Phenotypic Mutation 'hem-haw'

• Allele: hem-haw
• Mutation Type: nonsense
• Chromosome: 15
• Coordinate: 103,379,659 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Nckap1l
• Gene Name: NCK associated protein 1 like
• Synonym(s): Hem1, 4930568P13Rik
• Chromosomal Location: 103,362,221-103,407,237 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HEM family of tissue-specific transmembrane proteins which are highly conserved from invertebrates through mammals. This gene is only expressed in hematopoietic cells. The encoded protein is a part of the Scar/WAVE complex which plays an important role in regulating cell shape in both metazoans and plants. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010] ; PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit anemia, lymphopenia, neutrophilia and tissue-specific pathology, defective neutrophil migration, phagocytosis and F-actin polymerization, abnormal B and T cell development, impaired T cell activation and adhesion, and enhanced IL-17 production. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000035400] [ENSMUSP00000154960 ^†] † probably from a misspliced transcript
• AlphaFold: Q8K1X4
• SMART Domains: Protein: ENSMUSP00000035400; Gene: ENSMUSG00000022488; AA Change: Y315*

Domain	Start	End	E-Value	Type
Pfam:Nckap1	7	1123	N/A	PFAM

• Predicted Effect: probably null
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Probably essential (E-score: 0.852)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:33 PM by Diantha La Vine
• Record Created: 2018-11-08 10:17 PM by Bruce Beutler
• Record Posted: 2019-03-19
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_153505; MGI:1926063

Alleles Listed at MGI

All Mutations and Alleles(5) : Chemically induced (ENU)(1) Targeted(4)

Phenotypic Description

Figure 1. Hem-haw mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Hem-haw mice exhibit reduced CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Hem-haw mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Hem-haw mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Hem-haw mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Hem-haw mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Hem-haw mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Hem-haw mice exhibit decreased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Hem-haw mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Hem-haw mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Hem-haw mice exhibit decreased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Hem-haw mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Hem-haw mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Hem-haw mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 15. Hem-haw mice exhibit increased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 16. Hem-haw mice exhibit increased expression of CD44 on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 17. Hem-haw mice exhibit increased expression of CD44 on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 18. Hem-haw mice exhibit increased expression of CD44 on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 19. Hem-haw mice exhibit reduced body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The hem-haw phenotype was identified among G3 mice of the pedigree R6440, some of which showed a reduction in the B to T cell ratio (Figure 1), a reduction in the CD4 to CD8 T cell ratio (Figure 2), reduced frequencies of B cells (Figure 3), T cells (Figure 4), CD4+ T cells (Figure 5), CD4+ T cells in CD3+ T cells (Figure 6), CD8+ T cells (Figure 7), central memory CD8 T cells in CD8 T cells (Figure 8), naïve CD4 T cells in CD4 T cells (Figure 9), naïve CD8 T cells in CD8 T cells (Figure 10), and NK cells (Figure 11) with concomitant increased frequencies of CD8+ T cells in CD3+ T cells (Figure 12), effector memory CD4 T cells in CD4 T cells (Figure 13), effector memory CD8 T cells in CD8 T cells (Figure 14), and CD44+ T cells (Figure 15), all in the peripheral blood. Increased expression of CD44 on peripheral blood T cells (Figure 16), CD4+ T cells (Figure 17), and CD8+ T cells (Figure 18). Some mice also showed reduced body weights compared to wild-type littermates (Figure 19).

Nature of Mutation

Figure 20. Linkage mapping of the increased effector memory CD8 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 42 mutations (X-axis) identified in the G1 male of pedigree R6440. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 42 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Nckap1l:  a C to A transversion at base pair 103,471,232 (v38) on chromosome 15, or base pair 17,450 in the GenBank genomic region NC_000081 encoding Nckap1l.  The strongest association was found with a recessive model of inheritance to the normalized effector memory CD8 T cell frequency, wherein one variant homozygote departed phenotypically from 15 homozygous reference mice and 21 heterozygous mice with a P value of 1.186 x 10^-26 (Figure 20).  

The mutation corresponds to residue 1,000 in the mRNA sequence NM_153505 within exon 10 of 31 total exons.

