Phenotypic Mutation 'Haddock' (pdf version)
AlleleHaddock
Mutation Type missense
Chromosome2
Coordinate117,291,895 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Rasgrp1
Gene Name RAS guanyl releasing protein 1
Chromosomal Location 117,279,993-117,343,001 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous and targeted null mutations exhibit a lymphoproliferative autoimmune syndrome in which T cells fail to activate Ras or proliferate after antigen exposure, defects in positive selection, and enlarged spleen and lymph nodes. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011246; MGI:1314635

Mapped Yes 
Amino Acid Change Aspartic acid changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000099593] [ENSMUSP00000133449] [ENSMUSP00000134592] [ENSMUSP00000134027] [ENSMUSP00000134167] [ENSMUSP00000136423]
SMART Domains Protein: ENSMUSP00000099593
Gene: ENSMUSG00000027347
AA Change: D338G

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
Pfam:EF-hand_6 474 502 5e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Predicted Effect possibly damaging

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
(Using ENSMUST00000102534)
SMART Domains Protein: ENSMUSP00000133449
Gene: ENSMUSG00000027347
AA Change: D338G

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_6 442 467 1.2e-5 PFAM
C1 507 556 5.77e-16 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
(Using ENSMUST00000172901)
SMART Domains Protein: ENSMUSP00000134592
Gene: ENSMUSG00000027347
AA Change: D338G

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_6 442 467 1.1e-5 PFAM
Pfam:C1_1 507 539 3.4e-8 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
(Using ENSMUST00000173252)
SMART Domains Protein: ENSMUSP00000134027
Gene: ENSMUSG00000027347
AA Change: D338G

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 441 464 1.6e-5 PFAM
Pfam:EF-hand_6 442 467 1.6e-5 PFAM
C1 507 556 5.77e-16 SMART
PDB:4L9U|B 705 756 2e-23 PDB
Predicted Effect probably benign

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
(Using ENSMUST00000173541)
SMART Domains Protein: ENSMUSP00000134167
Gene: ENSMUSG00000027347
AA Change: D338G

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
(Using ENSMUST00000174770)
SMART Domains Protein: ENSMUSP00000136423
Gene: ENSMUSG00000027347
AA Change: D338G

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Predicted Effect possibly damaging

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
(Using ENSMUST00000178884)
Meta Mutation Damage Score 0.0983 question?
Is this an essential gene? Possibly nonessential (E-score: 0.414) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD44+ CD4 MFI - increased
FACS CD44+ T MFI - increased
Candidate Explorer Status CE: excellent candidate; human score: 2; ML prob: 0.54
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(5) Chemically induced (other)(1) Radiation induced(1) Spontaneous(1) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Rasgrp1 APN 2 117305791 nonsense probably null
IGL00901:Rasgrp1 APN 2 117285130 missense probably damaging 0.96
IGL01083:Rasgrp1 APN 2 117285068 missense probably benign 0.22
IGL01325:Rasgrp1 APN 2 117298529 missense probably damaging 1.00
IGL01520:Rasgrp1 APN 2 117288663 missense probably damaging 1.00
IGL01776:Rasgrp1 APN 2 117286840 critical splice donor site probably null
IGL01780:Rasgrp1 APN 2 117284878 missense probably benign 0.00
IGL01859:Rasgrp1 APN 2 117289418 missense probably benign 0.00
IGL01892:Rasgrp1 APN 2 117293842 missense probably damaging 1.00
IGL02068:Rasgrp1 APN 2 117300578 splice site probably benign
IGL02684:Rasgrp1 APN 2 117282576 missense probably benign 0.03
bukhansan UTSW 2 117291697 missense possibly damaging 0.78
grouper UTSW 2 117302004 nonsense probably null
gyeryandsan UTSW 2 117287943 missense probably damaging 1.00
naejangsan UTSW 2 117291792 nonsense probably null
sea_bass UTSW 2 117282654 missense probably benign 0.02
venutian UTSW 2 117284929 nonsense probably null
R0067:Rasgrp1 UTSW 2 117294820 missense probably damaging 1.00
R0067:Rasgrp1 UTSW 2 117294820 missense probably damaging 1.00
R0538:Rasgrp1 UTSW 2 117284947 missense probably benign 0.42
R0786:Rasgrp1 UTSW 2 117300499 missense probably benign
R1068:Rasgrp1 UTSW 2 117282576 missense probably benign 0.03
R1165:Rasgrp1 UTSW 2 117284939 missense possibly damaging 0.49
R1491:Rasgrp1 UTSW 2 117282619 nonsense probably null
R1707:Rasgrp1 UTSW 2 117298547 missense probably damaging 1.00
R1869:Rasgrp1 UTSW 2 117290347 missense probably damaging 1.00
R2214:Rasgrp1 UTSW 2 117285165 missense probably damaging 0.98
R2425:Rasgrp1 UTSW 2 117289450 critical splice acceptor site probably null
R3236:Rasgrp1 UTSW 2 117291812 missense probably benign 0.00
R3915:Rasgrp1 UTSW 2 117288641 missense probably damaging 1.00
R4079:Rasgrp1 UTSW 2 117285029 missense probably benign 0.19
R4163:Rasgrp1 UTSW 2 117282654 missense probably benign 0.02
R4781:Rasgrp1 UTSW 2 117291709 missense probably benign 0.04
R4782:Rasgrp1 UTSW 2 117284875 missense probably benign 0.00
R5028:Rasgrp1 UTSW 2 117302004 nonsense probably null
R6019:Rasgrp1 UTSW 2 117291895 missense probably damaging 0.99
R6220:Rasgrp1 UTSW 2 117284929 nonsense probably null
R6294:Rasgrp1 UTSW 2 117291792 nonsense probably null
R6335:Rasgrp1 UTSW 2 117293870 missense probably damaging 0.99
R6948:Rasgrp1 UTSW 2 117298604 missense probably damaging 0.99
R7165:Rasgrp1 UTSW 2 117338404 missense probably benign 0.02
R7246:Rasgrp1 UTSW 2 117338354 nonsense probably null
R7372:Rasgrp1 UTSW 2 117285154 missense probably benign 0.01
R7400:Rasgrp1 UTSW 2 117298545 missense probably damaging 1.00
R7432:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7448:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7448:Rasgrp1 UTSW 2 117291697 missense possibly damaging 0.78
R7449:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7450:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7475:Rasgrp1 UTSW 2 117286108 missense probably benign
R7487:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7573:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R7672:Rasgrp1 UTSW 2 117287943 missense probably damaging 1.00
R8016:Rasgrp1 UTSW 2 117287833 nonsense probably null
Z1176:Rasgrp1 UTSW 2 117301974 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:34 PM by Diantha La Vine
Record Created 2018-09-03 5:37 PM by Bruce Beutler
Record Posted 2018-10-16
Phenotypic Description

