Phenotypic Mutation 'pantone'

• Allele: pantone
• Mutation Type: missense
• Chromosome: 1
• Coordinate: 87,699,675 bp (GRCm38)
• Base Change: T ⇒ A (forward strand)
• Gene: Inpp5d
• Gene Name: inositol polyphosphate-5-phosphatase D
• Synonym(s): s-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
• Chromosomal Location: 87,620,312-87,720,507 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014] ; PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Glutamine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000044647] [ENSMUSP00000072763 ^†] [ENSMUSP00000126569] [ENSMUSP00000131244] [ENSMUSP00000127941] [ENSMUSP00000132384] † probably from a misspliced transcript
• AlphaFold: Q9ES52
• SMART Domains: Protein: ENSMUSP00000044647; Gene: ENSMUSG00000026288; AA Change: L565Q

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	954	979	N/A	INTRINSIC
low complexity region	1045	1057	N/A	INTRINSIC
low complexity region	1119	1131	N/A	INTRINSIC
low complexity region	1139	1148	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
  (Using ENSMUST00000042275)
• SMART Domains: Protein: ENSMUSP00000072763; Gene: ENSMUSG00000026288; AA Change: L565Q

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	932	953	N/A	INTRINSIC

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
  (Using ENSMUST00000072999)
• SMART Domains: Protein: ENSMUSP00000126569; Gene: ENSMUSG00000026288; AA Change: L303Q

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	692	717	N/A	INTRINSIC
low complexity region	783	795	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	877	886	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000167032)
• SMART Domains: Protein: ENSMUSP00000131244; Gene: ENSMUSG00000026288; AA Change: L566Q

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	4.5e-104	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1059	1071	N/A	INTRINSIC
low complexity region	1079	1088	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000168783)
• SMART Domains: Protein: ENSMUSP00000127941; Gene: ENSMUSG00000026288; AA Change: L566Q

Domain	Start	End	E-Value	Type
SH2	6	95	4.6e-31	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	2.2e-106	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	955	980	N/A	INTRINSIC
low complexity region	1046	1058	N/A	INTRINSIC
low complexity region	1120	1132	N/A	INTRINSIC
low complexity region	1140	1149	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000169754)
• SMART Domains: Protein: ENSMUSP00000132384; Gene: ENSMUSG00000026288; AA Change: L303Q

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	796	808	N/A	INTRINSIC
low complexity region	816	825	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000170300)
• Meta Mutation Damage Score: 0.9048
• Is this an essential gene?: Probably essential (E-score: 0.929)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2020-05-29 3:35 PM by Thomas Gallagher
• Record Created: 2018-08-31 8:57 AM by Bruce Beutler
• Record Posted: 2019-02-14
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, Zhao Zhang, Roberto Pontes, Bruce Beutler

Accession Number

NCBI RefSeq: NM_010566; NM_001110192, NM_001110193; MGI: 107357

Alleles Listed at MGI

All Mutations and Alleles(67) : Chemically induced (ENU)(5) Chemically induced (other)(1) Gene trapped(53) Radiation induced(1) Targeted(7)

Phenotypic Description

Figure 1. Pantone mice exhibit decreased heart rates. Normalized average heart rate data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Pantone mice exhibit reduced body weights. Scaled weights are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Pantone mice exhibit decreased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Pantone mice exhibit decreased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Pantone mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Pantone mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Pantone mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Pantone mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Pantone mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Pantone mice exhibit decreased frequencies of peripheral naïve CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Pantone mice exhibit decreased frequencies of peripheral naïve CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Pantone mice exhibit decreased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Pantone mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Pantone mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 15. Pantone mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 16. Pantone mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 17. Pantone mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 18. Pantone mice exhibit increased expression of CD44 on T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 mean fluorescence intensity. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 19. Pantone mice exhibit increased expression of CD44 on CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 mean fluorescence intensity. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The pantone phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6371, some of which showed reduced heart rates (Figure 1) and reduced body weights (Figure 2). Some mice also showed reduced B to T cell ratios (Figure 3) and CD4 to CD8 T cell ratios (Figure 4) as well as reduced frequencies of B cells (Figure 5), T cells (Figure 6), CD4+ T cells (Figure 7), CD4+ T cells in CD3+ T cells (Figure 8), CD8+ T cells (Figure 9), naïve CD4 T cells in CD4 T cells (Figure 10), naïve CD8 T cells in CD8 T cells (Figure 11), and NK cells (Figure 12) with concomitant increased frequencies of B1 cells (Figure 13), CD8+ T cells in CD3+ T cells (Figure 14), central memory CD8 T cells in CD8 T cells (Figure 15), effector memory CD4 T cells in CD4 T cells (Figure 16), and effector memory CD8 T cells in CD8 T cells (Figure 17). Expression of CD44 on peripheral blood T cells (Figure 18) and CD8+ T cells (Figure 19) was increased.