983 AGCAGTTTGAAAGGGTACAGTAAGCGAGTGGCA 310 -S--S--L--K--G--Y--S--K--R--V--A-

The mutated nucleotide is indicated in red. The mutation results in substitution of tyrosine 315 for a premature stop codon (Y315*) in the HEM1 protein.

Protein Prediction

Figure 21. The HEM1 protein. HEM1 does not have defined domains. There are nine potential N-glycosylation sites, two cAMP/cGMP-depondant kinase phosphorylation sites, and eight potential membrane-associated domains. The hem-haw mutation results in substitution of tyrosine 315 for a premature stop codon in the HEM1 protein.

Nckap1l encodes hematopoietic protein HEM-1 (HEM1; alternatively, Nck-associated protein 1-like [Nckap1l or Nap1l]). HEM1 does not have defined domains, but has several conserved hydrophobic regions and cysteines indicative of protein-interaction domains (Figure 21).

HEM1 has two putative cAMP/cGMP phosphorylation sites; the significance of HEM1 phosphorylation is unknown (1).

The hem-haw mutation results in substitution of tyrosine 315 for a premature stop codon (Y315*); Tyr315 is within proximity to a putative membrane-associated domain. Expression and localization of the mutant protein have not been assessed.

Expression/Localization

NCKAP1L is exclusively expressed in hematopoietic cells (1;2). HEM1 localizes to the leading edge of polarized neutrophils (3).

Background

Figure 22. WAVE complex activation/actin polymerization downstream of immune receptors. (A) Rho family members regulate F-actin polymerization in response to immunoreceptor (i.e. chemokine, Toll-like receptor, T cell receptor, B cell receptor, integrin) signaling. Interaction of immunoreceptors with their respective ligands activates Rho guanine nucleotide exchange factors (GEFs), which catalyze the release of GDP from Rho, allowing GTP to bind. Conversely, Rho-GTPase activating proteins such as Rho-GAP cause GTP to be hydrolyzed back to the inactive GDP-bound form. Major Rho family members in immune cells include CDC42, Rac, and RhoA. CDC42-GTP binds and activates WASP, which facilitates Arp2/3-mediated nucleation of ATP-bound G-actin. Rac-GTP specifically binds and activates the WAVE complex which also facilitates Arp2/3-mediated F-actin nucleation. Both Rac-GTP and CDC42-GTP also activate DIAP3, which is required for nucleation of unbranched actin filaments, and PAK-dependent LIM kinase, which stabilizes actin polymerization by preventing Cofilin from severing ADP-bound actin and promoting actin depolymerization. RhoA-GTP contributes to actin regulation by activating ROCK (Rho-associated coiled-coil-containing kinase), which inhibits myosin light chain phosphatase (MLCP) resulting in increased phosphorylation of myosin light chains (MLCs), which bind actin and stimulate contraction at the “tail” during migration. (B) Model of Hem-1 functions in F-actin polymerization immunoreceptor activation. In immune cells, the WAVE complex [which consists of WAVE (1 or 2), Abi (1 or 2), Hem-1, Sra1, and HSPC300] is basally inactive. Upon T cell activation, activated Rac binds and activates the WAVE complex, thus promoting Arp2/3-mediated F-actin polymerization from monomeric G-actin. The WAVE complex (including Hem-1) may also directly control cell adhesion in a Rap1-dependent manner. Hem-1 has also been implicated in inhibiting myosin contraction at the leading edge of migrating cells, which may contribute to membrane protrusion. Figure and legend adapted from Park,H. et al. (2010).

