Phenotypic Mutation 'naejangsan' (pdf version)
List |< first << previous [record 22 of 132] next >> last >|
Allelenaejangsan
Mutation Type nonsense
Chromosome2
Coordinate117,291,792 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Rasgrp1
Gene Name RAS guanyl releasing protein 1
Chromosomal Location 117,279,993-117,343,001 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous and targeted null mutations exhibit a lymphoproliferative autoimmune syndrome in which T cells fail to activate Ras or proliferate after antigen exposure, defects in positive selection, and enlarged spleen and lymph nodes. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011246; MGI:1314635

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000099593] [ENSMUSP00000133449] [ENSMUSP00000134592] [ENSMUSP00000134027] [ENSMUSP00000134167] [ENSMUSP00000136423]
SMART Domains Protein: ENSMUSP00000099593
Gene: ENSMUSG00000027347
AA Change: Y372*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
Pfam:EF-hand_6 474 502 5e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000133449
Gene: ENSMUSG00000027347
AA Change: Y372*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_6 442 467 1.2e-5 PFAM
C1 507 556 5.77e-16 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000134592
Gene: ENSMUSG00000027347
AA Change: Y372*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_6 442 467 1.1e-5 PFAM
Pfam:C1_1 507 539 3.4e-8 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000134027
Gene: ENSMUSG00000027347
AA Change: Y372*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 441 464 1.6e-5 PFAM
Pfam:EF-hand_6 442 467 1.6e-5 PFAM
C1 507 556 5.77e-16 SMART
PDB:4L9U|B 705 756 2e-23 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000134167
Gene: ENSMUSG00000027347
AA Change: Y372*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000136423
Gene: ENSMUSG00000027347
AA Change: Y372*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B:T cells - increased
FACS B1b cells - increased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgM MFI - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - increased
FACS NK cells - increased
FACS T cells - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (ENU)(2) Chemically induced (other)(1) Radiation induced(1) Spontaneous(1) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Rasgrp1 APN 2 117305791 nonsense probably null
IGL00901:Rasgrp1 APN 2 117285130 missense probably damaging 0.96
IGL01083:Rasgrp1 APN 2 117285068 missense probably benign 0.22
IGL01325:Rasgrp1 APN 2 117298529 missense probably damaging 1.00
IGL01520:Rasgrp1 APN 2 117288663 missense probably damaging 1.00
IGL01776:Rasgrp1 APN 2 117286840 critical splice donor site probably null
IGL01780:Rasgrp1 APN 2 117284878 missense probably benign 0.00
IGL01859:Rasgrp1 APN 2 117289418 missense probably benign 0.00
IGL01892:Rasgrp1 APN 2 117293842 missense probably damaging 1.00
IGL02068:Rasgrp1 APN 2 117300578 splice site probably benign
IGL02684:Rasgrp1 APN 2 117282576 missense probably benign 0.03
grouper UTSW 2 117302004 nonsense probably null
Haddock UTSW 2 117291895 missense
venutian UTSW 2 117284929 nonsense
R0067:Rasgrp1 UTSW 2 117294820 missense probably damaging 1.00
R0067:Rasgrp1 UTSW 2 117294820 missense probably damaging 1.00
R0538:Rasgrp1 UTSW 2 117284947 missense probably benign 0.42
R0786:Rasgrp1 UTSW 2 117300499 missense probably benign
R1068:Rasgrp1 UTSW 2 117282576 missense probably benign 0.03
R1165:Rasgrp1 UTSW 2 117284939 missense possibly damaging 0.49
R1491:Rasgrp1 UTSW 2 117282619 nonsense probably null
R1707:Rasgrp1 UTSW 2 117298547 missense probably damaging 1.00
R1869:Rasgrp1 UTSW 2 117290347 missense probably damaging 1.00
R2214:Rasgrp1 UTSW 2 117285165 missense probably damaging 0.98
R2425:Rasgrp1 UTSW 2 117289450 critical splice acceptor site probably null
R3236:Rasgrp1 UTSW 2 117291812 missense probably benign 0.00
R3915:Rasgrp1 UTSW 2 117288641 missense probably damaging 1.00
R4079:Rasgrp1 UTSW 2 117285029 missense probably benign 0.19
R4163:Rasgrp1 UTSW 2 117282654 missense probably benign 0.02
R4781:Rasgrp1 UTSW 2 117291709 missense probably benign 0.04
R4782:Rasgrp1 UTSW 2 117284875 missense probably benign 0.00
R5028:Rasgrp1 UTSW 2 117302004 nonsense probably null
R6019:Rasgrp1 UTSW 2 117291895 missense probably damaging 0.99
R6220:Rasgrp1 UTSW 2 117284929 nonsense probably null
R6294:Rasgrp1 UTSW 2 117291792 nonsense probably null
R6335:Rasgrp1 UTSW 2 117293870 missense probably damaging 0.99
R6948:Rasgrp1 UTSW 2 117298604 missense probably damaging 0.99
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-01-10 10:08 AM by Anne Murray
Record Created 2018-07-25 8:52 PM by Xue Zhong
Record Posted 2018-08-27
Phenotypic Description
Figure 1. Naejangsan mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Naejangsan mice exhibit increased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Naejangsan mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Naejangsan mice exhibit reduced frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Naejangsan mice exhibit reduced frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Naejangsan mice exhibit reduced frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Naejangsan mice exhibit reduced frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Naejangsan mice exhibit reduced frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Naejangsan mice exhibit reduced frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Naejangsan mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Naejangsan mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Naejangsan mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Naejangsan mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Naejangsan mice exhibit increased frequencies of peripheral neutrophils. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Naejangsan mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Naejangsan mice exhibit increased expression of CD44 on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 17. Naejangsan mice exhibit increased expression of CD44 on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 18. Naejangsan mice exhibit increased expression of CD44 on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 19. Naejangsan mice exhibit increased expression of IgM on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The naejangsan phenotype was identified among G3 mice of the pedigree R6294, some of which showed increased B to T cell ratios (Figure 1) due to increased frequencies of B cells (Figure 2) and B1b cells (Figure 3) with concomitant reduced frequencies of T cells (Figure 4), CD4+ T cells (Figure 5), CD4+ T cells in CD3+ T cells (Figure 6), naive CD4 T cells in CD4 T cells (Figure 7), CD8+ T cells (Figure 8), and naive CD8 T cells in CD8 T cells (Figure 9), all in the peripheral blood. Some mice showed increased frequencies of central memory CD4 T cells in CD4 T cells (Figure 10), effector memory CD4 T cells in CD4 T cells (Figure 11), central memory CD8 T cells in CD8 T cells (Figure 12), effector memory CD8 T cells in CD8 T cells (Figure 13), neutrophils (Figure 14), and natural killer cells (Figure 15), all in the peripheral blood. The expression of CD44 on peripheral blood T cells (Figure 16), CD4+ T cells (Figure 17), and CD8+ T cells (Figure 18) as well as the expression of IgM on peripheral blood B cells (Figure 19) were increased.

