Phenotypic Mutation 'hersey' (pdf version)
Allelehersey
Mutation Type missense
Chromosome10
Coordinate60,308,036 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Cdh23
Gene Name cadherin 23 (otocadherin)
Synonym(s) nmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D
Chromosomal Location 60,302,748-60,696,490 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_023370, NM_001252635; MGI:105128

Mapped Yes 
Amino Acid Change Valine changed to Glutamic Acid
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000072973] [ENSMUSP00000101101] [ENSMUSP00000101102] [ENSMUSP00000101103] [ENSMUSP00000101104]
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: V2929E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect possibly damaging

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
(Using ENSMUST00000073242)
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: V2930E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
(Using ENSMUST00000105461)
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: V2932E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
(Using ENSMUST00000105462)
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: V2930E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
(Using ENSMUST00000105463)
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: V2928E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
(Using ENSMUST00000105464)
Meta Mutation Damage Score 0.8045 question?
Is this an essential gene? Possibly essential (E-score: 0.719) question?
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological 11138008 11322776
Body Weight - decreased
Body Weight (BP Male) - decreased
Body Weight (BP) - decreased
Body Weight (BP, z-score) - decreased
Body Weight (Z-score) - decreased
FACS CD44+ T cells - increased
Candidate Explorer Status CE: excellent candidate; human score: 0.5; ML prob: 0.612
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(41) : Chemically induced (ENU)(7)  Chemically induced (other)(2) Endonuclease-mediated(3) Gene trapped(2) QTL(2) Radiation induced(1) Spontaneous(13) Targeted(11)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Cdh23 APN 10 60523548 missense probably benign 0.03
IGL00429:Cdh23 APN 10 60421141 missense probably damaging 0.97
IGL01014:Cdh23 APN 10 60307522 missense probably damaging 0.99
IGL01284:Cdh23 APN 10 60466097 missense possibly damaging 0.95
IGL01305:Cdh23 APN 10 60312624 missense probably damaging 1.00
IGL01367:Cdh23 APN 10 60310787 missense probably damaging 1.00
IGL01396:Cdh23 APN 10 60385069 missense possibly damaging 0.93
IGL01412:Cdh23 APN 10 60314694 missense probably damaging 1.00
IGL01461:Cdh23 APN 10 60409147 missense possibly damaging 0.53
IGL01469:Cdh23 APN 10 60597725 missense probably benign 0.03
IGL01695:Cdh23 APN 10 60331833 missense probably benign 0.20
IGL01734:Cdh23 APN 10 60303513 missense probably benign
IGL01767:Cdh23 APN 10 60315724 missense probably damaging 1.00
IGL01796:Cdh23 APN 10 60311137 missense probably benign 0.31
IGL01843:Cdh23 APN 10 60419819 splice site probably null
IGL02025:Cdh23 APN 10 60385143 missense probably damaging 1.00
IGL02071:Cdh23 APN 10 60523560 missense possibly damaging 0.93
IGL02160:Cdh23 APN 10 60597765 splice site probably benign
