Phenotypic Mutation 'gemini2'

• Allele: gemini2
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 121,480,446 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Irf8
• Gene Name: interferon regulatory factor 8
• Synonym(s): ICSBP, Myls, IRF-8, Icsbp1
• Chromosomal Location: 121,463,097-121,483,433 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: The protein encoded by this gene is a transcription factor that belongs to the interferon regulatory factor family. Proteins belonging to this family have a DNA binding domain at the amino terminus that contains five well-conserved tryptophan-rich repeats. This domain recognizes DNA sequences similar to the interferon-stimulated response element. The protein encoded by this gene promotes or suppresses lineage-specific genes to regulate the differentation of lymphoid and myeloid lineage cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014] ; PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased incidence of viral infections, shortened life span, deregulated hematopoiesis, and hematological neoplasias. Heterozygotes show similar, but milder, phenotypes. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Alanine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000040245] [ENSMUSP00000125447] [ENSMUSP00000125029] [ENSMUSP00000125443]
• AlphaFold: P23611
• SMART Domains: Protein: ENSMUSP00000040245; Gene: ENSMUSG00000041515; AA Change: V319A

Domain	Start	End	E-Value	Type
IRF	3	115	8.69e-65	SMART
Blast:IRF	129	176	7e-11	BLAST
IRF-3	202	380	2.63e-78	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
  (Using ENSMUST00000047737)
• SMART Domains: Protein: ENSMUSP00000125447; Gene: ENSMUSG00000041515; AA Change: V228A

Domain	Start	End	E-Value	Type
IRF	3	85	2.54e-16	SMART
IRF-3	111	289	2.63e-78	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
  (Using ENSMUST00000160943)
• SMART Domains: Protein: ENSMUSP00000125029; Gene: ENSMUSG00000041515; AA Change: V319A

Domain	Start	End	E-Value	Type
IRF	3	115	8.69e-65	SMART
Blast:IRF	129	176	7e-11	BLAST
IRF-3	202	380	2.63e-78	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
  (Using ENSMUST00000162001)
• SMART Domains: Protein: ENSMUSP00000125443; Gene: ENSMUSG00000041515

Domain	Start	End	E-Value	Type
IRF	3	85	2.54e-16	SMART
Pfam:IRF-3	111	151	4.7e-9	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.3053
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:33 PM by Anne Murray
• Record Created: 2018-11-17 3:43 PM by Bruce Beutler
• Record Posted: 2018-11-30
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001301811, NM_008320; MGI:96395

Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (ENU)(1) Spontaneous(1) Targeted(8)  

Phenotypic Description

Figure 1. Gemini2 mice exhibit increased CD4+ to CD8+ T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Gemini2 mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Gemini2 mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The gemini2 phenotype was identified among G3 mice of the pedigree R6343, some of which showed increased CD4⁺ to CD8⁺ T cell ratio (Figure 1) due to increased frequencies of CD4⁺ T cells in CD3⁺ T cells (Figure 2) with concomitant reduced frequencies of CD8⁺ T cells in CD3⁺ T cells (Figure 3) in the peripheral blood.

Nature of Mutation

Figure 4. Linkage mapping of the increased CD4+ to CD8+ T cell ratio using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 50 mutations (X-axis) identified in the G1 male of pedigree R6343. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 50 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Irf8:  a T to C transition at base pair 120,753,707 (v38) on chromosome 8, or base pair 17,350 in the GenBank genomic region NC_000074 encoding Irf8.  The strongest association was found with a recessive model of inheritance to the normalized CD4⁺ to CD8⁺ T cell ratio, wherein six variant homozygotes departed phenotypically from 26 homozygous reference mice and 21 heterozygous mice with a P value of 2.977 x 10^-8 (Figure 4).  

The mutation corresponds to residue 1,009 in the mRNA sequence NM_008320 within exon 7 of 9 total exons.

993 GACGAGGTGGTGCAGGTCTTTGACACCAACCAG 314 -D--E--V--V--Q--V--F--D--T--N--Q-

The mutated nucleotide is indicated in red. The mutation results in substitution of valine for an alanine at position 319 (V319A) in the IRF8 protein, and is strongly predicted by Polyphen-2 to be benign (score = 0.429).

