Phenotypic Mutation 'cardigan'

• Allele: cardigan
• Mutation Type: synonymous
• Chromosome: 15
• Coordinate: 11,022,172 bp (GRCm38)
• Base Change: C ⇒ A (forward strand)
• Gene: Slc45a2
• Gene Name: solute carrier family 45, member 2
• Synonym(s): blanc-sale, Oca4, dominant brown, Dbr, bls, Aim1, Aim-1, Matp
• Chromosomal Location: 11,000,721-11,029,233 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009] ; PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P58355
• SMART Domains: Protein: ENSMUSP00000112408; Gene: ENSMUSG00000022243

Domain	Start	End	E-Value	Type
Pfam:MFS_2	1	457	2e-22	PFAM
Pfam:MFS_1	2	292	2.6e-12	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.102)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• Last Updated: 2019-04-23 7:48 PM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2008-04-15
• Science Writers: Nora G. Smart
• Illustrators: Nora G. Smart, Diantha La Vine
• Authors: Amanda L. Blasius, Bruce Beutler

Accession Number

NCBI RefSeq: NM_053077; MGI: 2153040

Alleles Listed at MGI

All alleles(11) : Targeted, other(1) Spontaneous(5) Chemically induced(5)

Repository

none

Phenotypic Description

The cardigan mutation was induced by ENU mutagenesis on the C57BL/6J (black) background, and was discovered in G3 animals.  Homozygous mutant mice exhibit a "dirty white" coat color associated with a light ocular albinism (Figure 1).  Newborn mutants have very light-colored skin and eyes in comparison with their heterozygote littermates.  Their eyes darken during development until only a light red glint remains in adults.  Cardigan mutants are viable and fertile.  Cardigan mutants bear a strong resemblance to galak, sweater, and grey goose mutant animals.

 

Nature of Mutation

The cardigan mutation was mapped to Chromosome 15, and corresponds to a C to A transversion at position 1094 of the Slc45a2 transcript, in exon 4 of 7 total exons.

 

1078 TGGACTGCCTTCCTGTCAAACATGCTCTTCTTC

328  -W--T--A--F--L--S--N--M--L--F--F-

 

The mutated nucleotide is indicated in red lettering, and creates a premature stop codon at codon 333 (normally a serine) deleting 297 amino acids from the C-terminus of the protein.

Protein Prediction

Figure 2. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. The cardigan mutation creates a premature stop codon at codon 333 (normally a serine) deleting 297 amino acids from the C-terminus of the protein. This image is interactive. Click on the mutations for more specific information.

The mouse SLC45A2 (solute carrier family 45, member 2) or MATP (membrane associated transporter protein) protein contains 530 residues and is 82% identical to human SLC45A2 located on Chromosome 5 (1). 

 

SLC45A2 is a 55kD protein with 12 membrane-spanning domains (Figure 2).  Homologues are present in all vertebrates with a high level of conservation between fish and mouse (2), and even higher between mouse and human (1).  SLC45A2 proteins are similar to sucrose/proton transporters found in plants (1;2), especially to the plant transporters belonging to the SUC3/SUT2 groups (named for Arabidopsis thaliana sucrose transporter 3, and Lycopersicon esculentum sucrose transporter 2) (3).  SLC45A2 transporters are distinguished by an elongated N-terminus, and by an enlarged cytoplasmic loop between transmembrane domains six and seven.  They also have higher Km values for sucrose uptake relative to other plant sucrose transporters (3).  Sucrose transporters are known to transport other sugars besides sucrose, and may even catalyze biotin uptake across the membrane (3).  SLC45A2 proteins include a region found in all plant sucrose/proton symporters known as the sucrose-transporter signature sequence, R-X-G-R-[K/R], located between transmembrane domains two and three (1-4).  The aspartate residue located in the fourth transmembrane domain of all sucrose transporters is also found in SLC45A2 (2).  The N and C-terminal domains of SLC45A2 are predicted to be on the cytoplasmic side of the membrane along with the loops between transmembrane domains two and three, four and five, six and seven, eight and nine, and ten and eleven (1;2).  The transmembrane domains of sucrose transporters are predicted to form alpha-helices (3;4).