IGL02175:Cdh23 APN 10 60331308 missense possibly damaging 0.92
IGL02220:Cdh23 APN 10 60305124 missense probably damaging 1.00
IGL02302:Cdh23 APN 10 60323523 missense possibly damaging 0.87
IGL02331:Cdh23 APN 10 60465543 missense probably damaging 0.99
IGL02452:Cdh23 APN 10 60317942 missense probably damaging 0.99
IGL02499:Cdh23 APN 10 60385179 missense probably damaging 1.00
IGL02548:Cdh23 APN 10 60650122 missense probably benign 0.37
IGL02593:Cdh23 APN 10 60465995 splice site probably benign
IGL02626:Cdh23 APN 10 60391801 missense probably damaging 1.00
IGL02951:Cdh23 APN 10 60311364 missense probably damaging 1.00
IGL03145:Cdh23 APN 10 60376814 missense probably damaging 0.99
dee_dee UTSW 10 60308056 nonsense probably null
ANU22:Cdh23 UTSW 10 60312624 missense probably damaging 1.00
IGL02980:Cdh23 UTSW 10 60314620 missense probably damaging 1.00
PIT4362001:Cdh23 UTSW 10 60465458 missense probably benign 0.15
R0013:Cdh23 UTSW 10 60413173 missense possibly damaging 0.90
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0082:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R0124:Cdh23 UTSW 10 60308056 nonsense probably null
R0172:Cdh23 UTSW 10 60319632 missense probably damaging 1.00
R0195:Cdh23 UTSW 10 60317059 missense probably damaging 0.99
R0365:Cdh23 UTSW 10 60379315 missense probably damaging 0.99
R0437:Cdh23 UTSW 10 60410797 missense probably damaging 1.00
R0486:Cdh23 UTSW 10 60386946 missense probably damaging 1.00
R0494:Cdh23 UTSW 10 60316596 splice site probably benign
R0545:Cdh23 UTSW 10 60331291 missense probably benign 0.06
R0619:Cdh23 UTSW 10 60433777 missense probably damaging 1.00
R0647:Cdh23 UTSW 10 60307902 missense probably damaging 0.99
R0647:Cdh23 UTSW 10 60323374 nonsense probably null
R0730:Cdh23 UTSW 10 60323714 missense probably damaging 0.99
R0880:Cdh23 UTSW 10 60406421 missense possibly damaging 0.51
R0942:Cdh23 UTSW 10 60410860 missense possibly damaging 0.67
R0989:Cdh23 UTSW 10 60534510 missense probably damaging 0.99
R1017:Cdh23 UTSW 10 60331793 missense probably damaging 1.00
R1173:Cdh23 UTSW 10 60312392 splice site probably benign
R1449:Cdh23 UTSW 10 60376951 missense probably damaging 1.00
R1456:Cdh23 UTSW 10 60487120 missense possibly damaging 0.84
R1519:Cdh23 UTSW 10 60379343 missense possibly damaging 0.92
R1532:Cdh23 UTSW 10 60314331 missense probably damaging 0.99
R1559:Cdh23 UTSW 10 60419699 splice site probably benign
R1704:Cdh23 UTSW 10 60314611 missense probably damaging 1.00
R1711:Cdh23 UTSW 10 60523536 missense probably benign 0.07
R1760:Cdh23 UTSW 10 60326076 missense probably damaging 1.00
R1782:Cdh23 UTSW 10 60488542 missense probably damaging 1.00
R1791:Cdh23 UTSW 10 60391726 missense possibly damaging 0.89
R1803:Cdh23 UTSW 10 60331281 missense probably damaging 1.00
R1857:Cdh23 UTSW 10 60323297 missense probably damaging 1.00
R1874:Cdh23 UTSW 10 60436818 missense possibly damaging 0.52
R1914:Cdh23 UTSW 10 60323570 missense probably damaging 0.99
R1958:Cdh23 UTSW 10 60410873 missense probably benign 0.02
R1964:Cdh23 UTSW 10 60385222 missense probably benign 0.31
R1966:Cdh23 UTSW 10 60323582 missense probably damaging 1.00
R1981:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R2010:Cdh23 UTSW 10 60314227 missense probably damaging 0.99