Protein Prediction

Figure 5. Domain structure of the IRF8 protein. The DNA binding region (DBD) is characterized by the presence of five highly conserved tryptophans (residues 13, 28, 40, 60, and 79). The phosphorylation of IRF8 at an unconserved serine residue (Ser260) is essential for efficient IRF8 association with IRF1. Tyrosine phosphorylation at Tyr48 prevents IRF8 from binding alone to target DNA. Phosphorylation of the more conserved Tyr95 increased the interaction with PU.1 and IRF1. IAD1 = IRF association domain. The gemini2 mutation results in substitution of valine for an alanine at position 319. This image is interactive. Other mutations found in the IRF8 protein are noted in red. Click on each mutation for more information.

The N-terminal half of IRF8 (residues 1-121) serves as the DNA binding region (1;2), and is characterized by the presence of five highly conserved tryptophans (residues 13, 28, 40, 60 and 79) each separated by 10-20 amino acids (Figure 5) (3).  Crystal structure analyses of IRF DBDs suggest that they comprise a four-stranded antiparallel β-sheet (β1-β4), three helices (α1-α3), and three long loops (L1-L3) connecting β2 to α2, α2 to α3, and β3 to β4, respectively (4-8). IRF family proteins share sequence and structural homology in their DNA binding regions, and all bind to a similar DNA motif (A/G NGAAANNGAAACT) called the IFN-stimulated response element (ISRE) (9) or IFN regulatory element (IRE) (10) that is present in the regulatory regions of interferons and interferon-stimulated genes (ISGs). 

The C-terminal halves of all IRF family members contain either an IRF association domain 1 (IAD1) or an IAD2, with which they bind to other IRFs, other transcription factors, or self-associate. These interactions allow the IRFs to modulate their activity and target a variety of genes. The IAD1 is approximately 177 amino acids in length, and is conserved in all IRFs except IRF1 and IRF2. IAD2 domains are found only in IRF1 and IRF2 (1;2;11). Structural studies of IRF3 and IRF5 demonstrated that the IAD forms a β-sandwich core flanked by N- and C-terminal α-helical regions (12-14), and a conserved α-helix motif exists in the IRF8 IAD domain at amino acids 361-375. 

IRF8 is tyrosine phosphorylated at Tyr48 in its DBD, preventing IRF8 from binding alone to target DNA. Tyr48 is not conserved with other IRFs except for IRF4, suggesting the mechanism behind the poor DNA binding abilities of these two proteins. IRF8 tyrosine phosphorylation also appears to be important for interactions with partner transcription factors including other IRFs (2;15;16). Phosphorylation of the more conserved Tyr 95 results in increased interaction with PU.1 and IRF1, while the tyrosine phosphatase SHP1 (see the record for spin) inhibits the ability of IRF8 to interact with these partners, leading to reduced expression of myeloid specific genes (16). 

The gemini2 mutation results in substitution of valine for an alanine at position 319 (V319A); Val319 is within the IAD1 domain.

See the record Gemini for more information about Irf8.

Putative Mechanism

Irf8^-/- animals display deregulated hematopoiesis with impaired macrophage development, and development of a chronic myelogenous leukemia-like (CML) syndrome characterized by hyperproliferation of abnormal myeloid, histocytic, and lymphocytic cells.  Heterozygous animals displayed less dramatic manifestations of the same phenotypes (17). More recently, IRF8 was found to be important for the differentiation of B cells, DCs, and eosinophils [reviewed by (18;19)], and IRF8-deficient mice display osteoporosis due to an increased numbers of myeloid-derived osteoclasts (20).  In addition, IRF8-deficient mice are susceptible to infection with various pathogens, the control of which requires IFN-γ-mediated immunity.  However, Irf8^-/- animals were able to survive infection with vesicular stomatitis virus (VSV) or influenza A (17;21), which are controlled primarily by type I IFNs and humoral immunity, respectively.

IRF8-deficient mice showed marked expansion of primarily granulocytes in the spleen, lymph node, and bone marrow, suggesting that IRF8 plays a critical role in the differentiation of myeloid cells. During myeloid cell differentiation, IRF8 promotes monocyte/macrophage over granulocyte differentiation (22;23). IRF1 and IRF8 act together to regulate the transcription of a multitude of genes involved in macrophage maturation, function and TLR stimulation including the genes encoding both subunits (p35 and p40) of the IL-12 cytokine (24;25). 