Nature of Mutation

Figure 20. Linkage mapping of the reduced B cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 50 mutations (X-axis) identified in the G1 male of pedigree R6371. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 50 mutations. All of the above phenotypes were linked a mutation in Inpp5d: a T to A transversion at base pair 87,699,675 (v38) on chromosome 1, or base pair or 79,364 in the GenBank genomic region NC_000067. The strongest association was found with a recessive model of inheritance to reduced B cell frequency phenotype, wherein 10 homozygous variants departed phenotypically from 22 homozygous reference mice and 38 heterozygous mice with a P value of 6.934 x 10^-21 (Figure 20).

The mutation corresponds to residue 1,874 in the mRNA sequence NM_010566 within exon 15 of 27 total exons.

1858 AACATCCTGCGGTTCCTGGCCCTGGGAGACAAG 561  -N--I--L--R--F--L--A--L--G--D--K-

The mutated nucleotide is indicated in red. The mutation results in a leucine to glutamine substitution at amino acid 566 (L566Q) in the SHIP-1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999).

Protein Prediction

Figure 21. Domain structure of SHIP protein isoforms. SHIPβ and SHIPδ arise from alternative splicing that occurs adjacent to the first NPXY motif. SHIPβ arises from in-frame splicing, while SHIPδ arises from out-of-frame splicing that results in an alternative C-terminal domain. The sSHIP isoform has an alternative promoter. The SH2 containing isoforms have been shown to be expressed in differentiated hematopoietic cells, mouse embyronic fibroblasts (MEF) and vascular endothelial cells. The sSHIP isoform is expressed by embryonic stem (ES) cells and HSC. Full-length SHIP is also expressed in HSC. Other potential isoforms have been described (not shown). The pantone mutation results in a leucine to glutamine substitution at amino acid 566 (L566Q). The image is interactive. Other Inpp5d mutations are noted in red. Click on each allele for more information.

Inpp5d encodes SHIP-1, an 1191-amino acid Src homology 2 (SH2) domain-containing inositol polyphosphate 5-phosphatase (Figure 21). The SHIP-1 (hereafter SHIP) protein contains an N-terminal SH2 domain (residues 8-100), two centrally located inositol polyphosphate 5-phosphatase motifs (residues 585-596 and 667-694), two NPXY motifs that, if phosphorylated, could be bound by phosphotyrosine-binding (PTB) domains (residues 913-917 and 1016-1020), and a C-terminal proline-rich domain with several SH3 binding motifs. The pantone mutation results in a leucine to glutamine substitution at amino acid 566 (L566Q) in the SHIP-1 protein; amino acid 566 is within an undefined region of SHIP-1 preceding the inositol polyphosphate 5-phosphatase motifs. The pantone mutation is predicted to affect all of the SHIP isoforms (Figure 21).

Please see the record styx Salamander for information about Inpp5d.

Putative Mechanism

In hematolymphoid cells, SHIP can be recruited to a wide variety of receptor complexes including growth factor receptors and immune receptors. SHIP is recruited to receptor-associated signaling complexes via adaptors (e.g. Shc, Grb2, Dok3), scaffold proteins like Gab1 or directly via its SH2 domain. After recruitment to the plasma membrane, SHIP can then hydrolyze PIP₃. Hydrolysis of PIP₃ inhibits recruitment of PH domain containing kinases like Akt, Btk (Bruton’s tyrosine kinase), and phospholipase C (PLC)-γ to the plasma membrane and thus limits the activity of several different PI3K effectors that promote cell survival, migration, differentiation or proliferation. These include distal kinases like MAP/ERK, JNK/SAPK, p38 MAPK and key transcription factors such as NF-κB and NFAT.