R2036:Cdh23 UTSW 10 60466043 missense possibly damaging 0.52
R2038:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R2044:Cdh23 UTSW 10 60596730 missense possibly damaging 0.72
R2111:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2112:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2211:Cdh23 UTSW 10 60466004 missense possibly damaging 0.92
R2261:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2262:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2306:Cdh23 UTSW 10 60323445 missense probably damaging 1.00
R2344:Cdh23 UTSW 10 60316724 missense probably damaging 1.00
R2857:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2858:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2859:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2876:Cdh23 UTSW 10 60307496 missense probably damaging 1.00
R3034:Cdh23 UTSW 10 60409010 splice site probably benign
R3424:Cdh23 UTSW 10 60376881 missense possibly damaging 0.76
R3699:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3700:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3950:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3951:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3952:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R4108:Cdh23 UTSW 10 60410822 missense possibly damaging 0.51
R4114:Cdh23 UTSW 10 60421040 splice site probably null
R4273:Cdh23 UTSW 10 60311161 missense possibly damaging 0.69
R4284:Cdh23 UTSW 10 60303493 missense possibly damaging 0.91
R4334:Cdh23 UTSW 10 60385059 missense probably damaging 0.99
R4474:Cdh23 UTSW 10 60311086 missense probably damaging 1.00
R4532:Cdh23 UTSW 10 60534423 missense probably benign 0.32
R4597:Cdh23 UTSW 10 60409044 missense probably damaging 1.00
R4604:Cdh23 UTSW 10 60337666 missense possibly damaging 0.93
R4793:Cdh23 UTSW 10 60331350 missense probably damaging 1.00
R4816:Cdh23 UTSW 10 60409077 missense possibly damaging 0.93
R4833:Cdh23 UTSW 10 60385038 missense probably damaging 1.00
R4840:Cdh23 UTSW 10 60419777 missense possibly damaging 0.53
R4857:Cdh23 UTSW 10 60391784 missense probably damaging 1.00
R4869:Cdh23 UTSW 10 60376934 missense probably damaging 1.00
R4894:Cdh23 UTSW 10 60337851 missense probably benign 0.04
R4940:Cdh23 UTSW 10 60307935 missense probably damaging 0.98
R5020:Cdh23 UTSW 10 60308032 missense probably damaging 0.99
R5026:Cdh23 UTSW 10 60304848 missense possibly damaging 0.88
R5081:Cdh23 UTSW 10 60436807 missense possibly damaging 0.89
R5138:Cdh23 UTSW 10 60312282 missense probably damaging 1.00
R5236:Cdh23 UTSW 10 60312572 missense probably damaging 1.00
R5361:Cdh23 UTSW 10 60657265 critical splice donor site probably null
R5384:Cdh23 UTSW 10 60337762 missense probably damaging 0.99
R5500:Cdh23 UTSW 10 60314311 missense probably damaging 1.00
R5512:Cdh23 UTSW 10 60534386 splice site probably null
R5673:Cdh23 UTSW 10 60307857 missense probably damaging 1.00
R5720:Cdh23 UTSW 10 60393023 missense possibly damaging 0.71
R5726:Cdh23 UTSW 10 60407480 missense probably damaging 0.98
R5732:Cdh23 UTSW 10 60331317 missense possibly damaging 0.80
R5739:Cdh23 UTSW 10 60305609 missense probably damaging 0.99
R5760:Cdh23 UTSW 10 60406392 missense probably damaging 0.99
R5793:Cdh23 UTSW 10 60306128 missense probably damaging 1.00
