 9, - strand):

1   tgcttcagtg ttcagtcgtc tctgtctctg ctgttctcat ttctgagaga aataaaaaca
61  tccattttga agtaaatatg tgtgaatgtc ctctgtgagt tatattgttc actatttagg
121 tgtcaattct ttattctttt ggcagtattt tcagtgatga cacatttatg atcaagtatt
181 tactgagaat agaatgaata ggttttaagc tgaattgtct atcaatgaaa tttttataca
241 aagttgtttt cttggtttta tagggaaaac atcagagaga ggctcatttt ccctgtacag
301 cagagactct ggactctcag gctgtcaggt aagtttagtg aagtttacac ttacataatg
361 atagagaaga tagaagttta tctacatgat ttcaccatta tgtattcata ttattttgtg
421 acttcgtgtg attgggttgt tttgttttta gcagctcaac atatcttttc attgttccat
481 cttgagatgg tttcctttct tcaattgaat tttcttaact tccatttaat gggagacaaa
541 gtagaaaagt ttctctgctt tctaaatgca tcttatgtct ggaaataagt tctcacctat
601 tcc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Aronheim, A., Shiran, R., Rosen, A., and Walker, M. D. (1993) The E2A Gene Product Contains Two Separable and Functionally Distinct Transcription Activation Domains. Proc Natl Acad Sci U S A. 90, 8063-8067.

  2. Belle, I., and Zhuang, Y. (2014) E Proteins in Lymphocyte Development and Lymphoid Diseases. Curr Top Dev Biol. 110, 153-187.

  3. Eckner, R., Yao, T. P., Oldread, E., and Livingston, D. M. (1996) Interaction and Functional Collaboration of p300/CBP and bHLH Proteins in Muscle and B-Cell Differentiation. Genes Dev. 10, 2478-2490.

  4. Longo, A., Guanga, G. P., and Rose, R. B. (2008) Crystal Structure of E47-NeuroD1/beta2 bHLH Domain-DNA Complex: Heterodimer Selectivity and DNA Recognition. Biochemistry. 47, 218-229.

  5. Ellenberger, T., Fass, D., Arnaud, M., and Harrison, S. C. (1994) Crystal Structure of Transcription Factor E47: E-Box Recognition by a Basic Region Helix-Loop-Helix Dimer. Genes Dev. 8, 970-980.

  6. Murre, C., McCaw, P. S., and Baltimore, D. (1989) A New DNA Binding and Dimerization Motif in Immunoglobulin Enhancer Binding, Daughterless, MyoD, and Myc Proteins. Cell. 56, 777-783.

  7. Massari, M. E., Grant, P. A., Pray-Grant, M. G., Berger, S. L., Workman, J. L., and Murre, C. (1999) A Conserved Motif Present in a Class of Helix-Loop-Helix Proteins Activates Transcription by Direct Recruitment of the SAGA Complex. Mol Cell. 4, 63-73.

  8. Zhang, J., Kalkum, M., Yamamura, S., Chait, B. T., and Roeder, R. G. (2004) E Protein Silencing by the Leukemogenic AML1-ETO Fusion Protein. Science. 305, 1286-1289.

  9. Wang, D., Claus, C. L., Vaccarelli, G., Braunstein, M., Schmitt, T. M., Zuniga-Pflucker, J. C., Rothenberg, E. V., and Anderson, M. K. (2006) The Basic Helix-Loop-Helix Transcription Factor HEBAlt is Expressed in Pro-T Cells and Enhances the Generation of T Cell Precursors. J Immunol. 177, 109-119.

  10. Gan, T. I., Rowen, L., Nesbitt, R., Roe, B. A., Wu, H., Hu, P., Yao, Z., Kim, U. J., O'Sickey, T., and Bina, M. (2002) Genomic Organization of Human TCF12 Gene and Spliced mRNA Variants Producing Isoforms of Transcription Factor HTF4. Cytogenet Genome Res. 98, 245-248.

  11. Zhang, Y., Flejter, W. L., Barcroft, C. L., Riviere, M., Szpirer, J., Szpirer, C., and Bina, M. (1995) Localization of the Human HTF4 Transcription Factors 4 Gene (TCF12) to Chromosome 15q21. Cytogenet Cell Genet. 68, 235-238.

  12. Mesman, S., and Smidt, M. P. (2017) Tcf12 is Involved in Early Cell-Fate Determination and Subset Specification of Midbrain Dopamine Neurons. Front Mol Neurosci. 10, 353.

  13. Palacios, E. H., and Weiss, A. (2004) Function of the Src-Family Kinases, Lck and Fyn, in T-Cell Development and Activation. Oncogene. 23, 7990-8000.