Inpp5d knockout mice [MGI:2386884; (1;2)] and myeloid-specific conditional knockout mice [MGI:3715983; (3)] exhibit reduced levels of B cells. The changes in B cell number was attributed to high levels of the cytokine interleukin-6 (IL-6), which directly contributes to the reduced level of B cells seen in these mice as IL-6 is known to inhibit B cell development while enhancing myeloid cell development (1). In addition to the expansion of other myeloid cell types, SHIP-deficient animals carry large numbers of myeloid suppressor cells that are potent antagonists of allogeneic T cell activation by host APCs in vitro (4). In addition, SHIP-deficient T cells do not produce a type 2 T helper (Th2) response, which is important in determining B cell antibody class switching, when exposed to the proper stimuli (5). An ENU-induced model with a mutation in Inpp5d [Iso651Thr; MGI:5050823; (6)] exhibited decreased levels of double-positive thymocytes and a reduced number of circulating lymphocytes. This study determined that a SHIP1 isoform expressed in stem and progenitor cells (s-SHIP), and lost upon the ENU-induced mutation, is necessary for SHIP1 function in hematopoiesis (6).

The phenotypes observed in the pantone mice indicates loss of SHIP-1-associated function.

Primers

PCR Primer
pantone_pcr_F: ATGGGTAGATTCCTGCATGG
pantone_pcr_R: TGATTTTCTGTCCACAGCCGAC

Sequencing Primer
pantone_seq_F: ATGGAATCTAGACTCTGTGTTCCCAG
pantone_seq_R: GACTCCTGAGAGCCTCTGTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 404 nucleotides is amplified (chromosome 1, + strand):

1   atgggtagat tcctgcatgg aatctagact ctgtgttccc agttgggttt cccagacaca
61  ctcaggtgac cactgggaca gagcttgagt ctaagtctct gtttcccacc tgttgcctct
121 gacttcctac tgtcagatca aggacagtac ccatgctaga tgtgctagat ggcccttgtt
181 ttcttgaatt aggagaaatc aaaactatat gaacatcctg cggttcctgg ccctgggaga
241 caagaagcta agcccattta acatcaccca ccgcttcacc cacctcttct ggcttgggga
301 tctcaactac cgcgtggagc tgcccacttg ggtaaggaga ctccaccttg ggtcgagcca
361 taggggacag aggctctcag gagtcggctg tggacagaaa atca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Nakamura, K., Kouro, T., Kincade, P. W., Malykhin, A., Maeda, K., and Coggeshall, K. M. (2004) Src Homology 2-Containing 5-Inositol Phosphatase (SHIP) Suppresses an Early Stage of Lymphoid Cell Development through Elevated Interleukin-6 Production by Myeloid Cells in Bone Marrow. J Exp Med. 199, 243-254.

  2. Maeda, K., Baba, Y., Nagai, Y., Miyazaki, K., Malykhin, A., Nakamura, K., Kincade, P. W., Sakaguchi, N., and Coggeshall, K. M. (2005) IL-6 Blocks a Discrete Early Step in Lymphopoiesis. Blood. 106, 879-885.

  3. Karlsson, M. C., Guinamard, R., Bolland, S., Sankala, M., Steinman, R. M., and Ravetch, J. V. (2003) Macrophages Control the Retention and Trafficking of B Lymphocytes in the Splenic Marginal Zone. J Exp Med. 198, 333-340.

  4. Ghansah, T., Paraiso, K. H., Highfill, S., Desponts, C., May, S., McIntosh, J. K., Wang, J. W., Ninos, J., Brayer, J., Cheng, F., Sotomayor, E., and Kerr, W. G. (2004) Expansion of Myeloid Suppressor Cells in SHIP-Deficient Mice Represses Allogeneic T Cell Responses. J Immunol. 173, 7324-7330.

  5. Tarasenko, T., Kole, H. K., Chi, A. W., Mentink-Kane, M. M., Wynn, T. A., and Bolland, S. (2007) T Cell-Specific Deletion of the Inositol Phosphatase SHIP Reveals its Role in Regulating Th1/Th2 and Cytotoxic Responses. Proc Natl Acad Sci U S A. 104, 11382-11387.

  6. Nguyen, N. Y., Maxwell, M. J., Ooms, L. M., Davies, E. M., Hilton, A. A., Collinge, J. E., Hilton, D. J., Kile, B. T., Mitchell, C. A., Hibbs, M. L., Jane, S. M., and Curtis, D. J. (2011) An ENU-Induced Mouse Mutant of SHIP1 Reveals a Critical Role of the Stem Cell Isoform for Suppression of Macrophage Activation. Blood. 117, 5362-5371.