Filamentous actin (F-actin) polymerization and depolymerization is required for immune cell adhesion to the vascular endothelium as well as for polarization, migration, phagocytosis, and formation of an immune synapse in response to an infection (Figure 22) (4-7). Coordinated polymerization and depolymerization of F-actin is initiated by members of the Rho family of guanosine triphosphatases (Rho GTPases; i.e., Cdc42, Rho, and Rac [see the record bingo for information about Rac2]) and downstream Rho family target complexes (e.g., WASP [Wiskott–Aldrich syndrome protein] and WAVE [WASP-family verprolin homologous protein]) [reviewed in (8)]. Rho GTPases are activated downstream of B cell and T cell receptors (see the records for hive and thoth for more information about B and T cell receptor signaling, respectively), chemokine receptors (e.g., CCR7 [see the record for lanzhou]), cytokine receptors (e.g., interferon receptor [see the record for macro-1]), and Toll-like receptors (e.g., TLR4 [see the record for lps3]) (Figure 22A) (9). After stimulation, guanine nucleotide exchange factors (GEFs; e.g., DOCK2 [see the record for frazz], SWAP70, Vav1 [see the record for tardive], and Tiam1) convert Rho proteins from an inactive GDP-bound state to an active-GTP-bound form, subsequently promoting downstream signaling. GTPase-activating proteins (Rho-GAPs; e.g., Bcr and RacGAP1) promote the hydrolysis of GTP to GDP, switching off active Rho.

The actin regulatory complex (Arp2/3) initiates the formation of new actin filaments, which is required for monomeric actin (G-actin) to switch to its filamentous form. The Arp2/3 complex is activated by nucleation promoting factors including the WASP and WAVE complexes (10). The WAVE complex contains Sra1 (specifically Rac-associated protein 1), Hem-1, or Hem-2 (also known as Nap1 (Nck-associated protein-1)], Abi [Abelson interactor 1 or 2 (Abi1 or Abi2)], WAVE (WAVE1, WAVE2, or WAVE3), and HSPC300 (hematopoietic stem/progenitor cell protein 300) (11). After immune receptor activation, GTP-bound CDC42 promotes a conformational change in the WASP complex that allows binding of the complex to G-actin and the Arp2/3 complex, subsequently leading to F-actin polymerization (Figure 22B) (12;13). In the WAVE complex, GTP-bound Rac binds, stimulating Arp2/3-induced F-actin polymerization. The Rac binds directly to the Sra1 component of the WAVE complex, which binds either HEM1 or HEM2 (11;14). The HEM proteins interact with Abi1/2, which binds HSPC300 and WAVE. The mechanism by which WAVE stimulates Arp2/3-induced F-actin polymerization is unknown.

HEM1 is required for the stabilization and/or translation of the WAVE complex proteins (e.g., WAVE2, Abi1, and CYFIP1/2) in hematopoietic cells (2;15). As part of the WAVE complex, HEM1 is a regulator of the actin cytoskeleton. As a result, HEM1 controls lymphocyte development, activation, proliferation, and homeostasis as well as erythrocyte membrane stability, and neutrophil and macrophage phagocytosis and migration (2;10).

HEM1 also putatively associates with myosin regulatory complexes through interactions with polarity proteins (e.g., myosin light chain phosphatase, two different Rho-GAPs [Rho-GAP4 and Myosin IXB], and Vps34 [a class III PI3K], which indicates that it may also inhibit myosin-based contraction at the leading edge of migrating cells (3).

Hematopoietic stem cells (HSCs) migrate from their sites of origin to the fetal liver on embryonic day 9.5 to 10.5 during mouse development (16). Migration to the fetal liver is essential for adult HSC maturation and efficient adult hematopoiesis (17). On embryonic day 16.5 to 17.5, the HSCs migrate to the bone marrow (16;17). HEM1 and the WAVE complex are required for the transition of fetal liver hematopoiesis to the bone marrow (18). Loss of HEM1 expression did not alter HSC migration to the bone marrow, but resulted in degradation of the WAVE complex as well as apoptosis of the fetal liver HSCs after arrival in the fetal marrow niche (18).

The HEM1 human gene is located in a chromosomal region (12q13.1) that is prone to chromosome translocations in hematopoietic cell cancers. High levels of HEM1 is associated with poor prognosis in human chronic lymphocytic leukemias (19). Chromosome 12q13.1 is also a folic acid fragile site, Fra 12a (1).

