Phenotypic Mutation 'Myd88rev1'

• Allele: Myd88rev1
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 119,337,394 bp (GRCm38)
• Base Change: A ⇒ T (forward strand)
• Gene: Myd88
• Gene Name: myeloid differentiation primary response gene 88
• Chromosomal Location: 119,335,934-119,341,411 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Phenylalanine changed to Isoleucine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P22366
• SMART Domains: Protein: ENSMUSP00000035092; Gene: ENSMUSG00000032508; AA Change: F285I

Domain	Start	End	E-Value	Type
DEATH	19	109	7.17e-15	SMART
TIR	160	296	3.39e-25	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
  (Using ENSMUST00000035092)
• SMART Domains: Protein: ENSMUSP00000115746; Gene: ENSMUSG00000032508

Domain	Start	End	E-Value	Type
Pfam:Death	50	109	3.5e-13	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Penetrance: unknown
• Mode of Inheritance: Unknown
• Local Stock: Sperm, gDNA
• Last Updated: 2017-06-14 10:39 AM by Katherine Timer
• Record Created: unknown
• Record Posted: 2010-02-08
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine, Katherine Timer
• Authors: Kevin Khovananth, Owen Siggs, Yu Xia and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010851; MGI: 108005

Alleles Listed at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(3) Chemically induced(2)

Repository

none

Phenotypic Description

The Myd88rev1 allele was discovered in a sequencing screen of G1 mice born to N-ethyl-N-nitrosourea (ENU)-mutagenized sires. DNA collected from animals was sequenced using primers directed against the Myd88 gene. 

 

Peritoneal macrophages from Myd88rev1 homozygotes were tested in several ex vivo assays. Tumor necrosis factor (TNF)-α production in these macrophages was normal in response to Toll-like receptor (TLR) stimulation including the TLR2/6 ligands MALP2 (macrophage-activating lipopeptide 2) and peptidoglycan (PGN), the TLR9 ligand CpG DNA, the TLR4 ligand lipopolysaccharide (LPS), the TLR1/2 ligand Pam₃CSK₄ (a triacyl lipopeptide), the TLR7 ligand resiquimod (a ssRNA mimetic), and the TLR3 ligand poly I:C (a dsRNA mimetic) (TLR Signaling Screen). Myd88rev1 macrophages produce normal amounts of double-stranded DNA-induced type I interferon (IFN) (Double-stranded DNA Macrophage Screen), LPS/nigericin-induced interleukin (IL)-1β (NALP3 Inflammasome Screen), and are resistant to infection with mouse cytomegalovirus (MCMV), influenza virus, Rift Valley Fever virus (RVFV), and an adenoviral vector (Ex Vivo Macrophage Screen for Control of Viral Infection).

 

Nature of Mutation

The Myd88rev1 mutation is a T to A transversion identified in exon 5 (of 6 total exons) at position 934 of the Myd88 transcript.

 

919 TGCACCAAGTCCTGGTTCTGGACCCGCCTTGCC

280 -C--T--K--S--W--F--W--T--R--L--A-

 

The mutated nucleotide is indicated in red lettering, and results in a conversion of phenylalanine to isoleucine at residue 285 of the MyD88 protein.

Protein Prediction

Figure 1. Solution structure of the MyD88 TIR domain. The central five β-strands are shown in cyan while the surrounding α-helices are shown in pink. The BB loop important for MyD88 binding to TLRs, and the αE helix important for homotypic interactions, are labeled. The amino acid altered by the Myd88rev1 mutation is indicated. UCSF Chimera structure is based on PDB 2Z5V, Ohnishi et al, Proc. Natl. Acad. Sci. U.S.A. 106, 10260-10265 (2009). Click on the 3D structure to view it rotate.

Figure 2. MyD88 domain structure and 3D TIR domain. A, MyD88 is a 296 amino acid protein adapter. It contains an N-terminal death domain (DD) that acts as a protein-protein interaction domain that mediates homotypic interactions with other death domain-containing proteins in order to propagate signaling. The death domain of MyD88 is required for binding to IL-1 receptor associated kinase (IRAK) family proteins. The C-terminal portion of MyD88 contains a Toll/IL-1 receptor (TIR) domain, a conserved region which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs, IL receptors and the adapters MyD88 and TIRAP contain three conserved boxes (boxes 1, 2 and 3), which are required for signaling. Between the death domain and TIR domain is an “intermediate domain” that may be required for differential activation of distinct NF-κB- versus JNK-dependent transcriptional programs. The Myd88rev mutation results in a substitution of a highly conserved phenylalanine with isoleucine at residue 285. B, The 3D structure shows the six α-helices and five β-strands of the TIR domain. 3D structure was created using UCSF Chimera package (2Z5V). This image is interactive. Click on the image to view other mutations found in MyD88 (red). Click on the mutations for more specific information. Click on the 3D structure to view it rotate.

The Myd88rev1 mutation results in substitution of an isoleucine for a highly conserved phenylalanine at residue 285 of MyD88 located in the αE helix of the MyD88 TIR domain (Figures 1 and 2).