Figure 1. Haddock mice exhibit increased expression of CD44 on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Haddock mice exhibit increased expression of CD44 on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Haddock phenotype was identified among G3 mice of the pedigree R6019, some of which showed increased expression of CD44 on peripheral blood T cells (Figure 1) and CD4+ T cells (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of increased CD44 expression on CD4+ T cells using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 84 mutations (X-axis) identified in the G1 male of pedigree R6019. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 84 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in three genes on chromosome 2: Rasgrp1, Stard9, and Gm14025. The Rasgrp1 was presumed causative as the immunological phenotypes observed in the Haddock mice mimic those found in other Rasgrp1 alleles (see grouper and MGI [accessed September 20, 2017]). The mutation in Rasgrp1 is an A to G transition at base pair 117,291,895 (v38) on chromosome 2, or base pair 50,983 in the GenBank genomic region NC_000068 encoding Rasgrp1. The strongest association was found with a dominant model of inheritance to the normalized CD44 expression on CD4+ T cells, wherein four variant homozygotes and nine heterozygous mice departed phenotypically from 10 homozygous reference mice with a P value of 6.302 x 10-10 (Figure 3).  

 

The mutation corresponds to residue 1,181 in the mRNA sequence NM_011246 within exon 9 of 17 total exons.

 

1165 TCCTGCAGAAACTATGACAACTACAGGCGAGCC

333  -S--C--R--N--Y--D--N--Y--R--R--A-

 

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to glycine substitution at position 338 (D338G) in the RasGRP1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.948).

Protein Prediction
Figure 4. Domain structure of RasGRP1. Domain information is from SMART and UniProt. The Haddock mutation results in an aspartic acid to glycine substitution at position 338. This image is interactive. Click on each mutation for more information.

Ras guanine-releasing protein 1 (RasGRP1) is a member of the Ras guanine nucleotide exchange factor (RasGEF) family. All of the RasGRPs have a central catalytic core, two EF hands, and a C1 domain (1-3). The catalytic domain of the RasGEF proteins can be subdivided into a Cdc25/GEF domain and a Ras exchanger motif (REM). The C-terminus of RasGRP1 after the C1 domain contains an unstructured region and a predicted coiled coil (3). Beaulieu and colleagues have designated the coiled-coil region as a plasma membrane targeter (PT) domain (4). In addition, a portion of the unstructured region adjacent to the PT domain was designated as a suppressor of PT (SuPT) domain.