R5880:Cdh23 UTSW 10 60384934 missense probably damaging 1.00
R5905:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R5907:Cdh23 UTSW 10 60428379 missense probably damaging 1.00
R5910:Cdh23 UTSW 10 60377821 missense possibly damaging 0.81
R5932:Cdh23 UTSW 10 60392984 missense probably damaging 1.00
R5996:Cdh23 UTSW 10 60413577 missense possibly damaging 0.85
R6015:Cdh23 UTSW 10 60307982 missense probably damaging 0.97
R6020:Cdh23 UTSW 10 60331326 missense probably damaging 1.00
R6023:Cdh23 UTSW 10 60465542 missense probably damaging 1.00
R6028:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R6066:Cdh23 UTSW 10 60433758 missense probably damaging 1.00
R6137:Cdh23 UTSW 10 60434512 missense probably damaging 0.96
R6211:Cdh23 UTSW 10 60410821 missense possibly damaging 0.90
R6298:Cdh23 UTSW 10 60426672 nonsense probably null
R6302:Cdh23 UTSW 10 60305093 missense possibly damaging 0.74
R6338:Cdh23 UTSW 10 60413151 missense probably damaging 1.00
R6356:Cdh23 UTSW 10 60438847 missense probably damaging 1.00
R6441:Cdh23 UTSW 10 60308036 missense probably damaging 1.00
R6714:Cdh23 UTSW 10 60331830 missense possibly damaging 0.62
R6760:Cdh23 UTSW 10 60306168 missense probably damaging 1.00
R6807:Cdh23 UTSW 10 60378871 missense possibly damaging 0.95
R6855:Cdh23 UTSW 10 60306122 missense possibly damaging 0.66
R6937:Cdh23 UTSW 10 60487114 missense probably damaging 1.00
R6942:Cdh23 UTSW 10 60438856 missense possibly damaging 0.93
R6961:Cdh23 UTSW 10 60650114 missense probably benign 0.00
R7009:Cdh23 UTSW 10 60337306 missense probably damaging 0.99
R7010:Cdh23 UTSW 10 60530991 missense probably benign 0.03
R7032:Cdh23 UTSW 10 60331788 missense probably damaging 1.00
R7046:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R7111:Cdh23 UTSW 10 60387044 missense probably damaging 1.00
R7196:Cdh23 UTSW 10 60307980 missense probably damaging 0.99
R7198:Cdh23 UTSW 10 60312599 missense possibly damaging 0.91
R7223:Cdh23 UTSW 10 60331817 missense probably damaging 1.00
R7290:Cdh23 UTSW 10 60376841 missense probably benign
R7335:Cdh23 UTSW 10 60305116 missense probably damaging 1.00
R7340:Cdh23 UTSW 10 60530996 missense probably benign 0.19
R7350:Cdh23 UTSW 10 60410910 missense probably damaging 1.00
R7366:Cdh23 UTSW 10 60315692 nonsense probably null
R7374:Cdh23 UTSW 10 60317900 missense probably damaging 0.99
R7455:Cdh23 UTSW 10 60306224 missense possibly damaging 0.82
R7537:Cdh23 UTSW 10 60384945 missense probably benign 0.17
R7573:Cdh23 UTSW 10 60323550 missense probably benign 0.17
R7578:Cdh23 UTSW 10 60407407 missense probably benign 0.14
R7646:Cdh23 UTSW 10 60305152 missense possibly damaging 0.95
R7703:Cdh23 UTSW 10 60337264 missense probably damaging 1.00
R7763:Cdh23 UTSW 10 60312577 missense probably damaging 1.00
R7797:Cdh23 UTSW 10 60385194 missense probably benign 0.07
X0052:Cdh23 UTSW 10 60385134 missense probably damaging 1.00
Z1088:Cdh23 UTSW 10 60413644 missense probably benign 0.35
Mode of Inheritance Unknown
Local Stock Live Mice
Repository
Last Updated 2019-09-04 9:33 PM by Anne Murray
Record Created 2018-09-18 1:09 PM by Jamie Russell
Record Posted 2018-10-11
Phenotypic Description
Figure 1. Hersey showed circling and abnormal movements.