Nckap1l-deficient (Nckap1l^-/-) mice are overtly healthy and fertile. However, the Nckap1l^-/- mice showed aberrant F-actin polymerization and actin capping in lymphocytes and neutrophils due to loss of the Rac-controlled actin regulatory WAVE protein complex (2). The Nckap1l^-/- mice exhibited aberrant T cell development at the CD4/CD8 double-negative to CD4/CD8 double-positive stage as well as impaired T cell activation and adhesion (2). B cells from the Nckap1l^-/- mice showed impaired development at the pro-B cell and T0/T1 stages. The mice showed reduced numbers of B cells, CD4+ T cells, and CD8+ T cells with concomitant increased numbers of neutrophils in the periphery. T cells from the Nckap1l^-/- mice showed reduced proliferation in response to CD3 and CD28 stimulation. Neutrophils from the Nckap1l^-/- mice showed a failure to migrate in response to chemotactic signals and showed defects in bacteria phagocytosis (2). The Nckap1l^-/- mice showed increased Th17 cell production from naïve CD4+ T cells (2). In another study, Nckap1l^-/- mice showed marrow fibrosis and hematopoietic failure at six to eight weeks of age; the mice subsequently died (18).

Putative Mechanism

HEM1-associated cytoskeletal reorganization is required for T and B cell development as well as T cell activation, survival, adhesion, and proliferation (2). The immune cell phenotypes observed in the hem-haw mice mimic that of Nckap1l^-/- mice (2) indicating loss of HEM1-associated function in the hem-haw mice.

Primers

PCR Primer
hem-haw_pcr_F: AAACAGAGCACAGTGGCCTC
hem-haw_pcr_R: CCCCTGAAGTAGTGCAGAAGAG

Sequencing Primer
hem-haw_seq_F: TGGCCTCTAAGTCACAAGATGGC
hem-haw_seq_R: GGCTCAGTGCTAAACTCAAACTTAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 407 nucleotides is amplified (chromosome 15, + strand):

1   aaacagagca cagtggcctc taagtcacaa gatggcctct aagccactgg atagccttgt
61  ttgcatagtg tgagaagaat gagtgagaac cctgctagtt agggtgtgtg tacttactaa
121 cagatgacat gacgccctac tgtgcttggt ctgtcaatcc tcaggtacag taagcgagtg
181 gcagacatca aggagagcaa ggaacacgcc attacaaaca ggtaaaggtg ggatgtgggc
241 ctggaggggt tgggatagga atctctatac agacttgtgg gctcatccca ggaacttcct
301 gcagccccac agatgtttgt attttctaag tttgagttta gcactgagcc ttcctcctgc
361 ctgacacatc ttcccaagtg ctgctctctt ctgcactact tcagggg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Hromas, R., Collins, S., Raskind, W., Deaven, L., and Kaushansky, K. (1991) Hem-1, a Potential Membrane Protein, with Expression Restricted to Blood Cells. Biochim Biophys Acta. 1090, 241-244.

  2. Park, H., Staehling-Hampton, K., Appleby, M. W., Brunkow, M. E., Habib, T., Zhang, Y., Ramsdell, F., Liggitt, H. D., Freie, B., Tsang, M., Carlson, G., Friend, S., Frevert, C., and Iritani, B. M. (2008) A Point Mutation in the Murine Hem1 Gene Reveals an Essential Role for Hematopoietic Protein 1 in Lymphopoiesis and Innate Immunity. J Exp Med. 205, 2899-2913.

  3. Weiner, O. D., Rentel, M. C., Ott, A., Brown, G. E., Jedrychowski, M., Yaffe, M. B., Gygi, S. P., Cantley, L. C., Bourne, H. R., and Kirschner, M. W. (2006) Hem-1 Complexes are Essential for Rac Activation, Actin Polymerization, and Myosin Regulation during Neutrophil Chemotaxis. PLoS Biol. 4, e38.

  4. Burkhardt, J. K., Carrizosa, E., and Shaffer, M. H. (2008) The Actin Cytoskeleton in T Cell Activation. Annu Rev Immunol. 26, 233-259.

  5. Fooksman, D. R., Vardhana, S., Vasiliver-Shamis, G., Liese, J., Blair, D. A., Waite, J., Sacristan, C., Victora, G. D., Zanin-Zhorov, A., and Dustin, M. L. (2010) Functional Anatomy of T Cell Activation and Synapse Formation. Annu Rev Immunol. 28, 79-105.

