Phenotypic Mutation 'Herrscher'

• Allele: Herrscher
• Mutation Type: nonsense
• Chromosome: 11
• Coordinate: 11,718,961 bp (GRCm39)
• Base Change: C ⇒ T (forward strand)
• Gene: Ikzf1
• Gene Name: IKAROS family zinc finger 1
• Synonym(s): Zfpn1a1, 5832432G11Rik, LyF-1, Ikaros
• Chromosomal Location: 11,634,980-11,722,926 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: The protein encoded by this gene belongs to a family of transcription factors that are characterized by a set of four DNA-binding zinc fingers at the N-terminus and two C-terminal zinc fingers involved in protein dimerization. It is regulated by both epigenetic and transcription factors. This protein is a transcriptional regulator of hematopoietic cell development and homeostasis. In addition, it is required to confer temporal competence to retinal progenitor cells during embryogenesis, demonstrating an essential function in nervous system development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014] ; PHENOTYPE: Homozygous mutants have a variety of T, B, and hematopoeitic cell maturation defects. Heterozygotes for one allele exhibit dominant negative effects and mice develop lymphoproliferative disorders. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000018798] [ENSMUSP00000067372] [ENSMUSP00000075992]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000018798; Gene: ENSMUSG00000018654; AA Change: Q223*

Domain	Start	End	E-Value	Type
ZnF_C2H2	58	80	8.02e-5	SMART
ZnF_C2H2	86	108	2.57e-3	SMART
ZnF_C2H2	114	137	8.22e-2	SMART
low complexity region	282	293	N/A	INTRINSIC
ZnF_C2H2	371	393	7.49e0	SMART
ZnF_C2H2	399	423	5.34e-1	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000067372; Gene: ENSMUSG00000018654; AA Change: Q330*

Domain	Start	End	E-Value	Type
ZnF_C2H2	137	159	1.43e-1	SMART
ZnF_C2H2	165	187	8.02e-5	SMART
ZnF_C2H2	193	215	2.57e-3	SMART
ZnF_C2H2	221	244	8.22e-2	SMART
low complexity region	389	400	N/A	INTRINSIC
ZnF_C2H2	478	500	7.49e0	SMART
ZnF_C2H2	506	530	5.34e-1	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000075992; Gene: ENSMUSG00000018654; AA Change: Q310*

Domain	Start	End	E-Value	Type
ZnF_C2H2	117	139	1.43e-1	SMART
ZnF_C2H2	145	167	8.02e-5	SMART
ZnF_C2H2	173	195	2.57e-3	SMART
ZnF_C2H2	201	224	8.22e-2	SMART
low complexity region	369	380	N/A	INTRINSIC
ZnF_C2H2	458	480	7.49e0	SMART
ZnF_C2H2	486	510	5.34e-1	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2022-04-12 3:40 PM by External Program
• Record Created: 2018-08-23 8:21 AM by Darui Xu
• Record Posted: 2018-09-11
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001025597 (variant 1), NM_009578 (variant 2), NM_001301863 (variant 3), NM_001301865 (variant 4), NM_001301866 (variant 5), NM_001301868 (variant 6); MGI:1342540

Alleles Listed at MGI

All Mutations and Alleles(14) : Chemically induced (ENU)(1) Gene trapped(1) Targeted(12)

Phenotypic Description

Figure 1. Herrscher mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Herrscher mice exhibit reduced CD4+ to CD8+ T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Herrscher mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Herrscher phenotype was identified among G3 mice of the pedigree R6274, some of which showed decreased B to T cell ratios (Figure 1), a decrease in the CD4⁺ to CD8⁺ T cell ratio (Figure 2), and reduced frequencies of CD4+ T cells in CD3+ T cells (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the reduced CD4+ T cell in CD3+ T cell frequency using an additive/dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 56 mutations (X-axis) identified in the G1 male of pedigree R6274. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ikzf1: a C to T transition at base pair 11,768,961(v38) on chromosome 11, or base pair 83,993 in the GenBank genomic region NC_000077 encoding Ikzf1. The strongest association was found with an additive/dominant model of inheritance to the CD4+ T cell frequency, wherein 13 heterozygous mice departed phenotypically from 17 homozygous reference mice with a P value of 1.066 x 10^-8 (Figure 4). No homozygous variant mice were screened for pedigree R6274.

The mutation corresponds to residue 1,486 in the mRNA sequence NM_001025597 within exon 8 of 8 total exons.

1471 TCCCACGTGATGGACCAGGCCATCAACAATGCC 305  -S--H--V--M--D--Q--A--I--N--N--A-

The mutated nucleotide is indicated in red. The mutation results in substitution of glutamine 310 for a premature stop codon (Q310*) in variant 1 of the IKZF1 protein.

Protein Prediction

Figure 5. Domain organization of IKAROS. IKAROS has six C₂H₂-type zinc fingers, with four at the N-terminus and two at the C-terminus. The herrscher mutation results in substitution of glutamine 310 for a premature stop codon (Q310*) in variant 1 of the IKZF1 protein. Other mutations found in the IKAROS protein are shown in red. Click on each mutation for more information.