 

The cardigan mutation results in protein truncation after amino acid 333, located in the seventh transmembrane domain of the SLC45A2 protein.  It is unknown whether normal levels of the altered SLC45A2 protein exist in cardigan mice.

Expression/Localization

In situ hybridization analysis demonstrates expression of murine Slc45a2 in the presumptive retinal pigmented epithelium (RPE) starting at embryonic day (E) 9.5, and in neural crest-derived melanoblasts (melanocyte precursor cells) starting at E10.5.  The in vivo cellular expression pattern of Slc45a2 at E9.5–E11.5 has a distribution similar to that of dopachrome tautomerase (Dct), an enzyme involved in melanin synthesis often used as a marker for melanoblasts (5), consistent with Slc45a2 expression in pigment cell precursors.  Slc45a2 expression at E9.5 is observed at the dorsal edge of the optic vesicle, the presumptive RPE.  At E10.5, Slc45a2 expression continues in the presumptive RPE, and is also seen in rostral, neural crest-derived melanoblasts.  This expression pattern continues at E11.5 (6).

 

Human SLC45A2 mRNA is expressed at high levels in most melanoma and melanocyte cell lines, but not in other tissues (7).  However, expressed sequence tags (ESTs) of both mouse and human SLC45A2 are present in kidney and uterus cDNA libraries, suggesting some expression of SLC45A2 in these tissues (2).

 

The subcellular localization of the SLC45A2 protein has not been determined.

Background

Figure 3. Premelanosomes arise from the late secretory or endosomal pathway. Stage 1 premelanosomes (depicted here as "Early endosome/Stage I" for simplicity) lacking pigment are thought to correspond to the coated endosome, an intermediate between early and late endosomes densely coated on one face with clathrin. PMEL17, a structural component of the melanosome on which melanins are deposited (not depicted) accumulates in stage I and II; PMEL17 is masked by melanin in later stages. Melanin synthesis begins in Stage II premelanosomes that contain regular arrays of parallel fibers that give these organelles a striated appearance by electron microscopy. During Stage III, these fibers gradually darken and thicken (red arrows, inset) as eumelanin is deposited along them, such that by Stage IV no striations are visible and the melansome is filled with melanin; this action has been illustrated in the inset. All cargoes required for melanin synthesis, processing, and transport (OCA2, SLC45A2, Rab32, Rab38, DCT (alternatively, Tyrp2), Tyr, and Tyrp1) derive from the Golgi and traverse vacuolar and/or tubular elements (not shown) of early endosomes en route to the stage III melanosome. Adaptor protein-3 and -1 as well as biogeneisis of lysosome-related organelle complex-1 (BLOC-1) and BLOC-2 regulate the intracellular trafficking of Tyrp1. SLC45A2 and OCA2 function in the trafficking of Tyrp1 and DCT to melanosomes. OCA2 maintains the proper pH in the melanosomes and transports glutathione, a protein necessary for Tyr and Tyrp1 trafficking to melanosomes. Black arrows represent transport of vesicles; red arrows represent protein-mediated regulation at a specific transport step as indicated in the key. Slc45a2 expression is regulated by the microphthalmia transcription factor (MITF). The image is interactive, click to reveal mutations in several of the proteins. Several mouse models with mutations in components of the pigment-producing pathway are shown below; the mutation name (black) and mutated gene (red) are indicated. The melanosome pathway has been adapted from several sources including: Raposo, G. and Marks, M.S. (2007), Nat. Rev. Mol. Cell Biol., 8:786 and Lakkaraju, A. et al. (2009), J. Cell Biol., 187:161.

The SLC45A2 gene was independently discovered as encoding a melanocyte differentiation antigen expressed in a high percentage of melanoma cell lines (7), and a transporter protein critical for normal pigmentation in medaka fish, mice, and humans (1;2).  In mice, the underwhite (uw) gene encodes the SLC45A2 protein (1;8).  Uw mutants display variable levels of pigmentation in their skin, hair, and eyes, which range from nearly white with dark red eyes for homozygous underwhite mice, light beige with darker eyes for homozygous underwhite dominant brown (Uw^dbr) mice, to dark brown and dark eyes for heterozygous Uw^dbrand underwhite dense (uw^d) animals (9).