Nature of Mutation

Figure 20. Linkage mapping of the increased frequency of effector memory CD4 T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 72 mutations (X-axis) identified in the G1 male of pedigree R6294. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 72 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 2: Olfr1318 and Rasgrp1. The Rasgrp1 was presumed causative as the immunological phenotypes observed in the naejangsan mice mimic those found in other Rasgrp1 alleles (see grouper and MGI [accessed September 20, 2017]). The mutation in Rasgrp1 is a T to A transversion at base pair 117,291,792 (v38) on chromosome 2, or base pair 51,086 in the GenBank genomic region NC_000068 encoding Rasgrp1. The strongest association was found with a recessive model of inheritance to the normalized frequency of effector memory CD4 T cells, wherein six variant homozygotes departed phenotypically from 22 homozygous reference mice and 25 heterozygous mice with a P value of 2.771 x 10-52 (Figure 20).  

 

The mutation corresponds to residue 1,284 in the mRNA sequence NM_011246 within exon 9 of 17 total exons.

  

1267 GAGGCTATGCCCGACTATCTGGAAGATGGGAAG

367  -E--A--M--P--D--Y--L--E--D--G--K-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of tyrosine 372 for a premature stop codon (Y372*).

Protein Prediction
Figure 21. Domain structure of RasGRP1. Domain information is from SMART and UniProt. The naejangsan mutation results in substitution of tyrosine 372 for a premature stop codon. This image is interactive. Click on each mutation for more information.

Ras guanine-releasing protein 1 (RasGRP1) is a member of the Ras guanine nucleotide exchange factor (RasGEF) family. All of the RasGRPs have a central catalytic core, two EF hands, and a C1 domain (1-3). The catalytic domain of the RasGEF proteins can be subdivided into a Cdc25/GEF domain and a Ras exchanger motif (REM). The C-terminus of RasGRP1 after the C1 domain contains an unstructured region and a predicted coiled coil (3). Beaulieu and colleagues have designated the coiled-coil region as a plasma membrane targeter (PT) domain (4). In addition, a portion of the unstructured region adjacent to the PT domain was designated as a suppressor of PT (SuPT) domain.

 

The mutation results in substitution of tyrosine 372 for a premature stop codon (Y372*); amino acid 372 is within the Cdc25/GEF domain.

 

Please see the record grouper for more information about Rasgrp1.