Prepro-B cell numbers were significantly reduced in the bone marrow of Irf8 mutant mice, suggesting that IRF8 plays a role in the differentiation of CLP progenitors to B cells. The decreased commitment of CLPs to develop into B cells was associated with reduced expression of important B cell lineage factors including the transcription factors E2A, EBF (see the record for Crater_lake), and PAX5 (see the record for glacier). IRF8, along with PU.1, was shown to directly regulate the expression of EBF (26) and may also directly regulate the expression of IKAROS (see the record for Star_lord), a transcription factor involved in the generation of primitive lymphoid progenitors (27). EBF is responsible for the activation of several genes involved in B cell lineage commitment including Pax5. 

IRF8 is also involved in the germinal center (GC) program. In Irf8 ^-/- mice, GCs show less organized morphology and Irf8 ^-/- B cells express reduced expression levels of the Aicda (see the record for bellezza) and Bcl6 genes.

IRF4 and IRF8 appear to coordinate the development of DCs. IRF4, but not IRF8, is necessary for CD4⁺ DC differentiation, both IRFs support the development of DN DCs, and IRF8 is important for both CD8α⁺, pDC, Langerhans and interstitial DC differentiation (28-33). IRF8-deficient mice are devoid of pDC and CD8α⁺ DCs and subsequently have impaired production of type I IFN and IL-12p40 (30). In addition to pDC development, IRF8 supports pDC function by being involved in the second, amplifying phase of type I IFN transcription in response to TLR stimulation and viral infections, including MCMV. 

Irf8^-/- fail to mount T_H1 responses (21;34), but this defect is likely due to the inability of IRF8-deficient macrophages and DCs to promote T_H1 differentiation due to impaired production of the major T_H1-promoting cytokine IL-12, rather than a defect in T cells (24;25;35). IRF8 is essential in silencing T_H17 differentiation (36).  A conventional IRF8 knockout model found that there were no defects on T_H1 or T_H2 cells, but that T_H17 cell differentiation was enhanced through the IRF8-mediated targeting of RORγt (see the record for chestnut), a nuclear receptor involved in T_H17 development (36).

The IRF8 IAD domain is crucial for IRF8 function as demonstrated by BXH2 mice, which carry the R249C missense mutation in the IAD and have an almost identical phenotype to Irf8^-/- animals (37).  The phenotype of the gemini2 mice indicates aberrant IRF8-associated function; other immune-related functions have not be assessed in the gemini2 mice.

Primers

PCR Primer
gemini2_pcr_F: GCTGCCTAAGTTGTATGGGC
gemini2_pcr_R: TGCTGTCCTTATACCGAGGG

Sequencing Primer
gemini2_seq_F: GAACCCGTGTGCTTTCCGAC
gemini2_seq_R: AGGCAGGCTAGGCTTCCAAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 492 nucleotides is amplified (chromosome 8, + strand):

1   gctgcctaag ttgtatgggc cggatggcct ggaacccgtg tgctttccga cggccgacac
61  catccccagt gagcggcaga ggcaggtgac ccggaagctg tttgggcacc tggaacgtgg
121 cgtgctactg cacagcaacc gcaagggcgt gttcgtgaag cggctgtgcc agggccgcgt
181 gttctgcagc ggcaacgcgg tggtgtgcaa gggcaggccc aacaagctgg agcgggacga
241 ggtggtgcag gtctttgaca ccaaccagtt catccgaggt cagtaccaag tcacctcgct
301 gccacccact gtccctgcct tagaggtcac acccacctcc ttccttgtgc ctcctgtatc
361 atgggccaag tgcactcttg catggctttg gcagtggtat agctggggga acccttggaa
421 gcctagcctg cctgtgcttt ctgagcgcct gggcaaccct ttcctcacct ccccctcggt
481 ataaggacag ca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Sharf, R., Azriel, A., Lejbkowicz, F., Winograd, S. S., Ehrlich, R., and Levi, B. Z. (1995) Functional Domain Analysis of Interferon Consensus Sequence Binding Protein (ICSBP) and its Association with Interferon Regulatory Factors. J. Biol. Chem.. 270, 13063-13069.