  14. Groves, T., Smiley, P., Cooke, M. P., Forbush, K., Perlmutter, R. M., and Guidos, C. J. (1996) Fyn can Partially Substitute for Lck in T Lymphocyte Development. Immunity. 5, 417-428.

  15. van Oers, N. S., Lowin-Kropf, B., Finlay, D., Connolly, K., and Weiss, A. (1996) Alpha Beta T Cell Development is Abolished in Mice Lacking both Lck and Fyn Protein Tyrosine Kinases. Immunity. 5, 429-436.

  16. Sohn, S. J., Forbush, K. A., Pan, X. C., and Perlmutter, R. M. (2001) Activated p56lck Directs Maturation of both CD4 and CD8 Single-Positive Thymocytes. J Immunol. 166, 2209-2217.

  17. Seong, R. H., Chamberlain, J. W., and Parnes, J. R. (1992) Signal for T-Cell Differentiation to a CD4 Cell Lineage is Delivered by CD4 Transmembrane Region and/or Cytoplasmic Tail. Nature. 356, 718-720.

  18. Hernandez-Hoyos, G., Sohn, S. J., Rothenberg, E. V., and Alberola-Ila, J. (2000) Lck Activity Controls CD4/CD8 T Cell Lineage Commitment. Immunity. 12, 313-322.

  19. Legname, G., Seddon, B., Lovatt, M., Tomlinson, P., Sarner, N., Tolaini, M., Williams, K., Norton, T., Kioussis, D., and Zamoyska, R. (2000) Inducible Expression of a p56Lck Transgene Reveals a Central Role for Lck in the Differentiation of CD4 SP Thymocytes. Immunity. 12, 537-546.

  20. Wan, Y. Y. (2010) Multi-Tasking of Helper T Cells. Immunology. 130, 166-171.

  21. Fontenot, J. D., Gavin, M. A., and Rudensky, A. Y. (2003) Foxp3 Programs the Development and Function of CD4+CD25+ Regulatory T Cells. Nat Immunol. 4, 330-336.

  22. Sawada, S., and Littman, D. R. (1993) A Heterodimer of HEB and an E12-Related Protein Interacts with the CD4 Enhancer and Regulates its Activity in T-Cell Lines. Mol Cell Biol. 13, 5620-5628.

  23. Jones, M. E., and Zhuang, Y. (2007) Acquisition of a Functional T Cell Receptor during T Lymphocyte Development is Enforced by HEB and E2A Transcription Factors. Immunity. 27, 860-870.

  24. Wojciechowski, J., Lai, A., Kondo, M., and Zhuang, Y. (2007) E2A and HEB are Required to Block Thymocyte Proliferation Prior to Pre-TCR Expression. J Immunol. 178, 5717-5726.

  25. D'Cruz, L. M., Knell, J., Fujimoto, J. K., and Goldrath, A. W. (2010) An Essential Role for the Transcription Factor HEB in Thymocyte Survival, Tcra Rearrangement and the Development of Natural Killer T Cells. Nat Immunol. 11, 240-249.

  26. Langerak, A. W., Wolvers-Tettero, I. L., van Gastel-Mol, E. J., Oud, M. E., and van Dongen, J. J. (2001) Basic Helix-Loop-Helix Proteins E2A and HEB Induce Immature T-Cell Receptor Rearrangements in Nonlymphoid Cells. Blood. 98, 2456-2465.

  27. Takeuchi, A., Yamasaki, S., Takase, K., Nakatsu, F., Arase, H., Onodera, M., and Saito, T. (2001) E2A and HEB Activate the Pre-TCR Alpha Promoter during Immature T Cell Development. J Immunol. 167, 2157-2163.

  28. Tremblay, M., Herblot, S., Lecuyer, E., and Hoang, T. (2003) Regulation of pT Alpha Gene Expression by a Dosage of E2A, HEB, and SCL. J Biol Chem. 278, 12680-12687.

  29. In, T. S. H., Trotman-Grant, A., Fahl, S., Chen, E. L. Y., Zarin, P., Moore, A. J., Wiest, D. L., Zuniga-Pflucker, J. C., and Anderson, M. K. (2017) HEB is Required for the Specification of Fetal IL-17-Producing Gammadelta T Cells. Nat Commun. 8, 2004-017-02225-5.

  30. Braunstein, M., and Anderson, M. K. (2011) HEB-Deficient T-Cell Precursors Lose T-Cell Potential and Adopt an Alternative Pathway of Differentiation. Mol Cell Biol. 31, 971-982.