Putative Mechanism

The RAS proteins are switches that cycle between inactive GDP (Ras-GDP)- and active GTP (Ras-GTP)-bound states. RasGEFs (e.g., RasGRP1, RasGRP3 [see the record for Aster], and SOS) function as RAS activators by maintaining the active GTP-bound state. In contrast, Ras GTPase-activating proteins (RasGAPs) promote GTP hydroloysis, subsequently returning Ras-GTP to an inactive state. RAS-associated signaling (e.g., the Ras-RAF-MEK-ERK pathway) regulates several functions including cell proliferation, differentiation, and apoptosis as well as the development and activity of lymphocytes. 

 

RasGRP1 is essential for activation of the ERK/MAPK signaling cascade in T cells, the regulation of T- and B-cell development, and B cell proliferation as well as T cell homeostasis, survival, differentiation, and proliferation (5-13). RasGRP1 also functions in the Ras-MAPK signaling pathway in NK cells, which subsequently leads to NK effector functions (14).Grb2 and DAG recruit SOS and RasGRP1, respectively, to the membrane after T cell receptor stimulation (5). At the membrane, RasGRP1 and SOS associate with membrane-anchored Ras. RasGRP1 primes SOS for activation by initiating an initial burst of Ras•GTP (15).

 

Low levels of RasGRP1 as well as expression of aberrant RASGRP1 transcripts in T cells in humans are putatively associated with the development of autoimmunity in a subset of systemic lupus erythematosus patients (16). Increased levels of RASGRP1 are often found in pediatric T cell leukemia where it stimulates growth (17;18). Mutations in RASGRP1 have been associated with autoimmune diabetes  (19;20). A mutation in RASGRP1 was linked to a case of immunodeficiency (21). The patient with RasGRP1-associated immunodeficiency showed recurrent infections and failure to thrive as well as a progressive reduction in the number of CD4+ T cells, an increased relative proportion of TCRγδ cells, a progressive decline in the number of B cells, and developed a low-grade Epstein-Barr virus (EBV)-associated B cell lymphoma. NK cells from the patient showed impaired cytotoxicity with defective granule convergence and actin accumulation.

 

Rasgrp1-deficient (Rasgrp1-/-) mice had increased numbers of CD8+ γδT cells in the peripheral lymphoid organs; γδT cell numbers in the thymus were comparable to that in wild-type mice. RasGRP1-deficient γδT cells were defective in proliferation following TCR stimulation and showed impaired IL-17 production. Rasgrp1-/- mice showed impaired CD4 Treg development in the thymus, but increased CD4+Foxp3+ Treg cells in the periphery (22). Also, the Rasgrp1-/- mice showed increased numbers of CD8+CD44highCD122+ T cells in the spleen. Rasgrp1-/- mice did not mount anaphylactic allergic reactions. Mast cells from the Rasgrp1-/- mice showed reduced degranulation and cytokine production as well as aberrant granule translocation, microtubule formation and Rho activation. Rasgrp1-/- mice exhibited reduced numbers of peripheral B cells, CD4+ T cells, CD8+ T cells, and invariant NKT cells with concomitant increased numbers of CD4+ T cells with activated memory phenotype (6;13;23-26). The Rasgrp1-/- mice exhibited enlarged spleens, increased levels of IgE and IgG1, and increased levels of autoantibody (13;23).

 

The phenotype of the naejangsan mice indicates loss of RasGRP1 function.

Primers PCR Primer
naejangsan(F):5'- TATGAGAAGGAAAGCAGAATCCTCC -3'
naejangsan(R):5'- CCAGTGACCGATCTGTTCTG -3'

Sequencing Primer
naejangsan_seq(F):5'- GGAAAGCAGAATCCTCCCTCCTC -3'
naejangsan_seq(R):5'- CAGTGACCGATCTGTTCTGCTTTG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

 

PCR Primers

R62940008_PCR_F: 5’- TATGAGAAGGAAAGCAGAATCCTCC-3’

R62940008_PCR_R: 5’- CCAGTGACCGATCTGTTCTG-3’

 

Sequencing Primers

R62940008_SEQ_F: 5’- GGAAAGCAGAATCCTCCCTCCTC-3’
 

R62940008_SEQ_R: 5’- CAGTGACCGATCTGTTCTGCTTTG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 400 nucleotides is amplified:

 

tatgagaagg aaagcagaat cctccctcct ctccacccgc tccagccccc cagtttatag

ctagtcttag cagttattct cccatgggaa tctcaccgtc agcagatgca ccaagtcctt

gttggcatcc aatggtgggg ccatctcctg cagctggacc aattcattga tatgattgta

aagggccagg agcttttgga cattcacctt cccatcttcc agatagtcgg gcatagcctc

atacagggat atgaggtcct tgaggtgcac acccagtatg gggattttga agtgggtgca

ctccccatag gctcgcctgt agttgtcata gtttctgcag gaggacagca gttcagtcat

ctcgcccaga acctacaaag cagaacagat cggtcactgg

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>T).

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler
List |< first << previous [record 22 of 132] next >> last >|