 

The Haddock mutation results in an aspartic acid to glycine substitution at position 338 (D338G); amino acid 338 is within the Cdc25/GEF domain.

 

Please see the record grouper for more information about Rasgrp1.

Putative Mechanism

The RAS proteins are switches that cycle between inactive GDP (Ras-GDP)- and active GTP (Ras-GTP)-bound states. RasGEFs (e.g., RasGRP1, RasGRP3 [see the record for Aster], and SOS) function as RAS activators by maintaining the active GTP-bound state. In contrast, Ras GTPase-activating proteins (RasGAPs) promote GTP hydroloysis, subsequently returning Ras-GTP to an inactive state. RAS-associated signaling (e.g., the Ras-RAF-MEK-ERK pathway) regulates several functions including cell proliferation, differentiation, and apoptosis as well as the development and activity of lymphocytes. 

 

RasGRP1 is essential for activation of the ERK/MAPK signaling cascade in T cells, the regulation of T- and B-cell development, and B cell proliferation as well as T cell homeostasis, survival, differentiation, and proliferation (5-13). RasGRP1 also functions in the Ras-MAPK signaling pathway in NK cells, which subsequently leads to NK effector functions (14).Grb2 and DAG recruit SOS and RasGRP1, respectively, to the membrane after T cell receptor stimulation (5). At the membrane, RasGRP1 and SOS associate with membrane-anchored Ras. RasGRP1 primes SOS for activation by initiating an initial burst of Ras•GTP (15).

 

Low levels of RasGRP1 as well as expression of aberrant RASGRP1 transcripts in T cells in humans are putatively associated with the development of autoimmunity in a subset of systemic lupus erythematosus patients (16). Increased levels of RASGRP1 are often found in pediatric T cell leukemia where it stimulates growth (17;18). Mutations in RASGRP1 have been associated with autoimmune diabetes  (19;20). A mutation in RASGRP1 was linked to a case of immunodeficiency (21). The patient with RasGRP1-associated immunodeficiency showed recurrent infections and failure to thrive as well as a progressive reduction in the number of CD4+ T cells, an increased relative proportion of TCRγδ cells, a progressive decline in the number of B cells, and developed a low-grade Epstein-Barr virus (EBV)-associated B cell lymphoma. NK cells from the patient showed impaired cytotoxicity with defective granule convergence and actin accumulation.

 

Rasgrp1-deficient (Rasgrp1-/-) mice had increased numbers of CD8+ γδT cells in the peripheral lymphoid organs; γδT cell numbers in the thymus were comparable to that in wild-type mice. RasGRP1-deficient γδT cells were defective in proliferation following TCR stimulation and showed impaired IL-17 production. Rasgrp1-/- mice showed impaired CD4 Treg development in the thymus, but increased CD4+Foxp3+ Treg cells in the periphery (22). Also, the Rasgrp1-/- mice showed increased numbers of CD8+CD44highCD122+ T cells in the spleen. Rasgrp1-/- mice did not mount anaphylactic allergic reactions. Mast cells from the Rasgrp1-/- mice showed reduced degranulation and cytokine production as well as aberrant granule translocation, microtubule formation and Rho activation. Rasgrp1-/- mice exhibited reduced numbers of peripheral B cells, CD4+ T cells, CD8+ T cells, and invariant NKT cells with concomitant increased numbers of CD4+ T cells with activated memory phenotype (6;13;23-26). The Rasgrp1-/- mice exhibited enlarged spleens, increased levels of IgE and IgG1, and increased levels of autoantibody (13;23).

 

The phenotype of the Haddock mice indicates loss of RasGRP1-associated function.

Primers PCR Primer
Haddock_pcr_F: GCAGCTGGACCAATTCATTG
Haddock_pcr_R: TACCCTCTGACATTTGATGTAGCTG

Sequencing Primer
Haddock_seq_F: GCAGCTGGACCAATTCATTGATATG
Haddock_seq_R: TTGGGGAGTTGTAGTAGATACTAAC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 408 nucleotides is amplified (chromosome 2, - strand):


1   taccctctga catttgatgt agctggagtt ttagttgggg agttgtagta gatactaact
61  agatgtatca ctcactatcc aacatatgag agatggagta aaaccgtggc aggcataaga
121 gtggctgcta caggcagtat actaggccct gcgggtgcca gtgaccgatc tgttctgctt
181 tgtaggttct gggcgagatg actgaactgc tgtcctcctg cagaaactat gacaactaca
241 ggcgagccta tggggagtgc acccacttca aaatccccat actgggtgtg cacctcaagg
301 acctcatatc cctgtatgag gctatgcccg actatctgga agatgggaag gtgaatgtcc
361 aaaagctcct ggccctttac aatcatatca atgaattggt ccagctgc


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler