Phenotypic Mutation 'Haddock'

• Allele: Haddock
• Mutation Type: missense
• Chromosome: 2
• Coordinate: 117,122,376 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Rasgrp1
• Gene Name: RAS guanyl releasing protein 1
• Chromosomal Location: 117,110,464-117,173,358 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for spontaneous and targeted null mutations exhibit a lymphoproliferative autoimmune syndrome in which T cells fail to activate Ras or proliferate after antigen exposure, defects in positive selection, and enlarged spleen and lymph nodes. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000099593] [ENSMUSP00000133449] [ENSMUSP00000134592] [ENSMUSP00000134027] [ENSMUSP00000134167] [ENSMUSP00000136423]
• AlphaFold: Q9Z1S3
• SMART Domains: Protein: ENSMUSP00000099593; Gene: ENSMUSG00000027347; AA Change: D338G

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
Pfam:EF-hand_6	474	502	5e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U|B	740	791	2e-23	PDB

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
  (Using ENSMUST00000102534)
• SMART Domains: Protein: ENSMUSP00000133449; Gene: ENSMUSG00000027347; AA Change: D338G

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.2e-5	PFAM
C1	507	556	5.77e-16	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
  (Using ENSMUST00000172901)
• SMART Domains: Protein: ENSMUSP00000134592; Gene: ENSMUSG00000027347; AA Change: D338G

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.1e-5	PFAM
Pfam:C1_1	507	539	3.4e-8	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
  (Using ENSMUST00000173252)
• SMART Domains: Protein: ENSMUSP00000134027; Gene: ENSMUSG00000027347; AA Change: D338G

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	441	464	1.6e-5	PFAM
Pfam:EF-hand_6	442	467	1.6e-5	PFAM
C1	507	556	5.77e-16	SMART
PDB:4L9U|B	705	756	2e-23	PDB

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
  (Using ENSMUST00000173541)
• SMART Domains: Protein: ENSMUSP00000134167; Gene: ENSMUSG00000027347; AA Change: D338G

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
  (Using ENSMUST00000174770)
• SMART Domains: Protein: ENSMUSP00000136423; Gene: ENSMUSG00000027347; AA Change: D338G

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U|B	740	791	2e-23	PDB

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
  (Using ENSMUST00000178884)
• Meta Mutation Damage Score: 0.0983
• Is this an essential gene?: Possibly nonessential (E-score: 0.270)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:34 PM by Diantha La Vine
• Record Created: 2018-09-03 5:37 PM by Bruce Beutler
• Record Posted: 2018-10-16
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_011246; MGI:1314635

Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(5) Chemically induced (other)(1) Radiation induced(1) Spontaneous(1) Targeted(5)

Phenotypic Description

Figure 1. Haddock mice exhibit increased expression of CD44 on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Haddock mice exhibit increased expression of CD44 on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Haddock phenotype was identified among G3 mice of the pedigree R6019, some of which showed increased expression of CD44 on peripheral blood T cells (Figure 1) and CD4+ T cells (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of increased CD44 expression on CD4+ T cells using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 84 mutations (X-axis) identified in the G1 male of pedigree R6019. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 84 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in three genes on chromosome 2: Rasgrp1, Stard9, and Gm14025. The Rasgrp1 was presumed causative as the immunological phenotypes observed in the Haddock mice mimic those found in other Rasgrp1 alleles (see grouper and MGI [accessed September 20, 2017]). The mutation in Rasgrp1 is an A to G transition at base pair 117,291,895 (v38) on chromosome 2, or base pair 50,983 in the GenBank genomic region NC_000068 encoding Rasgrp1. The strongest association was found with a dominant model of inheritance to the normalized CD44 expression on CD4+ T cells, wherein four variant homozygotes and nine heterozygous mice departed phenotypically from 10 homozygous reference mice with a P value of 6.302 x 10^-10 (Figure 3).  

