Phenotypic Mutation 'Dumpling'

• Allele: Dumpling
• Mutation Type: missense
• Chromosome: 1
• Coordinate: 138,067,890 bp (GRCm38)
• Base Change: A ⇒ C (forward strand)
• Gene: Ptprc
• Gene Name: protein tyrosine phosphatase, receptor type, C
• Synonym(s): B220, Ly-5, Lyt-4, CD45, T200
• Chromosomal Location: 138,062,861-138,175,708 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012] ; PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000138800] [ENSMUSP00000138275] [ENSMUSP00000138350]
• AlphaFold: P06800
• SMART Domains: Protein: ENSMUSP00000107667; Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	5	30	5.8e-13	PFAM
low complexity region	31	64	N/A	INTRINSIC
Pfam:CD45	70	129	1.8e-24	PFAM
FN3	233	317	2.28e0	SMART
FN3	333	411	3.48e-1	SMART
transmembrane domain	426	447	N/A	INTRINSIC
PTPc	500	762	7.57e-127	SMART
PTPc	791	1077	1.39e-102	SMART

• Predicted Effect: noncoding transcript
• SMART Domains: Protein: ENSMUSP00000138800; Gene: ENSMUSG00000026395; AA Change: C1018G

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	32	4.2e-13	PFAM
low complexity region	33	66	N/A	INTRINSIC
Pfam:CD45	72	131	2.3e-24	PFAM
FN3	235	319	2.28e0	SMART
FN3	335	413	3.48e-1	SMART
transmembrane domain	428	449	N/A	INTRINSIC
PTPc	502	764	7.57e-127	SMART
PTPc	793	1079	1.39e-102	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000182283)
• SMART Domains: Protein: ENSMUSP00000138275; Gene: ENSMUSG00000026395; AA Change: C994G

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	34	5.5e-13	PFAM
Pfam:CD45	48	107	2.3e-24	PFAM
FN3	211	295	2.28e0	SMART
FN3	311	389	3.48e-1	SMART
transmembrane domain	404	425	N/A	INTRINSIC
PTPc	478	740	7.57e-127	SMART
PTPc	769	1055	1.39e-102	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000182755)
• SMART Domains: Protein: ENSMUSP00000138350; Gene: ENSMUSG00000026395; AA Change: C1157G

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	2.7e-13	PFAM
low complexity region	111	128	N/A	INTRINSIC
low complexity region	170	205	N/A	INTRINSIC
Pfam:CD45	211	270	2.1e-24	PFAM
FN3	374	458	2.28e0	SMART
FN3	474	552	3.48e-1	SMART
transmembrane domain	567	588	N/A	INTRINSIC
PTPc	641	903	7.57e-127	SMART
PTPc	932	1218	1.39e-102	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000183301)
• Meta Mutation Damage Score: 0.5394
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:34 PM by Diantha La Vine
• Record Created: 2018-07-31 8:19 AM by Bruce Beutler
• Record Posted: 2018-08-01
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001111316 (variant 1), NM_011210 (variant 2), NM_001268286 (variant 3); MGI:1924753

Alleles Listed at MGI

All Mutations and Alleles(20) : Chemically induced (ENU)(9) Chemically induced (other)(2) Radiation induced(1) Targeted(7)  Transgenic(1)

Phenotypic Description

Figure 1. Dumpling mice exhibit decreased frequencies of peripheral B1a cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Dumpling mice exhibit decreased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Dumpling mice exhibit reduced B220 expression on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Dumpling phenotype was identified among G3 mice of the pedigree R6173, some of which showed reduced frequencies of B1a cells in B1 cells (Figure 1) and B1b cells (Figure 2) in the peripheral blood. Some mice also showed reduced expression of B220 on peripheral blood B cells (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the reduced B220 expression using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 57 mutations (X-axis) identified in the G1 male of pedigree R6173. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 57 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ptprc: a T to G transversion at base pair 138,067,890 (v38) on chromosome 1, or base pair 107,867 in the GenBank genomic region NC_000067 encoding Ptprc. The strongest association was found with an additive model of inheritance to the B220 mean fluorescence intensity (MFI) on B cells, wherein 10 variant homozygotes and 23 heterozygous mice departed phenotypically from five homozygous reference mice with a P value of 7.315 x 10^-15 (Figure 4).  

The mutation corresponds to residue 3,508 in the mRNA sequence NM_001111316 within exon 31 of 33 total exons, residue 3,189 in the mRNA sequence NM_011210 within exon 28 of 30 total exons, and residue 3,117 in the mRNA sequence NM_001268286 within exon 27 of 29 total exons.

