Phenotypic Mutation 'Herrscher' (pdf version)
List |< first << previous [record 16 of 132] next >> last >|
AlleleHerrscher
Mutation Type nonsense
Chromosome11
Coordinate11,768,961 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Ikzf1
Gene Name IKAROS family zinc finger 1
Synonym(s) LyF-1, 5832432G11Rik, Zfpn1a1, Ikaros
Chromosomal Location 11,685,003-11,772,926 bp (+)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of transcription factors that are characterized by a set of four DNA-binding zinc fingers at the N-terminus and two C-terminal zinc fingers involved in protein dimerization. It is regulated by both epigenetic and transcription factors. This protein is a transcriptional regulator of hematopoietic cell development and homeostasis. In addition, it is required to confer temporal competence to retinal progenitor cells during embryogenesis, demonstrating an essential function in nervous system development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mutants have a variety of T, B, and hematopoeitic cell maturation defects. Heterozygotes for one allele exhibit dominant negative effects and mice develop lymphoproliferative disorders. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001025597 (variant 1), NM_009578 (variant 2), NM_001301863 (variant 3), NM_001301865 (variant 4), NM_001301866 (variant 5), NM_001301868 (variant 6); MGI:1342540

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000018798] [ENSMUSP00000067372] [ENSMUSP00000075992]
SMART Domains Protein: ENSMUSP00000018798
Gene: ENSMUSG00000018654
AA Change: Q223*

DomainStartEndE-ValueType
ZnF_C2H2 58 80 8.02e-5 SMART
ZnF_C2H2 86 108 2.57e-3 SMART
ZnF_C2H2 114 137 8.22e-2 SMART
low complexity region 282 293 N/A INTRINSIC
ZnF_C2H2 371 393 7.49e0 SMART
ZnF_C2H2 399 423 5.34e-1 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000067372
Gene: ENSMUSG00000018654
AA Change: Q330*

DomainStartEndE-ValueType
ZnF_C2H2 137 159 1.43e-1 SMART
ZnF_C2H2 165 187 8.02e-5 SMART
ZnF_C2H2 193 215 2.57e-3 SMART
ZnF_C2H2 221 244 8.22e-2 SMART
low complexity region 389 400 N/A INTRINSIC
ZnF_C2H2 478 500 7.49e0 SMART
ZnF_C2H2 506 530 5.34e-1 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000075992
Gene: ENSMUSG00000018654
AA Change: Q310*

DomainStartEndE-ValueType
ZnF_C2H2 117 139 1.43e-1 SMART
ZnF_C2H2 145 167 8.02e-5 SMART
ZnF_C2H2 173 195 2.57e-3 SMART
ZnF_C2H2 201 224 8.22e-2 SMART
low complexity region 369 380 N/A INTRINSIC
ZnF_C2H2 458 480 7.49e0 SMART
ZnF_C2H2 486 510 5.34e-1 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight (BP) - decreased
FACS B1 cells - increased
FACS CD4:CD8 - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ CD4 T cells - increased
FACS CD44+ CD8 T cells - increased
FACS CD44+ T cells - increased
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(14) : Chemically induced (ENU)(1) Gene trapped(1) Targeted(12)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Ikzf1 APN 11 11768923 missense probably damaging 1.00
IGL01367:Ikzf1 APN 11 11748358 missense probably benign 0.04
IGL01823:Ikzf1 APN 11 11769091 missense possibly damaging 0.64
IGL02342:Ikzf1 APN 11 11700216 utr 5 prime probably benign
IGL02452:Ikzf1 APN 11 11748545 missense probably damaging 1.00
IGL03209:Ikzf1 APN 11 11700226 missense probably benign
IGL03236:Ikzf1 APN 11 11707848 missense probably damaging 1.00
Star_lord UTSW 11 11769448 missense probably damaging 1.00
waxwing UTSW 11 11748464 nonsense probably null
R0133:Ikzf1 UTSW 11 11741015 splice site probably null
R0417:Ikzf1 UTSW 11 11769352 missense probably benign 0.19
R0633:Ikzf1 UTSW 11 11769223 missense probably damaging 1.00
R0734:Ikzf1 UTSW 11 11758195 missense probably damaging 1.00
R1693:Ikzf1 UTSW 11 11707838 missense probably damaging 1.00
R2114:Ikzf1 UTSW 11 11769473 missense probably damaging 1.00
R2927:Ikzf1 UTSW 11 11769324 missense probably damaging 1.00
R4250:Ikzf1 UTSW 11 11754166 missense probably damaging 1.00
R5156:Ikzf1 UTSW 11 11769448 missense probably damaging 1.00
R5912:Ikzf1 UTSW 11 11748464 nonsense probably null
R6274:Ikzf1 UTSW 11 11768961 nonsense probably null
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2018-10-25 12:06 PM by Bruce Beutler
Record Created 2018-08-23 8:21 AM by Darui Xu
Record Posted 2018-09-11
Phenotypic Description
Figure 1. Herrscher mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Herrscher mice exhibit reduced CD4+ to CD8+ T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Herrscher mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Herrscher phenotype was identified among G3 mice of the pedigree R6274, some of which showed decreased B to T cell ratios (Figure 1), a decrease in the CD4+ to CD8+ T cell ratio (Figure 2), and reduced frequencies of CD4+ T cells in CD3+ T cells (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the reduced CD4+ T cell in CD3+ T cell frequency using an additive/dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 56 mutations (X-axis) identified in the G1 male of pedigree R6274. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ikzf1: a C to T transition at base pair 11,768,961(v38) on chromosome 11, or base pair 83,993 in the GenBank genomic region NC_000077 encoding Ikzf1. The strongest association was found with an additive/dominant model of inheritance to the CD4+ T cell frequency, wherein 13 heterozygous mice departed phenotypically from 17 homozygous reference mice with a P value of 1.066 x 10-8 (Figure 4). No homozygous variant mice were screened for pedigree R6274.

 

The mutation corresponds to residue 1,486 in the mRNA sequence NM_001025597 within exon 8 of 8 total exons.

 

1471 TCCCACGTGATGGACCAGGCCATCAACAATGCC
305  -S--H--V--M--D--Q--A--I--N--N--A-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of glutamine 310 for a premature stop codon (Q310*) in variant 1 of the IKZF1 protein.

Protein Prediction

Figure 5. Domain organization of IKAROS. IKAROS has six C2H2-type zinc fingers, with four at the N-terminus and two at the C-terminus. The herrscher mutation results in substitution of glutamine 310 for a premature stop codon (Q310*) in variant 1 of the IKZF1 protein. Other mutations found in the IKAROS protein are shown in red. Click on each mutation for more information.

Ikzf1 (IKAROS family zinc finger 1) encodes IKAROS (alternatively, IK1). IKAROS has six C2H2-type zinc fingers, with four at the N-terminus and two at the C-terminus (Figure 5) (1). The N-terminal zinc fingers mediate binding to the core DNA motif A/GGGAA. The C-terminal zinc fingers mediate IKAROS homodimerization as well as heterodimerization with other members of the IKAROS protein family (2). Dimerization of the IKAROS proteins enhances their DNA affinity and transcriptional activity.

 

The herrscher mutation results in substitution of glutamine 310 for a premature stop codon (Q310*) in variant 1 of the IKZF1 protein; Gln310 is within an undefined region between the fourth and fifth first zinc finger.

 

For more information about Ikzf1, please see the record for star_lord.

Putative Mechanism

IKAROS is a transcription factor that regulates the expression of genes that mediate the production of blood and immune cells, promotes precursor self-renewal, common lymphoid progenitor generation from hematopoietic stem cells, B and NK cell lineages from common lymphoid progenitors, inhibition of common myeloid progenitor differentiation, neutrophil generation from granulocyte-macrophage progenitors, and generation of erythroid cells from megakaryocyte-erythroid progenitors [reviewed in (3)].

 

Mutations in IKZF1 are associated with common variable immunodeficiency-13 (OMIM: #616873) (4;5). Patients with common variable immunodeficiency-13 exhibit recurrent bacterial infections, hypogammaglobulinemia, and decreased numbers of B cells (4;5). Some patients also have reduced numbers of NK cells and increased numbers of T lymphocytes (4). Dominant negative mutations in IKZF1 are linked to acute lymphoblastic leukemia (ALL) in infants and adults (6-8). Patients with ALL exhibit uncontrolled B-lymphoid progenitor expansion in the bone marrow.

 

Ikzf1-deficient (Ikzf1-/-) mice typically (95%) exhibited postnatal lethality by four weeks of age due to bacterial infections (9). The Ikzf1-/-mice exhibited reduced body sizes compared to wild-type mice (9). Ikzf1-/- mice exhibited reduced circulating adrenocorticotrophic hormone levels, adrenal glucocorticoid insufficiency, and contraction of the pituitary corticomelanotroph population due to loss of IKAROS-associated proopiomelanocortin gene expression (10). Ikzf1-/- mice also exhibited reduced numbers of B1a, B1b cells, NK cells, and double-positive T cells, deficient B cell differentiation, reduced spleen germinal center number, aberrant B cell activation and proliferation after IL-7 stimulation, and reduced IgG3 levels (9;11;12). Homozygous mice expressing an ENU-induced mutant Ikzf1 allele (Ikzf1plastc/plastc; H191R) exhibited embryonic lethality between embryonic days 15.5 and 17.5 due to fetal anemia (13). The Ikzf1plastc/plastc embryos showed thymus and liver hypoplasia, a failure in T and B cell differentiation, increased numbers of granulocyte/macrophage progenitor cells, reduced numbers of erythroid progenitor cells, aberrant erythroblast differentiation and growth (13). Homozygous mice expressing a mutant Ikzf1 allele that is missing zinc finger 1 (Ikzf1deltaF1/deltaF1) exhibited reduced numbers of immature B cells as well as pre-B, B1a, and B1b cell numbers, thymus hypoplasia, and reduced numbers of DN1 thymic pro-T cells (14).

 

The phenotype of the herrscher mice indicates abberant IKZF1herrscher-associated function in lymphocyte differentiation and function.

Primers PCR Primer
Herrscher(F):5'- ATGGCACCTTATCCCTCCTGAG -3'
Herrscher(R):5'- ACACAGACTTGGCCTTGGAC -3'

Sequencing Primer
Herrscher_seq(F):5'- TGAGCCCTGGCAGATGTGTC -3'
Herrscher_seq(R):5'- CTTGGACAGCAGCAGCAAGTTATC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler
List |< first << previous [record 16 of 132] next >> last >|