 

Please see the record for pococurante for information about Myd88.

Putative Mechanism

Figure 3. MyD88 signaling pathways. MyD88 is a protein adapter that relays signals from the IL-1 and IL-8 receptors (not shown) and from most TLRs. Activation of these receptors leads to MyD88 recruitment to the receptor complexes, where it recruits IRAK family proteins, first IRAK-4 and then IRAK-1, as well as TRAF6. The signaling pathway culminates in the activation of NF-κB-dependent transcription. MyD88 and TRAF6 may interact directly with IRF5 in a complex, activating IRF5 and promoting its translocation to the nucleus. MyD88, together with TRAF6 and IRAK4, has also been shown to bind IRF7 directly. This occurs downstream of TLR7, TLR8 and TLR9 in plasmacytoid dendritic cells and requires the phosphorylation of IRF7 by IRAK1.

The α_E helix of the MyD88 TIR domain is known to participate in important protein-protein interactions critical for MyD88 function. In particular, the α_E helix has been proposed to contribute to homotypic oligomerization of TIR domains, which is necessary for the propagation of signal from the MyD88 receptor to more distal elements of the TLR signaling pathway (Figure 3). Mutation of two conserved amino acids to two alanines within the α_E helix of either TLR2 or MyD88 prevents ligand-induced NF-κB activation in vitro (1,2), but does not prevent the association of MyD88 with TLRs suggesting that these residues instead affect homotypic interactions. Interestingly, one of the amino acids mutated in these studies is F285, the same residue affected by the Myd898rev1 mutation. Clearly, mutating this residue to an isoleucine has no effect on the function of MyD88 in vivo. As the previous in vitro studies analyzed the effects of mutating both F285 and W286 at the same time, it is likely that W286, not F285, is the critical amino acid responsible for mediating homotypic TIR interactions despite the high conservation of both of these residues or that both of these residues need to be altered in order to affect function. It is also possible that the alanine substitution at amino acid 285 has more impact than substitution with an isoleucine.

Primers

Primers cannot be located by automatic search.

Genotyping

Myd88rev1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

Primers

Myd88rev1 (F): 5’- TGCAGGAGATGATCCGGCAACTAGAACAGAC -3’

Myd88rev1 (R): 5’- CTCAACTAGTCCTTCGCTTAGACTCATGCAGCCC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Myd88rev1_seq(F): 5'- CATTGCCAGCGAGCTAATTGAG -3'

Myd88rev1_seq(R): 5’- GCCCTGATAAACACTGTCCTG -3’

 

The following sequence of 1006 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 9, bases 119,246,239 to 119,247,244) is amplified:

 

                                                           tgcagg

agatgatccg gcaactagaa cagacagact atcggcttaa gttgtgtgtg tccgaccgtg

acgtcctgcc gggcacctgt gtctggtcca ttgccagcga gctaattgag aaaaggttgg

ttaaacatct aagagggtag gtgggtgaat gcatgaaacc cagaggtcca gatgcaagga

ctgtcctgct agctgggctc tgtcccgcct gggtaatgta gtccttcctg accccatcct

ctgaaggaag tcaccgcagt gccactctcc ctcaggtgtc gccgcatggt ggtggttgtt

tctgacgatt atctacagag caaggaatgt gacttccaga ccaagtttgc actcagcctg

tctccaggta agcttaggcc tgctttggtc aaagagagag tagagatata gccttaggat

gatagtccag gaatgcaaaa ccaaagcact acagatctct gaggacggac ctgtgtactt

ccttatgtag tggatatgta tcatggatac ctggttggtg gagagctggt gttagcccgt

gctttaggga ctgagcctgt cccaccctag ggccccacgt ggtcctaata ccacaccctt

tggccttcag gtgtccaaca gaagcgactg attcctatta aatacaaggc gatgaagaag

gactttccca gtatcctgcg gttcatcact atatgcgact ataccaaccc ttgcaccaag

tcctggttct ggacccgcct tgccaaggct ttgtccctgc cctgaagatg accctgggag

ccctaggtat gtcagtctgt ctgtgttctt ccgcttgcct cctttgacac tgtagtgggg

agcttgtggt ccgtctatcc ctagacatct acagtagcca gatgtcatct ctcaagtcct

tacggaacca gtgactgcaa gtgacattat gacttgccgg gttgccagcc aggacagtgt

ttatcagggc tgcatgagtc taagcgaagg actagttgag

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References

1.  Jiang, Z., Georgel, P., Li, C., Choe, J., Crozat, K., Rutschmann, S., Du, X., Bigby, T., Mudd, S., Sovath, S., Wilson, I. A., Olson, A., and Beutler, B. (2006) Details of Toll-like receptor:adapter interaction revealed by germ-line mutagenesis, Proc Natl Acad Sci U S A 103, 10961-10966.

2.  Li, C., Zienkiewicz, J., and Hawiger, J. (2005) Interactive sites in the MyD88 Toll/interleukin (IL) 1 receptor domain responsible for coupling to the IL1beta signaling pathway, J. Biol. Chem. 280, 26152-26159.