The mutation corresponds to residue 1,181 in the mRNA sequence NM_011246 within exon 9 of 17 total exons.

1165 TCCTGCAGAAACTATGACAACTACAGGCGAGCC 333  -S--C--R--N--Y--D--N--Y--R--R--A-

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to glycine substitution at position 338 (D338G) in the RasGRP1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.948).

Protein Prediction

Figure 4. Domain structure of RasGRP1. Domain information is from SMART and UniProt. The Haddock mutation results in an aspartic acid to glycine substitution at position 338. This image is interactive. Click on each mutation for more information.

Ras guanine-releasing protein 1 (RasGRP1) is a member of the Ras guanine nucleotide exchange factor (RasGEF) family. All of the RasGRPs have a central catalytic core, two EF hands, and a C1 domain (1-3). The catalytic domain of the RasGEF proteins can be subdivided into a Cdc25/GEF domain and a Ras exchanger motif (REM). The C-terminus of RasGRP1 after the C1 domain contains an unstructured region and a predicted coiled coil (3). Beaulieu and colleagues have designated the coiled-coil region as a plasma membrane targeter (PT) domain (4). In addition, a portion of the unstructured region adjacent to the PT domain was designated as a suppressor of PT (SuPT) domain.

The Haddock mutation results in an aspartic acid to glycine substitution at position 338 (D338G); amino acid 338 is within the Cdc25/GEF domain.

Please see the record grouper for more information about Rasgrp1.

Putative Mechanism

The RAS proteins are switches that cycle between inactive GDP (Ras-GDP)- and active GTP (Ras-GTP)-bound states. RasGEFs (e.g., RasGRP1, RasGRP3 [see the record for Aster], and SOS) function as RAS activators by maintaining the active GTP-bound state. In contrast, Ras GTPase-activating proteins (RasGAPs) promote GTP hydroloysis, subsequently returning Ras-GTP to an inactive state. RAS-associated signaling (e.g., the Ras-RAF-MEK-ERK pathway) regulates several functions including cell proliferation, differentiation, and apoptosis as well as the development and activity of lymphocytes. 

RasGRP1 is essential for activation of the ERK/MAPK signaling cascade in T cells, the regulation of T- and B-cell development, and B cell proliferation as well as T cell homeostasis, survival, differentiation, and proliferation (5-13). RasGRP1 also functions in the Ras-MAPK signaling pathway in NK cells, which subsequently leads to NK effector functions (14).Grb2 and DAG recruit SOS and RasGRP1, respectively, to the membrane after T cell receptor stimulation (5). At the membrane, RasGRP1 and SOS associate with membrane-anchored Ras. RasGRP1 primes SOS for activation by initiating an initial burst of Ras•GTP (15).

Low levels of RasGRP1 as well as expression of aberrant RASGRP1 transcripts in T cells in humans are putatively associated with the development of autoimmunity in a subset of systemic lupus erythematosus patients (16). Increased levels of RASGRP1 are often found in pediatric T cell leukemia where it stimulates growth (17;18). Mutations in RASGRP1 have been associated with autoimmune diabetes  (19;20). A mutation in RASGRP1 was linked to a case of immunodeficiency (21). The patient with RasGRP1-associated immunodeficiency showed recurrent infections and failure to thrive as well as a progressive reduction in the number of CD4+ T cells, an increased relative proportion of TCRγδ cells, a progressive decline in the number of B cells, and developed a low-grade Epstein-Barr virus (EBV)-associated B cell lymphoma. NK cells from the patient showed impaired cytotoxicity with defective granule convergence and actin accumulation.