Ikzf1 (IKAROS family zinc finger 1) encodes IKAROS (alternatively, IK1). IKAROS has six C₂H₂-type zinc fingers, with four at the N-terminus and two at the C-terminus (Figure 5) (1). The N-terminal zinc fingers mediate binding to the core DNA motif A/GGGAA. The C-terminal zinc fingers mediate IKAROS homodimerization as well as heterodimerization with other members of the IKAROS protein family (2). Dimerization of the IKAROS proteins enhances their DNA affinity and transcriptional activity.

The herrscher mutation results in substitution of glutamine 310 for a premature stop codon (Q310*) in variant 1 of the IKZF1 protein; Gln310 is within an undefined region between the fourth and fifth first zinc finger.

For more information about Ikzf1, please see the record for star_lord.

Putative Mechanism

IKAROS is a transcription factor that regulates the expression of genes that mediate the production of blood and immune cells, promotes precursor self-renewal, common lymphoid progenitor generation from hematopoietic stem cells, B and NK cell lineages from common lymphoid progenitors, inhibition of common myeloid progenitor differentiation, neutrophil generation from granulocyte-macrophage progenitors, and generation of erythroid cells from megakaryocyte-erythroid progenitors [reviewed in (3)].

Mutations in IKZF1 are associated with common variable immunodeficiency-13 (OMIM: #616873) (4;5). Patients with common variable immunodeficiency-13 exhibit recurrent bacterial infections, hypogammaglobulinemia, and decreased numbers of B cells (4;5). Some patients also have reduced numbers of NK cells and increased numbers of T lymphocytes (4). Dominant negative mutations in IKZF1 are linked to acute lymphoblastic leukemia (ALL) in infants and adults (6-8). Patients with ALL exhibit uncontrolled B-lymphoid progenitor expansion in the bone marrow.

Ikzf1-deficient (Ikzf1^-/-) mice typically (95%) exhibited postnatal lethality by four weeks of age due to bacterial infections (9). The Ikzf1^-/-mice exhibited reduced body sizes compared to wild-type mice (9). Ikzf1^-/- mice exhibited reduced circulating adrenocorticotrophic hormone levels, adrenal glucocorticoid insufficiency, and contraction of the pituitary corticomelanotroph population due to loss of IKAROS-associated proopiomelanocortin gene expression (10). Ikzf1^-/- mice also exhibited reduced numbers of B1a, B1b cells, NK cells, and double-positive T cells, deficient B cell differentiation, reduced spleen germinal center number, aberrant B cell activation and proliferation after IL-7 stimulation, and reduced IgG3 levels (9;11;12). Homozygous mice expressing an ENU-induced mutant Ikzf1 allele (Ikzf1^{plastc/plastc}; H191R) exhibited embryonic lethality between embryonic days 15.5 and 17.5 due to fetal anemia (13). The Ikzf1^{plastc/plastc} embryos showed thymus and liver hypoplasia, a failure in T and B cell differentiation, increased numbers of granulocyte/macrophage progenitor cells, reduced numbers of erythroid progenitor cells, aberrant erythroblast differentiation and growth (13). Homozygous mice expressing a mutant Ikzf1 allele that is missing zinc finger 1 (Ikzf1^{deltaF1/deltaF1}) exhibited reduced numbers of immature B cells as well as pre-B, B1a, and B1b cell numbers, thymus hypoplasia, and reduced numbers of DN1 thymic pro-T cells (14).

The phenotype of the herrscher mice indicates abberant IKZF1^herrscher-associated function in lymphocyte differentiation and function.

Primers

PCR Primer
Herrscher_pcr_F: ATGGCACCTTATCCCTCCTGAG
Herrscher_pcr_R: ACACAGACTTGGCCTTGGAC

Sequencing Primer
Herrscher_seq_F: TGAGCCCTGGCAGATGTGTC
Herrscher_seq_R: CTTGGACAGCAGCAGCAAGTTATC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 11, + strand):

1   atggcacctt atccctcctg agccctggca gatgtgtcct gtctgctgtg acactagaac
61  accattcaac ccctgggtgt agatttcact tatgaccatc tacttcccgc aggagacaag
121 tgcctgtcag acatgcccta tgacagtgcc aactatgaga aggaggatat gatgacatcc
181 cacgtgatgg accaggccat caacaatgcc atcaactacc tgggggctga gtccctgcgc
241 ccattggtgc agacaccccc cggtagctcc gaggtggtgc cagtcatcag ctccatgtac
301 cagctgcaca agcccccctc agatggcccc ccacggtcca accattcagc acaggacgcc
361 gtggataact tgctgctgct gtccaaggcc aagtctgtgt 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Nietfeld, W., and Meyerhans, A. (1996) Cloning and Sequencing of hIk-1, a cDNA Encoding a Human Homologue of Mouse Ikaros/LyF-1. Immunol Lett. 49, 139-141.

  2. Dijon, M., Bardin, F., Murati, A., Batoz, M., Chabannon, C., and Tonnelle, C. (2008) The Role of Ikaros in Human Erythroid Differentiation. Blood. 111, 1138-1146.