  2. Sharf, R., Meraro, D., Azriel, A., Thornton, A. M., Ozato, K., Petricoin, E. F., Larner, A. C., Schaper, F., Hauser, H., and Levi, B. Z. (1997) Phosphorylation Events Modulate the Ability of Interferon Consensus Sequence Binding Protein to Interact with Interferon Regulatory Factors and to Bind DNA. J. Biol. Chem.. 272, 9785-9792.

  3. Matsuyama, T., Grossman, A., Mittrucker, H. W., Siderovski, D. P., Kiefer, F., Kawakami, T., Richardson, C. D., Taniguchi, T., Yoshinaga, S. K., and Mak, T. W. (1995) Molecular Cloning of LSIRF, a Lymphoid-Specific Member of the Interferon Regulatory Factor Family that Binds the Interferon-Stimulated Response Element (ISRE). Nucleic Acids Res.. 23, 2127-2136.

  4. Escalante, C. R., Shen, L., Escalante, M. C., Brass, A. L., Edwards, T. A., Singh, H., and Aggarwal, A. K. (2002) Crystallization and Characterization of PU.1/IRF-4/DNA Ternary Complex. J. Struct. Biol.. 139, 55-59.

  5. Escalante, C. R., Yie, J., Thanos, D., and Aggarwal, A. K. (1998) Structure of IRF-1 with Bound DNA Reveals Determinants of Interferon Regulation. Nature. 391, 103-106.

  6. Fujii, Y., Shimizu, T., Kusumoto, M., Kyogoku, Y., Taniguchi, T., and Hakoshima, T. (1999) Crystal Structure of an IRF-DNA Complex Reveals Novel DNA Recognition and Cooperative Binding to a Tandem Repeat of Core Sequences. EMBO J.. 18, 5028-5041.

  7. Panne, D., Maniatis, T., and Harrison, S. C. (2007) An Atomic Model of the Interferon-Beta Enhanceosome. Cell. 129, 1111-1123.

  8. Panne, D., Maniatis, T., and Harrison, S. C. (2004) Crystal Structure of ATF-2/c-Jun and IRF-3 Bound to the Interferon-Beta Enhancer. EMBO J.. 23, 4384-4393.

  9. Darnell, J. E.,Jr, Kerr, I. M., and Stark, G. R. (1994) Jak-STAT Pathways and Transcriptional Activation in Response to IFNs and Other Extracellular Signaling Proteins. Science. 264, 1415-1421.

  10. Tanaka, N., Kawakami, T., and Taniguchi, T. (1993) Recognition DNA Sequences of Interferon Regulatory Factor 1 (IRF-1) and IRF-2, Regulators of Cell Growth and the Interferon System. Mol. Cell. Biol.. 13, 4531-4538.

  11. Meraro, D., Hashmueli, S., Koren, B., Azriel, A., Oumard, A., Kirchhoff, S., Hauser, H., Nagulapalli, S., Atchison, M. L., and Levi, B. Z. (1999) Protein-Protein and DNA-Protein Interactions Affect the Activity of Lymphoid-Specific IFN Regulatory Factors. J. Immunol.. 163, 6468-6478.

  12. Chen, W., Lam, S. S., Srinath, H., Jiang, Z., Correia, J. J., Schiffer, C. A., Fitzgerald, K. A., Lin, K., and Royer, W. E.,Jr. (2008) Insights into Interferon Regulatory Factor Activation from the Crystal Structure of Dimeric IRF5. Nat. Struct. Mol. Biol.. 15, 1213-1220.

  13. Qin, B. Y., Liu, C., Lam, S. S., Srinath, H., Delston, R., Correia, J. J., Derynck, R., and Lin, K. (2003) Crystal Structure of IRF-3 Reveals Mechanism of Autoinhibition and Virus-Induced Phosphoactivation. Nat. Struct. Biol.. 10, 913-921.

  14. Takahasi, K., Suzuki, N. N., Horiuchi, M., Mori, M., Suhara, W., Okabe, Y., Fukuhara, Y., Terasawa, H., Akira, S., Fujita, T., and Inagaki, F. (2003) X-Ray Crystal Structure of IRF-3 and its Functional Implications. Nat. Struct. Biol.. 10, 922-927.