 

Initial studies of mice with uw mutations found defects in the melanosomes of these animals.  Melanosomes are endolysosomal-like organelles in which melanin is synthesized and stored (Figure 3).  They are present in pigmented cells including melanocytes and retinal pigmented epithelial cells (10).  Uw melanosomes are irregular in shape, reduced in size, and less mature than their wild-type counterparts.  The irregular shape of the melanosomes suggests that the protein encoded by the uw gene is important in melanosome biogenesis where it might play a structural role (9).  The semidominant nature of the Uw^db allele is also consistent with a structural role for the SLC45A2 protein.  Underwhite mutations reduce the levels of eumelanin (black/brown) pigment specifically by causing a reduction in levels of tyrosinase protein and activity (11;12).  Low tyrosinase activity favors pheomelanin (yellow/red) pigment production (13), whereas complete absence of tyrosinase activity results in absence of both eumelanin and pheomelanin (as in ghost mutants).  These phenotypes are remarkably similar to the phenotypes seen in mice mutant for Oca2, which also encodes a putative transporter protein (14;15) (mutated in quicksilver, charbon, snowflake, whitemouse, and faded).  Similar to the OCA2 protein, SLC45A2 appears to be necessary for the processing and trafficking of tyrosinase and other proteins to the melanosomes.  In vitro, uw melanocytes process tyrosinase and other melanosomal proteins normally through the endoplasmic reticulum (ER) and the Golgi apparatus, but subsequent intracellular trafficking to the melanosomes is aberrant.  Significant amounts of melanogenic enzymes including tyrosinase, tyrosine-related protein 1 (Tyrp1; see the record for chi) and dopachrome tautomerase (DCT) are aberrantly secreted from mutant melanocytes in vesicles and immature melanosomes, so that melanin fails to be produced intracellularly in mature melanosomes (12).  Neither the SLC45A2 nor OCA2 proteins seem to be present in early-stage melanosomes, suggesting these transporters function in intracellular trafficking of melanosomal proteins prior to this stage (16).  Slc45a2 expression appears to be indirectly regulated by the key transcriptional regulator of melanocyte development, the microphthalmia transcription factor (MITF).  Overexpression of MITF in melanoma cells results in an increase in Slc45a2 expression, while Slc45a2 expression is absent in MITF-deficient mice (6;8).  MITF is known to regulate the transcription of tyrosinase, Tyrp1, and Dct, as well as kit, which is necessary for melanocyte migration (mutated in Casper and Pretty2) (17).

 

In humans, mutations in SLC45A2 cause oculocutaneous albinism type 4 (OCA4, OMIM #606574), which affects approximately 1/20,000 people worldwide (1;18-20).  Oculocutaneous albinism in humans is a recessive, genetically heterogeneous congenital disorder characterized by decreased or absent pigmentation in the hair, skin, and eyes.  Reduced melanin pigment in the skin and eyes results in an increased sensitivity to ultraviolet radiation, and a predisposition to skin cancer (21).  The reduction of melanin pigment in the eye during development leads to foveal hypoplasia and abnormal routing of the nerve fibers from the eye to the brain, resulting in nystagmus (rapid movements of the eyes), strabismus (lazy eye), reduced visual acuity, and loss of binocular vision (21;22).  Aside from mutations in SLC45A2, OCA is caused by mutations in several genes including tyrosinase (OCA1A, OMIM #203100 and OCA1B, OMIM #606952), tyrosinase-related protein 1 or Tyrp1 (OCA3, OMIM #203290 or red OCA, OMIM #278400), and the OCA2 or P gene (OCA2, OMIM #203200) (1;14;21;23;24).  Tyrp1 has a direct role in melanin synthesis and also stabilizes tyrosinase (10;25;26), while OCA2 is thought to play a role similar to that of SLC45A2 and is important for proper maturation, processing and trafficking of tyrosinase to post-Golgi melanosomes (10;12;14;27).  OCA, amongst other phenotypes, is also characteristic of Hermansky-Pudlak syndrome (OMIM #203300), and Chediak-Higashi syndrome (OMIM #214500).  Mutations in genes associated with these diseases cause a more generalized defect in protein trafficking resulting in defects in lysosome-related organelles including melanosomes (please see toffee, dorian gray, pam gray, minnie, stamper-coat, bullet gray, sooty, souris, and grey wolf) (28;29).  The range of phenotypes present in OCA4 patients is very similar to that found in OCA2 patients.  Both OCA2 and OCA4 are generally milder than OCA1.