  3. John, L. B., and Ward, A. C. (2011) The Ikaros Gene Family: Transcriptional Regulators of Hematopoiesis and Immunity. Mol Immunol. 48, 1272-1278.

  4. Goldman, F. D., Gurel, Z., Al-Zubeidi, D., Fried, A. J., Icardi, M., Song, C., and Dovat, S. (2012) Congenital Pancytopenia and Absence of B Lymphocytes in a Neonate with a Mutation in the Ikaros Gene. Pediatr Blood Cancer. 58, 591-597.

  5. Kuehn, H. S., Boisson, B., Cunningham-Rundles, C., Reichenbach, J., Stray-Pedersen, A., Gelfand, E. W., Maffucci, P., Pierce, K. R., Abbott, J. K., Voelkerding, K. V., South, S. T., Augustine, N. H., Bush, J. S., Dolen, W. K., Wray, B. B., Itan, Y., Cobat, A., Sorte, H. S., Ganesan, S., Prader, S., Martins, T. B., Lawrence, M. G., Orange, J. S., Calvo, K. R., Niemela, J. E., Casanova, J. L., Fleisher, T. A., Hill, H. R., Kumanovics, A., Conley, M. E., and Rosenzweig, S. D. (2016) Loss of B Cells in Patients with Heterozygous Mutations in IKAROS. N Engl J Med. 374, 1032-1043.

  6. Sun, L., Heerema, N., Crotty, L., Wu, X., Navara, C., Vassilev, A., Sensel, M., Reaman, G. H., and Uckun, F. M. (1999) Expression of Dominant-Negative and Mutant Isoforms of the Antileukemic Transcription Factor Ikaros in Infant Acute Lymphoblastic Leukemia. Proc Natl Acad Sci U S A. 96, 680-685.

  7. Nakase, K., Ishimaru, F., Avitahl, N., Dansako, H., Matsuo, K., Fujii, K., Sezaki, N., Nakayama, H., Yano, T., Fukuda, S., Imajoh, K., Takeuchi, M., Miyata, A., Hara, M., Yasukawa, M., Takahashi, I., Taguchi, H., Matsue, K., Nakao, S., Niho, Y., Takenaka, K., Shinagawa, K., Ikeda, K., Niiya, K., and Harada, M. (2000) Dominant Negative Isoform of the Ikaros Gene in Patients with Adult B-Cell Acute Lymphoblastic Leukemia. Cancer Res. 60, 4062-4065.

  8. Mullighan, C. G., Su, X., Zhang, J., Radtke, I., Phillips, L. A., Miller, C. B., Ma, J., Liu, W., Cheng, C., Schulman, B. A., Harvey, R. C., Chen, I. M., Clifford, R. J., Carroll, W. L., Reaman, G., Bowman, W. P., Devidas, M., Gerhard, D. S., Yang, W., Relling, M. V., Shurtleff, S. A., Campana, D., Borowitz, M. J., Pui, C. H., Smith, M., Hunger, S. P., Willman, C. L., Downing, J. R., and Children's Oncology Group. (2009) Deletion of IKZF1 and Prognosis in Acute Lymphoblastic Leukemia. N Engl J Med. 360, 470-480.

  9. Georgopoulos, K., Bigby, M., Wang, J. H., Molnar, A., Wu, P., Winandy, S., and Sharpe, A. (1994) The Ikaros Gene is Required for the Development of all Lymphoid Lineages. Cell. 79, 143-156.

  10. Ezzat, S., Mader, R., Yu, S., Ning, T., Poussier, P., and Asa, S. L. (2005) Ikaros Integrates Endocrine and Immune System Development. J Clin Invest. 115, 1021-1029.

  11. Kirstetter, P., Thomas, M., Dierich, A., Kastner, P., and Chan, S. (2002) Ikaros is Critical for B Cell Differentiation and Function. Eur J Immunol. 32, 720-730.

  12. Wang, J. H., Nichogiannopoulou, A., Wu, L., Sun, L., Sharpe, A. H., Bigby, M., and Georgopoulos, K. (1996) Selective Defects in the Development of the Fetal and Adult Lymphoid System in Mice with an Ikaros Null Mutation. Immunity. 5, 537-549.

  13. Papathanasiou, P., Perkins, A. C., Cobb, B. S., Ferrini, R., Sridharan, R., Hoyne, G. F., Nelms, K. A., Smale, S. T., and Goodnow, C. C. (2003) Widespread Failure of Hematolymphoid Differentiation Caused by a Recessive Niche-Filling Allele of the Ikaros Transcription Factor. Immunity. 19, 131-144.

  14. Schjerven, H., McLaughlin, J., Arenzana, T. L., Frietze, S., Cheng, D., Wadsworth, S. E., Lawson, G. W., Bensinger, S. J., Farnham, P. J., Witte, O. N., and Smale, S. T. (2013) Selective Regulation of Lymphopoiesis and Leukemogenesis by Individual Zinc Fingers of Ikaros. Nat Immunol. 14, 1073-1083.