  6. Harwood, N. E., and Batista, F. D. (2010) Early Events in B Cell Activation. Annu Rev Immunol. 28, 185-210.

  7. Bokoch, G. M. (2005) Regulation of Innate Immunity by Rho GTPases. Trends Cell Biol. 15, 163-171.

  8. Mulloy, J. C., Cancelas, J. A., Filippi, M. D., Kalfa, T. A., Guo, F., and Zheng, Y. (2010) Rho GTPases in Hematopoiesis and Hemopathies. Blood. 115, 936-947.

  9. Tybulewicz, V. L., and Henderson, R. B. (2009) Rho Family GTPases and their Regulators in Lymphocytes. Nat Rev Immunol. 9, 630-644.

  10. Chan, M. M., Wooden, J. M., Tsang, M., Gilligan, D. M., Hirenallur-S, D. K., Finney, G. L., Rynes, E., Maccoss, M., Ramirez, J. A., Park, H., and Iritani, B. M. (2013) Hematopoietic Protein-1 Regulates the Actin Membrane Skeleton and Membrane Stability in Murine Erythrocytes. PLoS One. 8, e54902.

  11. Gautreau, A., Ho, H. Y., Li, J., Steen, H., Gygi, S. P., and Kirschner, M. W. (2004) Purification and Architecture of the Ubiquitous Wave Complex. Proc Natl Acad Sci U S A. 101, 4379-4383.

  12. Higgs, H. N., and Pollard, T. D. (2000) Activation by Cdc42 and PIP(2) of Wiskott-Aldrich Syndrome Protein (WASp) Stimulates Actin Nucleation by Arp2/3 Complex. J Cell Biol. 150, 1311-1320.

  13. Prehoda, K. E., Scott, J. A., Mullins, R. D., and Lim, W. A. (2000) Integration of Multiple Signals through Cooperative Regulation of the N-WASP-Arp2/3 Complex. Science. 290, 801-806.

  14. Kobayashi, K., Kuroda, S., Fukata, M., Nakamura, T., Nagase, T., Nomura, N., Matsuura, Y., Yoshida-Kubomura, N., Iwamatsu, A., and Kaibuchi, K. (1998) P140Sra-1 (Specifically Rac1-Associated Protein) is a Novel Specific Target for Rac1 Small GTPase. J Biol Chem. 273, 291-295.

  15. Weiner, O. D., Marganski, W. A., Wu, L. F., Altschuler, S. J., and Kirschner, M. W. (2007) An Actin-Based Wave Generator Organizes Cell Motility. PLoS Biol. 5, e221.

  16. Ciriza, J., Thompson, H., Petrosian, R., Manilay, J. O., and Garcia-Ojeda, M. E. (2013) The Migration of Hematopoietic Progenitors from the Fetal Liver to the Fetal Bone Marrow: Lessons Learned and Possible Clinical Applications. Exp Hematol. 41, 411-423.

  17. Coskun, S., Chao, H., Vasavada, H., Heydari, K., Gonzales, N., Zhou, X., de Crombrugghe, B., and Hirschi, K. K. (2014) Development of the Fetal Bone Marrow Niche and Regulation of HSC Quiescence and Homing Ability by Emerging Osteolineage Cells. Cell Rep. 9, 581-590.

  18. Shao, L., Chang, J., Feng, W., Wang, X., Williamson, E. A., Li, Y., Schajnovitz, A., Scadden, D., Mortensen, L. J., Lin, C. P., Li, L., Paulson, A., Downing, J., Zhou, D., and Hromas, R. A. (2018) The Wave2 Scaffold Hem-1 is Required for Transition of Fetal Liver Hematopoiesis to Bone Marrow. Nat Commun. 9, 2377-018-04716-5.

  19. Joshi, A. D., Hegde, G. V., Dickinson, J. D., Mittal, A. K., Lynch, J. C., Eudy, J. D., Armitage, J. O., Bierman, P. J., Bociek, R. G., Devetten, M. P., Vose, J. M., and Joshi, S. S. (2007) ATM, CTLA4, MNDA, and HEM1 in High Versus Low CD38 Expressing B-Cell Chronic Lymphocytic Leukemia. Clin Cancer Res. 13, 5295-5304.