 

Nearly 30 different mutations in the human SLC45A2 gene have been reported (1;18-20;30;31).  Among these, most of the missense mutations are located within or very close to the transmembrane domains, indicating that these areas are critical for the function of the SLC45A2 protein (18-20;31).  Similarly, most of the missense mutations detected in animal models of OCA4 are located within the transmembrane domains of the orthologous SLC45A2 proteins.  For example, the missense mutation D153N found in the cream coat color horse is within the fourth transmembrane domain (32).  The same amino acid change is found in the Uw^dbr allele of the mouse, suggesting that this residue is important for SLC45A2 function.  Additionally, the uw^d mouse mutation causes a S435P change in the tenth transmembrane domain (1;8).  In medaka fish, four mutations causing hypopigmentation are located within the eighth, ninth, and tenth transmembrane domains (2).  Polymorphisms in the human SLC45A2 gene are significantly associated with skin color variation (33;34).

Putative Mechanism

The cardigan mutation results in truncation of SLC45A2 in the seventh transmembrane domain.  Humans with SLC45A2 mutations causing protein truncation in the seventh or ninth transmembrane domains have very little pigmentation in their skin and eyes (18), much like cardigan homozygotes.  The classical underwhite mutation causes a frameshift and a premature stop codon at amino acid 308 in the seventh transmembrane domain (8).  These mice, like cardigan mutants, are nearly white with dark red eyes (9), and they do not express Slc45a2 mRNA (1). These results suggest that the truncated protein encoded by Slc45a2^cardigan would probably not be expressed, resulting in a functionally null allele of Slc45a2.

Primers

Primers cannot be located by automatic search.

Genotyping

Cardigan genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. This protocol has not been tested.

 

Primers for PCR amplification

Card(F): 5’- TTACTGGAGAGCAGGCACCTAGTC -3’

Card(R): 5’- GCCCCAGATGATGCAGTACCATTC- 3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Card_seq(F): 5’- CTCTGGTTGTCCAATGGAAAC -3’

Card_seq(R): 5’- AGATGATGCAGTACCATTCTCTGG -3’

 

The following sequence of 791 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Slc45a2) is amplified:

 

21057                                                              ttac
21061 tggagagcag gcacctagtc aaaggacagg gagttgaata gcaatctgtg ttagtttcct
21121 aaaacattac tacaaatgta acatccatca atcatcacac agttgtagtg gtcagaagtg
21181 ttggtgggct ctagtggatt ctcagctctg gttgtccaat ggaaaccaac atgtaatgtc
21241 ttatgagaga caagtgacag agacacagtc tggctgtggc tctgactctg actctgctga
21301 tgggtgcgta tctacactga acacctatgt tcttttgcca gagtcagagg acaatgtcga
21361 tgaagtcact ccttcgggca ttagtaaaca tgccttccca ttatcgctgc ctttgcgtca
21421 gccacctgat tggatggact gccttcctgt caaacatgct cttcttcaca gatttcatgg
21481 gacaggtaac ggatgcatat gcccacactc ttgtctggcc tgtgcaatag atatagcaaa
21541 gagtgccctc aagaagctgg tttacagtta cagttcaaga agtaggctgc tacacgctgt
21601 gaaacgaaat atcgtgcact actcaatcaa atacaataaa taaatgtaat caaattcaac
21661 gaatagacaa gagtaggttt gagagctgca gagccgtggc aagcttcatt aaaagcttgc
21721 aacccggtct tgaagggtga gtttcagaga taagagagaa tcctaagtgg aaacaggaat
21781 ggcatgtgct gaggtgagct ggaaggctgt tagctgtgcc agagaatggt actgcatcat
21841 ctggggc

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is shown in red text.

References

   1.  Newton, J. M., Cohen-Barak, O., Hagiwara, N., Gardner, J. M., Davisson, M. T., King, R. A., and Brilliant, M. H. (2001) Mutations in the human orthologue of the mouse underwhite gene (uw) underlie a new form of oculocutaneous albinism, OCA4, Am. J Hum. Genet 69, 981-988.