  31. Zhuang, Y., Cheng, P., and Weintraub, H. (1996) B-Lymphocyte Development is Regulated by the Combined Dosage of Three Basic Helix-Loop-Helix Genes, E2A, E2-2, and HEB. Mol Cell Biol. 16, 2898-2905.

  32. Welinder, E., Mansson, R., Mercer, E. M., Bryder, D., Sigvardsson, M., and Murre, C. (2011) The Transcription Factors E2A and HEB Act in Concert to Induce the Expression of FOXO1 in the Common Lymphoid Progenitor. Proc Natl Acad Sci U S A. 108, 17402-17407.

  33. Mansson, R., Welinder, E., Ahsberg, J., Lin, Y. C., Benner, C., Glass, C. K., Lucas, J. S., Sigvardsson, M., and Murre, C. (2012) Positive Intergenic Feedback Circuitry, Involving EBF1 and FOXO1, Orchestrates B-Cell Fate. Proc Natl Acad Sci U S A. 109, 21028-21033.

  34. Hardy, R. R., and Hayakawa, K. (2001) B Cell Development Pathways. Annu Rev Immunol. 19, 595-621.

  35. Lopes-Carvalho, T., Foote, J., and Kearney, J. F. (2005) Marginal Zone B Cells in Lymphocyte Activation and Regulation. Curr Opin Immunol. 17, 244-250.

  36. Tung, J. W., and Herzenberg, L. A. (2007) Unraveling B-1 Progenitors. Curr Opin Immunol. 19, 150-155.

  37. Herzog, S., Reth, M., and Jumaa, H. (2009) Regulation of B-Cell Proliferation and Differentiation by Pre-B-Cell Receptor Signalling. Nat Rev Immunol. 9, 195-205.

  38. Fuxa, M., and Skok, J. A. (2007) Transcriptional Regulation in Early B Cell Development. Curr Opin Immunol. 19, 129-136.

  39. Yoon, S. J., Wills, A. E., Chuong, E., Gupta, R., and Baker, J. C. (2011) HEB and E2A Function as SMAD/FOXH1 Cofactors. Genes Dev. 25, 1654-1661.

  40. Li, Y., Brauer, P. M., Singh, J., Xhiku, S., Yoganathan, K., Zuniga-Pflucker, J. C., and Anderson, M. K. (2017) Targeted Disruption of TCF12 Reveals HEB as Essential in Human Mesodermal Specification and Hematopoiesis. Stem Cell Reports. 9, 779-795.

  41. Yi, S., Yu, M., Yang, S., Miron, R. J., and Zhang, Y. (2017) Tcf12, A Member of Basic Helix-Loop-Helix Transcription Factors, Mediates Bone Marrow Mesenchymal Stem Cell Osteogenic Differentiation in Vitro and in Vivo. Stem Cells. 35, 386-397.

  42. Parker, M. H., Perry, R. L., Fauteux, M. C., Berkes, C. A., and Rudnicki, M. A. (2006) MyoD Synergizes with the E-Protein HEB Beta to Induce Myogenic Differentiation. Mol Cell Biol. 26, 5771-5783.

  43. Hu, J. S., Olson, E. N., and Kingston, R. E. (1992) HEB, a Helix-Loop-Helix Protein Related to E2A and ITF2 that can Modulate the DNA-Binding Ability of Myogenic Regulatory Factors. Mol Cell Biol. 12, 1031-1042.

  44. Sharma, V. P., Fenwick, A. L., Brockop, M. S., McGowan, S. J., Goos, J. A., Hoogeboom, A. J., Brady, A. F., Jeelani, N. O., Lynch, S. A., Mulliken, J. B., Murray, D. J., Phipps, J. M., Sweeney, E., Tomkins, S. E., Wilson, L. C., Bennett, S., Cornall, R. J., Broxholme, J., Kanapin, A., 500 Whole-Genome Sequences (WGS500) Consortium, Johnson, D., Wall, S. A., van der Spek, P. J., Mathijssen, I. M., Maxson, R. E., Twigg, S. R., and Wilkie, A. O. (2013) Mutations in TCF12, Encoding a Basic Helix-Loop-Helix Partner of TWIST1, are a Frequent Cause of Coronal Craniosynostosis. Nat Genet. 45, 304-307.

  45. Barndt, R. J., Dai, M., and Zhuang, Y. (2000) Functions of E2A-HEB Heterodimers in T-Cell Development Revealed by a Dominant Negative Mutation of HEB. Mol Cell Biol. 20, 6677-6685.

  46. Wikstrom, I., Forssell, J., Penha-Goncalves, M. N., Bergqvist, I., and Holmberg, D. (2008) A Role for E2-2 at the DN3 Stage of Early Thymopoiesis. Mol Immunol. 45, 3302-3311.