Figure 2. Hersey male mice exhibited reduced body weights compared to wild-type sex-matched littermates. Scaled weights shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The hersey phenotype was identified among G3 mice of the pedigree R6441, some of which showed circling and abnormal movements (Figure 1). Some mice also showed reduced body weights compared to wild-type littermates (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the behavioral phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 39 mutations (X-axis) identified in the G1 male of pedigree R6441. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 39 mutations. The above anomalies were linked to a mutation in Cdh23:  a T to A transversion at base pair 60,308,036 (v38) on chromosome 10, or base pair 388,478 in the GenBank genomic region NC_000076.6. The strongest association was found with a recessive model of inheritance to the behavioral phenotype, wherein six variant homozygotes departed phenotypically from 33 homozygous reference mice and 37 heterozygous mice with a P value of 3.032 x 10-9 (Figure 3).  

 

The mutation corresponds to residue 9,196 in the mRNA sequence NM_023370.3 within exon 61 of 70 total exons.

 

9180 CCTGGCTATTTTGTGGTAGACATCGTGGCCCGA

2923 -P--G--Y--F--V--V--D--I--V--A--R-

 

The mutated nucleotide is indicated in red. The mutation results in a valine to glutamic acid substitution at position 2,928 (V2928E) in the Cdh23 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.993).

Protein Prediction

Figure 4. Domain structures of Cdh23 splice variants. Cdh23 consists of 27 extracellular cadherin (EC) repeats, one transmembrane domain and a cytoplasmic domain that contains two PDZ-binding interfaces (PBIs; dark blue boxes). (A) Full-length Cdh23 undergoes alternative splicing that involves the inclusion or exclusion of exon 68; exon 68 encodes 35 cytoplasmic amino acids that interrupt the internal PBI of Cdh23. The B isoform proteins differ from full-length Cdh23 in that they have seven EC motifs, a transmembrane domain, and a cytoplasmic domain with (B1) or without (B2) the amino acid sequence encoded by exon 68. The C isoforms are cytosolic and do not have any EC repeats or the transmembrane domain; C1 (AAT72159) and C2 (AAT72160) both have a novel seven base pair exonic sequence, 65a, that encodes the N-terminus. C1 has exon 68, while C2 does not. The red boxes in each isoform denote the portion of the protein encoded by exon 68. The dee dee mutation results in a tyrosine to premature stop codon substitution at amino acid residue 2923 in Cdh23(+68) and 2921 in Cdh23(-68). The mutation is predicted to affect the A and B Cdh23 isoforms. SP, signal peptide; EC, extracellular cadherin repeats; TM, transmembrane domain; PBI, PDZ-binding interfaces.

Cdh23 (alternatively, Ush1d) encodes cadherin 23 (Cdh23), a member of the cadherin superfamily of cell-cell adhesion proteins (1). The cadherin proteins share similar features including a signal peptide (amino acids (aa) 1-23 in Cdh23), an extracellular domain (aa 24-3064 in Cdh23) with a variable number of extracellular ectodomain (EC) repeats (alternatively, cadherin motifs; Cdh23 has 27 EC repeats), a single helical transmembrane domain (aa 3065-3085 in Cdh23), and a cytoplasmic C-terminus (aa 3086-3354 in Cdh23) that connects the cadherin protein to the actin cytoskeleton through interactions with α- and β-catenin (Figure 4(1-4)). 

 

Each Cdh23 EC repeat has four calcium binding motifs that together bind three calcium ions. Cdh23 forms homodimers and heterodimers with protocadherin 15 (Pcdh15; see the record for squirm) through interactions along the full length of the extracellular domain (5;6). Cdh23 interacts with Pcdh15 to form tip links, extracellular filaments that connect the tips of hair cell stereocilia and function in the gating of the hair cell’s mechanotransducer channel (5;7-9). Within the cytoplasmic domain of Cdh23 are two PDZ-binding interfaces (PBIs) that interact with PDZ domains of other proteins.

 

The hersey mutation results in a valine to glutamic acid substitution at position 2,928 (V2928E); Val2928 is within the last EC repeat.

 

For more information about Cdh23, please see the record for dee­_dee.

Putative Mechanism

At their apical surface, hair cells in the cochlea of the inner ear have a single kinocilium and a bundle of actin-filled stereocilia arranged in a staircase of increasing height (10-12). Each stereocilium is connected to its taller neighbor by the tip link (13); side links, ankle links, and horizontal top connectors also connect the individual stereocilia and coordinate their movement (14;15). Cdh23 interacts with Pcdh15 to form the tip link (16-18). During deflection of the hair bundle, the tip link translates the mechanical forces arising from sound waves and head movement into electrochemical signals through gating of the mechanoelectric transducer channels at the lower end of each tip link (11;15;19); these electrical signals facilitate hearing and balance (7)

 

In the synaptic terminals of the photoreceptor cells of the retina, Cdh23 colocalizes with Pcdh15, harmonin, and Myo7a. The complex in the photoreceptor synapse is proposed to have a role in the structural and functional organization of the synaptic junction (20).  See the record squirm for more information about the sensory cells in the inner ear and retina as well as the known functions of Cdh23, Pcdh15, and the Usher syndrome-associated proteins therein.