107852 TCCATCCTCGTCCACTGCAGAGATGGATCCCAG 1152   -S--I--L--V--H--C--R--D--G--S--Q-   (NP_001104786; CD45-RABC) 1013   -S--I--L--V--H--C--R--D--G--S--Q-   (NP_035340; CD45-RAB) 989    -S--I--L--V--H--C--R--D--G--S--Q-   (NP_001255215; CD45-RO)

Genomic numbering corresponds to NC_000067. The mutated nucleotide is indicated in red. The mutation results in a cysteine to glycine substitution at position 1,157 (C1157G) in variant 1 of the CD45 protein (PolyPhen score = 1.000), a C1018G substitution in variant 2 (PolyPhen score = 1.000), and a C994G substitution in variant 3 (PolyPhen score = 1.000).

Protein Prediction

Figure 5. Domain structure of the CD45RABC isoform. The extracellular N-terminal A, B, and C regions are encoded by exons 4, 5, and 6, respectively, and are heavily O-glycosylated. The remainder of the extracelluar domain contains 15 sites for N-glycosylation. The catalytic cysteine (828) is indicated within the PTP D1 domain. The Dumpling mutation is shown in red. Abbreviations: FNIII=Type III fibronectin; TM=Transmembrane domain; PTP=Protein tyrosine phosphatase. This image is interactive. Other mutations found in CD45 are noted in red. Click on the mutations for more specific information.

Ptprc encodes CD45, a receptor-like protein tyrosine phosphatase (PTP) expressed by cells of the immune system. It is known by several names, including T200 (1), B220 for the B cell form (2), the mouse allotypic marker Ly-5 (3), and CD45. CD45 is a type I transmembrane glycoprotein containing a large N-terminal extracellular domain of ~400-500 residues (depending on the expression of several alternative exons, see below), a single transmembrane domain (22 amino acids), and a C-terminal cytoplasmic domain of 707 residues containing tandem PTP domains only one of which is enzymatically active (Figure 5). Following the PTP domains is a 79 residue C-terminal tail. 

Exons 4, 5, and 6 of Ptprc are alternatively spliced to generate three protein isoforms with variations in the most N-terminal domain, furthest from the cell membrane. The three peptides are designated as A, B, and C, respectively. The protein isoforms are commonly named based on the exons included, with the largest isoform (RABC) including all three exons, RAB including exons 4 and 5, etc., and the smallest isoform lacking all three exons designated RO. The D2 domain is a protein tyrosine phosphatase (PTP) domain that is enzymatically inactive, but optimal phosphatase activity in cells requires both the D1 and the D2 domains (4). Within the D2 domain is a unique acidic region of 19 residues that contains multiple sites for serine phosphorylation by casein kinase II (5;6). This modification is important for optimal CD45 phosphatase activity toward a model substrate in vitro and for cellular signaling leading to Ca²⁺ flux in Jurkat T cells, although the mechanistic basis for these effects is unknown. The D2 domain may also modulate substrate access and localization, as suggested by the interaction of D2 with the CD45 substrate Lck (7).

The Dumpling mutation results in a cysteine to glycine substitution at position 1,157 (C1157G) in variant 1 of CD45; amino acid 1157 is within the D2 domain.

Please see the record for belittle for information about CD45.

Putative Mechanism

The physiological function of CD45 has been examined most extensively in T cells. Studies with CD45-deficient cell lines identified CD45 as an obligate positive regulator of antigen receptor signaling, since T cells lacking CD45 failed to proliferate or produce cytokines in response to TCR stimulation (8;9). CD45 can regulate both the activating and inhibitory tyrosines of Src family kinases.

Ptprc^-/- mice have profound defects in thymic development due to dysfunctional signaling through the preTCR and TCR, leading to a block in thymocyte development at β selection and at the DP stage (10-12). As a result, the absolute number of DP thymocytes is reduced twofold, and the number of single positive (SP) thymocytes is reduced five-fold. Peripheral B cell numbers are actually increased in CD45-deficient mice.  CD45 deficiency has less severe consequences for B cells than for T cells. Peripheral B cell numbers are actually increased in CD45-deficient mice (10-12). Marginal zone B cells are increased, while B1 cell production is decreased, and B cell development is blocked at the transitional 2 (T2) to mature follicular B cell transition (13). Humans deficient in CD45 develop severe combined immunodeficiency (SCID) with defects in T and B cell development and function (OMIM #608971) (14;15). 

The immune cell phenotype of the Dumpling mice is similar to that of the Ptprc^-/- mice suggesting that the Dumpling mutation abrogates CD45 expression. Another ENU-induced Ptprc allele, storm (MGI:4819159), exhibited decreased B cell numbers as well as reduced T cell numbers. The expression and localization of CD45^Dumpling have not been examined; however, the phenotype of the Dumpling mice indicates that the Dumpling mice do not express functional CD45.