  15. Meraro, D., Gleit-Kielmanowicz, M., Hauser, H., and Levi, B. Z. (2002) IFN-Stimulated Gene 15 is Synergistically Activated through Interactions between the myelocyte/lymphocyte-Specific Transcription Factors, PU.1, IFN Regulatory Factor-8/IFN Consensus Sequence Binding Protein, and IFN Regulatory Factor-4: Characterization of a New Subtype of IFN-Stimulated Response Element. J. Immunol.. 168, 6224-6231.

  16. Kautz, B., Kakar, R., David, E., and Eklund, E. A. (2001) SHP1 Protein-Tyrosine Phosphatase Inhibits gp91PHOX and p67PHOX Expression by Inhibiting Interaction of PU.1, IRF1, Interferon Consensus Sequence-Binding Protein, and CREB-Binding Protein with Homologous Cis Elements in the CYBB and NCF2 Genes. J. Biol. Chem.. 276, 37868-37878.

  17. Holtschke, T., Lohler, J., Kanno, Y., Fehr, T., Giese, N., Rosenbauer, F., Lou, J., Knobeloch, K. P., Gabriele, L., Waring, J. F., Bachmann, M. F., Zinkernagel, R. M., Morse, H. C.,3rd, Ozato, K., and Horak, I. (1996) Immunodeficiency and Chronic Myelogenous Leukemia-Like Syndrome in Mice with a Targeted Mutation of the ICSBP Gene. Cell. 87, 307-317.

  18. Savitsky, D., Tamura, T., Yanai, H., and Taniguchi, T. (2010) Regulation of Immunity and Oncogenesis by the IRF Transcription Factor Family. Cancer Immunol. Immunother.. 59, 489-510.

  19. Wang, H., and Morse, H. C.,3rd. (2009) IRF8 Regulates Myeloid and B Lymphoid Lineage Diversification. Immunol. Res.. 43, 109-117.

  20. Zhao, B., Takami, M., Yamada, A., Wang, X., Koga, T., Hu, X., Tamura, T., Ozato, K., Choi, Y., Ivashkiv, L. B., Takayanagi, H., and Kamijo, R. (2009) Interferon Regulatory Factor-8 Regulates Bone Metabolism by Suppressing Osteoclastogenesis. Nat. Med.. 15, 1066-1071.

  21. Giese, N. A., Gabriele, L., Doherty, T. M., Klinman, D. M., Tadesse-Heath, L., Contursi, C., Epstein, S. L., and Morse, H. C.,3rd. (1997) Interferon (IFN) Consensus Sequence-Binding Protein, a Transcription Factor of the IFN Regulatory Factor Family, Regulates Immune Responses in Vivo through Control of Interleukin 12 Expression. J. Exp. Med.. 186, 1535-1546.

  22. Tamura, T., Nagamura-Inoue, T., Shmeltzer, Z., Kuwata, T., and Ozato, K. (2000) ICSBP Directs Bipotential Myeloid Progenitor Cells to Differentiate into Mature Macrophages. Immunity. 13, 155-165.

  23. Tsujimura, H., Nagamura-Inoue, T., Tamura, T., and Ozato, K. (2002) IFN Consensus Sequence Binding protein/IFN Regulatory Factor-8 Guides Bone Marrow Progenitor Cells Toward the Macrophage Lineage. J. Immunol.. 169, 1261-1269.

  24. Masumi, A., Tamaoki, S., Wang, I. M., Ozato, K., and Komuro, K. (2002) IRF-8/ICSBP and IRF-1 Cooperatively Stimulate Mouse IL-12 Promoter Activity in Macrophages. FEBS Lett.. 531, 348-353.

  25. Liu, J., Guan, X., Tamura, T., Ozato, K., and Ma, X. (2004) Synergistic Activation of Interleukin-12 p35 Gene Transcription by Interferon Regulatory Factor-1 and Interferon Consensus Sequence-Binding Protein. J. Biol. Chem.. 279, 55609-55617.