Rasgrp1-deficient (Rasgrp1^-/-) mice had increased numbers of CD8+ γδT cells in the peripheral lymphoid organs; γδT cell numbers in the thymus were comparable to that in wild-type mice. RasGRP1-deficient γδT cells were defective in proliferation following TCR stimulation and showed impaired IL-17 production. Rasgrp1^-/- mice showed impaired CD4 T_reg development in the thymus, but increased CD4⁺Foxp3⁺ T_reg cells in the periphery (22). Also, the Rasgrp1^-/- mice showed increased numbers of CD8⁺CD44^highCD122⁺ T cells in the spleen. Rasgrp1^-/- mice did not mount anaphylactic allergic reactions. Mast cells from the Rasgrp1^-/- mice showed reduced degranulation and cytokine production as well as aberrant granule translocation, microtubule formation and Rho activation. Rasgrp1^-/- mice exhibited reduced numbers of peripheral B cells, CD4+ T cells, CD8+ T cells, and invariant NKT cells with concomitant increased numbers of CD4+ T cells with activated memory phenotype (6;13;23-26). The Rasgrp1^-/- mice exhibited enlarged spleens, increased levels of IgE and IgG1, and increased levels of autoantibody (13;23).

The phenotype of the Haddock mice indicates loss of RasGRP1-associated function.

Primers

PCR Primer
Haddock_pcr_F: GCAGCTGGACCAATTCATTG
Haddock_pcr_R: TACCCTCTGACATTTGATGTAGCTG

Sequencing Primer
Haddock_seq_F: GCAGCTGGACCAATTCATTGATATG
Haddock_seq_R: TTGGGGAGTTGTAGTAGATACTAAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 408 nucleotides is amplified (chromosome 2, - strand):

1   taccctctga catttgatgt agctggagtt ttagttgggg agttgtagta gatactaact
61  agatgtatca ctcactatcc aacatatgag agatggagta aaaccgtggc aggcataaga
121 gtggctgcta caggcagtat actaggccct gcgggtgcca gtgaccgatc tgttctgctt
181 tgtaggttct gggcgagatg actgaactgc tgtcctcctg cagaaactat gacaactaca
241 ggcgagccta tggggagtgc acccacttca aaatccccat actgggtgtg cacctcaagg
301 acctcatatc cctgtatgag gctatgcccg actatctgga agatgggaag gtgaatgtcc
361 aaaagctcct ggccctttac aatcatatca atgaattggt ccagctgc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Johnson, J. E., Goulding, R. E., Ding, Z., Partovi, A., Anthony, K. V., Beaulieu, N., Tazmini, G., Cornell, R. B., and Kay, R. J. (2007) Differential Membrane Binding and Diacylglycerol Recognition by C1 Domains of RasGRPs. Biochem J. 406, 223-236.

  2. Lorenzo, P. S., Kung, J. W., Bottorff, D. A., Garfield, S. H., Stone, J. C., and Blumberg, P. M. (2001) Phorbol Esters Modulate the Ras Exchange Factor RasGRP3. Cancer Res. 61, 943-949.

  3. Ebinu, J. O., Bottorff, D. A., Chan, E. Y., Stang, S. L., Dunn, R. J., and Stone, J. C. (1998) RasGRP, a Ras Guanyl Nucleotide- Releasing Protein with Calcium- and Diacylglycerol-Binding Motifs. Science. 280, 1082-1086.

  4. Beaulieu, N., Zahedi, B., Goulding, R. E., Tazmini, G., Anthony, K. V., Omeis, S. L., de Jong, D. R., and Kay, R. J. (2007) Regulation of RasGRP1 by B Cell Antigen Receptor Requires Cooperativity between Three Domains Controlling Translocation to the Plasma Membrane. Mol Biol Cell. 18, 3156-3168.

  5. Ebinu, J. O., Stang, S. L., Teixeira, C., Bottorff, D. A., Hooton, J., Blumberg, P. M., Barry, M., Bleakley, R. C., Ostergaard, H. L., and Stone, J. C. (2000) RasGRP Links T-Cell Receptor Signaling to Ras. Blood. 95, 3199-3203.