   2.  Fukamachi, S., Shimada, A., and Shima, A. (2001) Mutations in the gene encoding B, a novel transporter protein, reduce melanin content in medaka, Nat. Genet 28, 381-385.

   3.  Sauer, N. (2007) Molecular physiology of higher plant sucrose transporters, FEBS Lett 581, 2309-2317.

   4.  Lemoine, R. (2000) Sucrose transporters in plants: update on function and structure, Biochim. Biophys. Acta 1465, 246-262.

   5.  Steel, K. P., Davidson, D. R., and Jackson, I. J. (1992) TRP-2/DT, a new early melanoblast marker, shows that steel growth factor (c-kit ligand) is a survival factor, Development 115, 1111-1119.

   6.  Baxter, L. L. and Pavan, W. J. (2002) The oculocutaneous albinism type IV gene Matp is a new marker of pigment cell precursors during mouse embryonic development, Mech. Dev. 116, 209-212.

   7.  Harada, M., Li, Y. F., El-Gamil, M., Rosenberg, S. A., and Robbins, P. F. (2001) Use of an in vitro immunoselected tumor line to identify shared melanoma antigens recognized by HLA-A*0201-restricted T cells, Cancer Res. 61, 1089-1094.

   8.  Du, J. and Fisher, D. E. (2002) Identification of Aim-1 as the underwhite mouse mutant and its transcriptional regulation by MITF, J Biol. Chem. 277, 402-406.

   9.  Sweet, H. O., Brilliant, M. H., Cook, S. A., Johnson, K. R., and Davisson, M. T. (1998) A new allelic series for the underwhite gene on mouse chromosome 15, J Hered 89, 546-551.

 10.  Wang, N. and Hebert, D. N. (2006) Tyrosinase maturation through the mammalian secretory pathway: bringing color to life, Pigment Cell Res. 19, 3-18.

  11.  Lehman, A. L., Silvers, W. K., Puri, N., Wakamatsu, K., Ito, S., and Brilliant, M. H. (2000) The underwhite (uw) locus acts autonomously and reduces the production of melanin, J. Invest Dermatol. 115, 601-606.

  12.  Costin, G. E., Valencia, J. C., Vieira, W. D., Lamoreux, M. L., and Hearing, V. J. (2003) Tyrosinase processing and intracellular trafficking is disrupted in mouse primary melanocytes carrying the underwhite (uw) mutation. A model for oculocutaneous albinism (OCA) type 4, J. Cell Sci. 116, 3203-3212.

  13.  Prota, G. (1993) Regulatory mechanisms of melanogenesis: beyond the tyrosinase concept, J Invest Dermatol. 100, 156S-161S.

  14.  Rinchik, E. M., Bultman, S. J., Horsthemke, B., Lee, S. T., Strunk, K. M., Spritz, R. A., Avidano, K. M., Jong, M. T., and Nicholls, R. D. (1993) A gene for the mouse pink-eyed dilution locus and for human type II oculocutaneous albinism, Nature 361, 72-76.

  15.  Gardner, J. M., Nakatsu, Y., Gondo, Y., Lee, S., Lyon, M. F., King, R. A., and Brilliant, M. H. (1992) The mouse pink-eyed dilution gene: association with human Prader-Willi and Angelman syndromes, Science 257, 1121-1124.

  16.  Basrur, V., Yang, F., Kushimoto, T., Higashimoto, Y., Yasumoto, K., Valencia, J., Muller, J., Vieira, W. D., Watabe, H., Shabanowitz, J., Hearing, V. J., Hunt, D. F., and Appella, E. (2003) Proteomic analysis of early melanosomes: identification of novel melanosomal proteins, J Proteome. Res. 2, 69-79.

  17.  Steingrimsson, E., Copeland, N. G., and Jenkins, N. A. (2004) Melanocytes and the microphthalmia transcription factor network, Annu. Rev. Genet 38, 365-411.

  18.  Rundshagen, U., Zuhlke, C., Opitz, S., Schwinger, E., and Kasmann-Kellner, B. (2004) Mutations in the MATP gene in five German patients affected by oculocutaneous albinism type 4, Hum. Mutat. 23, 106-110.