Primers

PCR Primer
Dumpling_pcr_F: TCAAATGATAGGCAGCAGCTACC
Dumpling_pcr_R: CACTTCACCTCGGATTGCAG

Sequencing Primer
Dumpling_seq_F: GCTACCAGCCTAAAAGCCTGG
Dumpling_seq_R: TTGCAGAGGAAGGAGCCC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 1, - strand):

1   cacttcacct cggattgcag aggaaggagc ccagaactgt gtaccagtac cagtgtacca
61  catggaaagg ggaagagctg cctgcagaac ccaaagacct ggtgtctatg attcaggacc
121 tcaaacagaa gcttcccaag gcttccccag aagggatgaa gtatcacaag catgcatcca
181 tcctcgtcca ctgcaggtta ggaagctgat ggggtgtact ctaaggttgg aaggctttgt
241 cttcactttt atgaagatgt agatggtgtg ttccagtgaa aatctccatg aagccattca
301 ctctcatgtt atttatatgc agcatgacta taatagtaat ataaacaata aaggttataa
361 agccaggctt ttaggctggt agctgctgcc tatcatttga 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Trowbridge, I. S., and Mazauskas, C. (1976) Immunological Properties of Murine Thymus-Dependent Lymphocyte Surface Glycoproteins. Eur J Immunol. 6, 557-562.

  2. Coffman, R. L., and Weissman, I. L. (1981) B220: A B Cell-Specific Member of Th T200 Glycoprotein Family. Nature. 289, 681-683.

  3. Komuro, K., Itakura, K., Boyse, E. A., and John, M. (1974) Ly-5: A New T-Lymphocyte Antigen System. Immunogenetics. 1, 452-456.

  4. Desai, D. M., Sap, J., Silvennoinen, O., Schlessinger, J., and Weiss, A. (1994) The Catalytic Activity of the CD45 Membrane-Proximal Phosphatase Domain is Required for TCR Signaling and Regulation. EMBO J. 13, 4002-4010.

  5. Wang, Y., Guo, W., Liang, L., and Esselman, W. J. (1999) Phosphorylation of CD45 by Casein Kinase 2. Modulation of Activity and Mutational Analysis. J Biol Chem. 274, 7454-7461.

  6. Greer, S. F., Wang, Y., Raman, C., and Justement, L. B. (2001) CD45 Function is Regulated by an Acidic 19-Amino Acid Insert in Domain II that Serves as a Binding and Phosphoacceptor Site for Casein Kinase 2. J Immunol. 166, 7208-7218.

  7. Wang, Y., and Johnson, P. (2005) Expression of CD45 Lacking the Catalytic Protein Tyrosine Phosphatase Domain Modulates Lck Phosphorylation and T Cell Activation. J Biol Chem. 280, 14318-14324.

  8. Pingel, J. T., and Thomas, M. L. (1989) Evidence that the Leukocyte-Common Antigen is Required for Antigen-Induced T Lymphocyte Proliferation. Cell. 58, 1055-1065.

  9. Weaver, C. T., Pingel, J. T., Nelson, J. O., and Thomas, M. L. (1991) CD8+ T-Cell Clones Deficient in the Expression of the CD45 Protein Tyrosine Phosphatase have Impaired Responses to T-Cell Receptor Stimuli. Mol Cell Biol. 11, 4415-4422.

  10. Mee, P. J., Turner, M., Basson, M. A., Costello, P. S., Zamoyska, R., and Tybulewicz, V. L. (1999) Greatly Reduced Efficiency of both Positive and Negative Selection of Thymocytes in CD45 Tyrosine Phosphatase-Deficient Mice. Eur J Immunol. 29, 2923-2933.

  11. Byth, K. F., Conroy, L. A., Howlett, S., Smith, A. J., May, J., Alexander, D. R., and Holmes, N. (1996) CD45-Null Transgenic Mice Reveal a Positive Regulatory Role for CD45 in Early Thymocyte Development, in the Selection of CD4+CD8+ Thymocytes, and B Cell Maturation. J Exp Med. 183, 1707-1718.

  12. Kishihara, K., Penninger, J., Wallace, V. A., Kundig, T. M., Kawai, K., Wakeham, A., Timms, E., Pfeffer, K., Ohashi, P. S., and Thomas, M. L. (1993) Normal B Lymphocyte Development but Impaired T Cell Maturation in CD45-exon6 Protein Tyrosine Phosphatase-Deficient Mice. Cell. 74, 143-156.

  13. Hermiston, M. L., Tan, A. L., Gupta, V. A., Majeti, R., and Weiss, A. (2005) The Juxtamembrane Wedge Negatively Regulates CD45 Function in B Cells. Immunity. 23, 635-647.

  14. Kung, C., Pingel, J. T., Heikinheimo, M., Klemola, T., Varkila, K., Yoo, L. I., Vuopala, K., Poyhonen, M., Uhari, M., Rogers, M., Speck, S. H., Chatila, T., and Thomas, M. L. (2000) Mutations in the Tyrosine Phosphatase CD45 Gene in a Child with Severe Combined Immunodeficiency Disease. Nat Med. 6, 343-345.

  15. Tchilian, E. Z., Wallace, D. L., Wells, R. S., Flower, D. R., Morgan, G., and Beverley, P. C. (2001) A Deletion in the Gene Encoding the CD45 Antigen in a Patient with SCID. J Immunol. 166, 1308-1313.