  6. Dower, N. A., Stang, S. L., Bottorff, D. A., Ebinu, J. O., Dickie, P., Ostergaard, H. L., and Stone, J. C. (2000) RasGRP is Essential for Mouse Thymocyte Differentiation and TCR Signaling. Nat Immunol. 1, 317-321.

  7. Roose, J. P., Mollenauer, M., Gupta, V. A., Stone, J., and Weiss, A. (2005) A Diacylglycerol-Protein Kinase C-RasGRP1 Pathway Directs Ras Activation upon Antigen Receptor Stimulation of T Cells. Mol Cell Biol. 25, 4426-4441.

  8. Priatel, J. J., Chen, X., Dhanji, S., Abraham, N., and Teh, H. S. (2006) RasGRP1 Transmits Prodifferentiation TCR Signaling that is Crucial for CD4 T Cell Development. J Immunol. 177, 1470-1480.

  9. Priatel, J. J., Teh, S. J., Dower, N. A., Stone, J. C., and Teh, H. S. (2002) RasGRP1 Transduces Low-Grade TCR Signals which are Critical for T Cell Development, Homeostasis, and Differentiation. Immunity. 17, 617-627.

  10. Golec, D. P., Henao Caviedes, L. M., and Baldwin, T. A. (2016) RasGRP1 and RasGRP3 are Required for Efficient Generation of Early Thymic Progenitors. J Immunol. 197, 1743-1753.

  11. Golec, D. P., Hoeppli, R. E., Henao Caviedes, L. M., McCann, J., Levings, M. K., and Baldwin, T. A. (2017) Thymic Progenitors of TCRalphabeta(+) CD8alphaalpha Intestinal Intraepithelial Lymphocytes Require RasGRP1 for Development. J Exp Med. 214, 2421-2435.

  12. Priatel, J. J., Chen, X., Huang, Y. H., Chow, M. T., Zenewicz, L. A., Coughlin, J. J., Shen, H., Stone, J. C., Tan, R., and Teh, H. S. (2010) RasGRP1 Regulates Antigen-Induced Developmental Programming by Naive CD8 T Cells. J Immunol. 184, 666-676.

  13. Coughlin, J. J., Stang, S. L., Dower, N. A., and Stone, J. C. (2005) RasGRP1 and RasGRP3 Regulate B Cell Proliferation by Facilitating B Cell Receptor-Ras Signaling. J Immunol. 175, 7179-7184.

  14. Lee, S. H., Yun, S., Lee, J., Kim, M. J., Piao, Z. H., Jeong, M., Chung, J. W., Kim, T. D., Yoon, S. R., Greenberg, P. D., and Choi, I. (2009) RasGRP1 is Required for Human NK Cell Function. J Immunol. 183, 7931-7938.

  15. Roose, J. P., Mollenauer, M., Ho, M., Kurosaki, T., and Weiss, A. (2007) Unusual Interplay of Two Types of Ras Activators, RasGRP and SOS, Establishes Sensitive and Robust Ras Activation in Lymphocytes. Mol Cell Biol. 27, 2732-2745.

  16. Yasuda, S., Stevens, R. L., Terada, T., Takeda, M., Hashimoto, T., Fukae, J., Horita, T., Kataoka, H., Atsumi, T., and Koike, T. (2007) Defective Expression of Ras Guanyl Nucleotide-Releasing Protein 1 in a Subset of Patients with Systemic Lupus Erythematosus. J Immunol. 179, 4890-4900.

  17. Oki, T., Kitaura, J., Watanabe-Okochi, N., Nishimura, K., Maehara, A., Uchida, T., Komeno, Y., Nakahara, F., Harada, Y., Sonoki, T., Harada, H., and Kitamura, T. (2012) Aberrant Expression of RasGRP1 Cooperates with Gain-of-Function NOTCH1 Mutations in T-Cell Leukemogenesis. Leukemia. 26, 1038-1045.