 

In humans, missense mutations in CDH23 are typically linked to autosomal recessive deafness 12 [DFNB12; OMIM: #601386; (3;21)], while null mutations are typically linked to Usher syndrome type 1D (USH1D) and Usher syndrome type 1D/F digenic [OMIM: #601067; (3;4)].  USH1D is characterized by hearing loss, retinitis pigmentosa leading to blindness, and in some cases, vestibular dysfunction (10;18;22). Type 1D/F Usher syndrome is caused by heterozygous mutations in both CDH23 and PCDH15. Patients with Usher syndrome type 1D/F exhibit congenital nonprogressive deafness, vestibular dysfunction, and retinitis pigmentosa (23).

 

Several Cdh23 mutant mouse alleles have been reported and all (with the exception of Cdh23v-bus (MGI:1856681), a donor splice site mutation after exon 67 in Cdh23) are within or affect an EC domain (1;16;18;25-29). Similar to the mutations found in humans, nonsense and splice-site mutations that lead to Cdh23 null alleles result in USHD1 phenotypes, while missense mutations result in phenotypes characteristic of DFNB12 [reviewed in (18)]. The null mutations [e.g., waltzer (Cdh23v; MGI:1856228)] affect hair bundle development and cause defects in the organization of the stereocilial bundle in the cochlear hair cells and misplaced kinocilia (1;28;30). These defects lead to both hearing loss and vestibular defects (as exhibited by circling, head tilt, and/or head tossing) (1;27;28). In contrast, the hair cells and hair bundles develop normally in mouse mutants with missense mutations of Cdh23, but the function is affected (24). Although all of the mouse models exhibit hearing loss; retinal degeneration does not occur (18). Examination of three Cdh23 null mutants using electroretinography determined that two out of the three mutants exhibited abnormal retinal function; cone photoreceptor function was mildly attenuated as well as the response of retinal interneurons (22). However, histological examination determined that the anatomy of the retinas were normal (22). Libby et al. propose that the difference between the mouse and human retina phenotypes in null mutants is dependent on genetic background (22). It is possible that in other genetic backgrounds that have yet to be tested, Cdh23 null alleles may exhibit retinal degeneration.

 

The hersey mice exhibit vestibular dysfunction similar to waltzer and other Cdh23 null mouse models.

Primers PCR Primer
hersey_pcr_F: CAATGGCGCCTGTGATGTTG
hersey_pcr_R: TGTTTACATAAAGCTGGAGCAACC

Sequencing Primer
hersey_seq_F: CCTGTGATGTTGGACAGCAG
hersey_seq_R: AATCAGGAGCGTTTCAGCC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 431 nucleotides is amplified (chromosome 10, - strand):


1   tgtttacata aagctggagc aaccactaaa aatcaggagc gtttcagcca ggcatgctag
61  cgtatgccta taatcccagc actcaggctg tggacgtgga gaactctgac ttcctccaag
121 gatgtggctt agggggcagg gcttatcatc agtatgtgtg gcctctgagc tgtgccaccc
181 cgactcttta acagggagtg tggacggtat cctgcgcacc tttgacctct tcatggccta
241 cagccctggc tattttgtgg tagacatcgt ggcccgagac ctggccggcc acaatgatac
301 cgccatcatc ggcatctaca tcctgaggga tgaccagcgc gtgaagatcg tcatcaatga
361 gatcccggac cgcgtgcgtg gcttcgagga ggagttcatt cgcctgctgt ccaacatcac
421 aggcgccatt g


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

div>  21. Wagatsuma, M., Kitoh, R., Suzuki, H., Fukuoka, H., Takumi, Y., and Usami, S. (2007) Distribution and Frequencies of CDH23 Mutations in Japanese Patients with Non-Syndromic Hearing Loss. Clin Genet. 72, 339-344.

Science Writers Anne Murray
AuthorsLauren Prince, Jamie Russell, and Bruce Beutler