  19.  Inagaki, K., Suzuki, T., Shimizu, H., Ishii, N., Umezawa, Y., Tada, J., Kikuchi, N., Takata, M., Takamori, K., Kishibe, M., Tanaka, M., Miyamura, Y., Ito, S., and Tomita, Y. (2004) Oculocutaneous albinism type 4 is one of the most common types of albinism in Japan, Am. J Hum. Genet 74, 466-471.

  20.  Inagaki, K., Suzuki, T., Ito, S., Suzuki, N., Adachi, K., Okuyama, T., Nakata, Y., Shimizu, H., Matsuura, H., Oono, T., Iwamatsu, H., Kono, M., and Tomita, Y. (2006) Oculocutaneous albinism type 4: six novel mutations in the membrane-associated transporter protein gene and their phenotypes, Pigment Cell Res. 19, 451-453.

  21.  Oetting, W. S. and King, R. A. (1999) Molecular basis of albinism: mutations and polymorphisms of pigmentation genes associated with albinism, Hum. Mutat. 13, 99-115.

  22.  Creel, D. J., Summers, C. G., and King, R. A. (1990) Visual anomalies associated with albinism, Ophthalmic Paediatr. Genet 11, 193-200.

  23.  Boissy, R. E., Zhao, H., Oetting, W. S., Austin, L. M., Wildenberg, S. C., Boissy, Y. L., Zhao, Y., Sturm, R. A., Hearing, V. J., King, R. A., and Nordlund, J. J. (1996) Mutation in and lack of expression of tyrosinase-related protein-1 (TRP-1) in melanocytes from an individual with brown oculocutaneous albinism: a new subtype of albinism classified as "OCA3", Am. J Hum. Genet 58, 1145-1156.

  24.  Manga, P., Kromberg, J. G., Box, N. F., Sturm, R. A., Jenkins, T., and Ramsay, M. (1997) Rufous oculocutaneous albinism in southern African Blacks is caused by mutations in the TYRP1 gene, Am. J Hum. Genet 61, 1095-1101.

  25.  Kobayashi, T., Imokawa, G., Bennett, D. C., and Hearing, V. J. (1998) Tyrosinase stabilization by Tyrp1 (the brown locus protein), J Biol. Chem. 273, 31801-31805.

  26.  Francis, E., Wang, N., Parag, H., Halaban, R., and Hebert, D. N. (2003) Tyrosinase maturation and oligomerization in the endoplasmic reticulum require a melanocyte-specific factor, J Biol. Chem. 278, 25607-25617.

  27.  Toyofuku, K., Wada, I., Valencia, J. C., Kushimoto, T., Ferrans, V. J., and Hearing, V. J. (2001) Oculocutaneous albinism types 1 and 3 are ER retention diseases: mutation of tyrosinase or Tyrp1 can affect the processing of both mutant and wild-type proteins, FASEB J 15, 2149-2161.

  28.  Di Pietro, S. M. and Dell'angelica, E. C. (2005) The cell biology of Hermansky-Pudlak syndrome: recent advances, Traffic. 6, 525-533.

  29.  Shiflett, S. L., Kaplan, J., and Ward, D. M. (2002) Chediak-Higashi Syndrome: a rare disorder of lysosomes and lysosome related organelles, Pigment Cell Res. 15, 251-257.

  30.  Suzuki, T., Inagaki, K., Fukai, K., Obana, A., Lee, S. T., and Tomita, Y. (2005) A Korean case of oculocutaneous albinism type IV caused by a D157N mutation in the MATP gene, Br. J Dermatol. 152, 174-175.

  31.  Sengupta, M., Chaki, M., Arti, N., and Ray, K. (2007) SLC45A2 variations in Indian oculocutaneous albinism patients, Mol. Vis. 13, 1406-1411.

  32.  Mariat, D., Taourit, S., and Guerin, G. (2003) A mutation in the MATP gene causes the cream coat colour in the horse, Genet Sel Evol. 35, 119-133.

  33.  Graf, J., Voisey, J., Hughes, I., and van, D. A. (2007) Promoter polymorphisms in the MATP (SLC45A2) gene are associated with normal human skin color variation, Hum. Mutat. 28, 710-717.

  34.  Soejima, M. and Koda, Y. (2007) Population differences of two coding SNPs in pigmentation-related genes SLC24A5 and SLC45A2, Int. J Legal Med. 121, 36-39.