  18. Hartzell, C., Ksionda, O., Lemmens, E., Coakley, K., Yang, M., Dail, M., Harvey, R. C., Govern, C., Bakker, J., Lenstra, T. L., Ammon, K., Boeter, A., Winter, S. S., Loh, M., Shannon, K., Chakraborty, A. K., Wabl, M., and Roose, J. P. (2013) Dysregulated RasGRP1 Responds to Cytokine Receptor Input in T Cell Leukemogenesis. Sci Signal. 6, ra21.

  19. Plagnol, V., Howson, J. M., Smyth, D. J., Walker, N., Hafler, J. P., Wallace, C., Stevens, H., Jackson, L., Simmonds, M. J., Type 1 Diabetes Genetics Consortium, Bingley, P. J., Gough, S. C., and Todd, J. A. (2011) Genome-Wide Association Analysis of Autoantibody Positivity in Type 1 Diabetes Cases. PLoS Genet. 7, e1002216.

  20. Qu, H. Q., Grant, S. F., Bradfield, J. P., Kim, C., Frackelton, E., Hakonarson, H., and Polychronakos, C. (2009) Association of RASGRP1 with Type 1 Diabetes is Revealed by Combined Follow-Up of Two Genome-Wide Studies. J Med Genet. 46, 553-554.

  21. Salzer, E., Cagdas, D., Hons, M., Mace, E. M., Garncarz, W., Petronczki, O. Y., Platzer, R., Pfajfer, L., Bilic, I., Ban, S. A., Willmann, K. L., Mukherjee, M., Supper, V., Hsu, H. T., Banerjee, P. P., Sinha, P., McClanahan, F., Zlabinger, G. J., Pickl, W. F., Gribben, J. G., Stockinger, H., Bennett, K. L., Huppa, J. B., Dupre, L., Sanal, O., Jager, U., Sixt, M., Tezcan, I., Orange, J. S., and Boztug, K. (2016) RASGRP1 Deficiency Causes Immunodeficiency with Impaired Cytoskeletal Dynamics. Nat Immunol. 17, 1352-1360.

  22. Chen, Y., Ci, X., Gorentla, B., Sullivan, S. A., Stone, J. C., Zhang, W., Pereira, P., Lu, J., and Zhong, X. P. (2012) Differential Requirement of RasGRP1 for Gammadelta T Cell Development and Activation. J Immunol. 189, 61-71.

  23. Fuller, D. M., Zhu, M., Song, X., Ou-Yang, C. W., Sullivan, S. A., Stone, J. C., and Zhang, W. (2012) Regulation of RasGRP1 Function in T Cell Development and Activation by its Unique Tail Domain. PLoS One. 7, e38796.

  24. Daley, S. R., Coakley, K. M., Hu, D. Y., Randall, K. L., Jenne, C. N., Limnander, A., Myers, D. R., Polakos, N. K., Enders, A., Roots, C., Balakishnan, B., Miosge, L. A., Sjollema, G., Bertram, E. M., Field, M. A., Shao, Y., Andrews, T. D., Whittle, B., Barnes, S. W., Walker, J. R., Cyster, J. G., Goodnow, C. C., and Roose, J. P. (2013) Rasgrp1 Mutation Increases Naive T-Cell CD44 Expression and Drives mTOR-Dependent Accumulation of Helios(+) T Cells and Autoantibodies. Elife. 2, e01020.

  25. Priatel, J. J., Chen, X., Zenewicz, L. A., Shen, H., Harder, K. W., Horwitz, M. S., and Teh, H. S. (2007) Chronic Immunodeficiency in Mice Lacking RasGRP1 Results in CD4 T Cell Immune Activation and Exhaustion. J Immunol. 179, 2143-2152.

  26. Shen, S., Chen, Y., Gorentla, B. K., Lu, J., Stone, J. C., and Zhong, X. P. (2011) Critical Roles of RasGRP1 for Invariant NKT Cell Development. J Immunol. 187, 4467-4473.