  26. Wang, H., Lee, C. H., Qi, C., Tailor, P., Feng, J., Abbasi, S., Atsumi, T., and Morse, H. C.,3rd. (2008) IRF8 Regulates B-Cell Lineage Specification, Commitment, and Differentiation. Blood. 112, 4028-4038.

  27. Ma, S., Pathak, S., Trinh, L., and Lu, R. (2008) Interferon Regulatory Factors 4 and 8 Induce the Expression of Ikaros and Aiolos to Down-Regulate Pre-B-Cell Receptor and Promote Cell-Cycle Withdrawal in Pre-B-Cell Development. Blood. 111, 1396-1403.

  28. Tsujimura, H., Tamura, T., and Ozato, K. (2003) Cutting Edge: IFN Consensus Sequence Binding protein/IFN Regulatory Factor 8 Drives the Development of Type I IFN-Producing Plasmacytoid Dendritic Cells. J. Immunol.. 170, 1131-1135.

  29. Schiavoni, G., Mattei, F., Sestili, P., Borghi, P., Venditti, M., Morse, H. C.,3rd, Belardelli, F., and Gabriele, L. (2002) ICSBP is Essential for the Development of Mouse Type I Interferon-Producing Cells and for the Generation and Activation of CD8alpha(+) Dendritic Cells. J. Exp. Med.. 196, 1415-1425.

  30. Aliberti, J., Schulz, O., Pennington, D. J., Tsujimura, H., Reis e Sousa, C., Ozato, K., and Sher, A. (2003) Essential Role for ICSBP in the in Vivo Development of Murine CD8alpha + Dendritic Cells. Blood. 101, 305-310.

  31. Suzuki, S., Honma, K., Matsuyama, T., Suzuki, K., Toriyama, K., Akitoyo, I., Yamamoto, K., Suematsu, T., Nakamura, M., Yui, K., and Kumatori, A. (2004) Critical Roles of Interferon Regulatory Factor 4 in CD11bhighCD8alpha- Dendritic Cell Development. Proc. Natl. Acad. Sci. U. S. A.. 101, 8981-8986.

  32. Tamura, T., Tailor, P., Yamaoka, K., Kong, H. J., Tsujimura, H., O'Shea, J. J., Singh, H., and Ozato, K. (2005) IFN Regulatory Factor-4 and -8 Govern Dendritic Cell Subset Development and their Functional Diversity. J. Immunol.. 174, 2573-2581.

  33. Schiavoni, G., Mattei, F., Borghi, P., Sestili, P., Venditti, M., Morse, H. C.,3rd, Belardelli, F., and Gabriele, L. (2004) ICSBP is Critically Involved in the Normal Development and Trafficking of Langerhans Cells and Dermal Dendritic Cells. Blood. 103, 2221-2228.

  34. Scharton-Kersten, T., Contursi, C., Masumi, A., Sher, A., and Ozato, K. (1997) Interferon Consensus Sequence Binding Protein-Deficient Mice Display Impaired Resistance to Intracellular Infection due to a Primary Defect in Interleukin 12 p40 Induction. J. Exp. Med.. 186, 1523-1534.

  35. Fehr, T., Schoedon, G., Odermatt, B., Holtschke, T., Schneemann, M., Bachmann, M. F., Mak, T. W., Horak, I., and Zinkernagel, R. M. (1997) Crucial Role of Interferon Consensus Sequence Binding Protein, but neither of Interferon Regulatory Factor 1 nor of Nitric Oxide Synthesis for Protection Against Murine Listeriosis. J. Exp. Med.. 185, 921-931.

  36. Ivanov, I. I., McKenzie, B. S., Zhou, L., Tadokoro, C. E., Lepelley, A., Lafaille, J. J., Cua, D. J., and Littman, D. R. (2006) The Orphan Nuclear Receptor RORgammat Directs the Differentiation Program of Proinflammatory IL-17+ T Helper Cells. Cell. 126, 1121-1133.

  37. Turcotte, K., Gauthier, S., Tuite, A., Mullick, A., Malo, D., and Gros, P. (2005) A Mutation in the Icsbp1 Gene Causes Susceptibility to Infection and a Chronic Myeloid Leukemia-Like Syndrome in BXH-2 Mice. J. Exp. Med.. 201, 881-890.