Allele | iconoclast | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 129,555,604 bp (GRCm38) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ G (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Lck | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | lymphocyte protein tyrosine kinase | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Hck-3, p56 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 129,548,344-129,573,641 bp (-) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016] PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_010693; MGI: 96756
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Leucine changed to Proline | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P06240 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000066209 Gene: ENSMUSG00000000409 AA Change: L300P
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000099656 Gene: ENSMUSG00000000409 AA Change: L300P
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000119263 Gene: ENSMUSG00000000409
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000125777 Gene: ENSMUSG00000000409 AA Change: L311P
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available ![]() |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) ![]() |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Sperm, gDNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 030958-UCD | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2018-01-05 3:13 PM by Eva Marie Y. Moresco | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2009-02-05 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation | ![]() 1070 CTGCAGCACCCGCGGCTAGTCCGGCTTTATGCA
295 -L--Q--H--P--R--L--V--R--L--Y--A-
The mutated nucleotide is indicated in red lettering, and results in a leucine to proline change at amino acid 300.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
The elucidation of crystal structures for Src, Hck, Lck, and PKA, revealed a classical regulatory mechanism common to Src family kinases, in which the phosphorylation status of two critical tyrosines, one in the C-terminal tail and one in the activation loop, dictates the activation status of these enzymes. Src family kinases are held in a closed, inactive conformation by intramolecular interactions between a phosphorylated tyrosine in the C-terminal tail (Y505 in Lck) and the SH2 domain (Figure 2B, PDB ID 2SRC) (2-4;6). This interaction couples the SH2 domain to the C-terminal tail, and also holds the SH2 and SH3 domains in a rigid conformation that disfavors kinase activation (7). Mutation of tyrosine 505 to phenylalanine, analogous to a Y572F mutation in Src, results in constitutive Lck kinase activation and confers transforming ability to the mutant protein (8-11). The phosphorylation status of Lck Y505 is controlled by the actions of the c-Src kinase (Csk) and the phosphatase CD45 (12-15).
In addition to the SH2-C-terminal tail interaction, the closed conformation of Src family kinases is also maintained by the docking of the SH3 domain onto an internal polyproline type II helical sequence formed by the linker between the SH2 and kinase domains (2-4). This polyproline helix is sandwiched between the SH3 domain and the back surface of the N-terminal lobe of the catalytic domain. It is thought that the binding of the SH2 domain to the phosphorylated tail segment is important for correctly positioning the SH2-kinase domain linker for interaction with the SH3 domain. Consistent with this hypothesis, maximal activation of Hck by the SH3-binding protein HIV-1 Nef occurs when the SH3 domain is displaced (16). In Lck, the polyproline sequence in the SH2-kinase domain linker (amino acids 224-237) follows the consensus PxxP motif preferred by SH3 domains (PQKP, amino acids 229-232).
Unique to each Src family kinase is a 60-80 amino acid sequence at the extreme N-terminus, the structure of which is unknown. In Lck, the unique region (amino acids 1-62) functions to target the protein to the plasma membrane and/or lipid rafts through the attachment of fatty acid chains to select residues. Lck contains a conserved glycine residue at position 2 which is cotranslationally myristoylated following removal of the start methionine. Myristoylation of glycine 2 is required for the subsequent reversible palmitoylation of cysteines 3 and 5 (20;21). The unique region also mediates Lck binding to CD4 and CD8, coreceptors for the T cell receptor, through the interaction of a dicysteine motif in Lck (CxxC, amino acids 20-23) with two cysteines in the cytoplasmic domains of CD4 and CD8α (CxCP) (22;23). A Zn2+ ion is necessary for this interaction (24;25). NMR structures of portions of the CD4 or CD8 cytoplasmic tail and the unique region of Lck demonstrate that the four cysteines, located within short α-helices on each molecule, coordinate Zn2+ with a tetrahedral conformation to form a “zinc clasp” (26). Association of CD4 and CD8 with Lck is not thought to be regulated by changes in cellular Zn2+ concentration, and except for a requirement for CD4 phosphorylation on serine 408, the mechanism by which the complexes are dissociated is unknown (27).
The iconoclast mutation lies in the N-lobe of the Lck kinase domain, within the loop connecting helix αC and strand β4, and likely results in a protein with reduced function(Figure 3, PDB ID 3LCK). The effect of the mutation on kinase activity, expression level, or localization has not been tested.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | Lck expression is specific to lymphoid cells, being found predominantly in CD4+ and CD8+ T cells, at lower levels in B cells, but not in monocytes, granulocytes, or non-hematopoietic cells (28). In humans, expression of Lck transcripts is induced concomitantly with the appearance of lymphoid cells in the developing thymus (28). Its expression is highest in thymocytes with rearranged α, β, and γ T cell receptor (TCR) genes, and lowest in thymocytes with germline α, β, and γ TCR genes (29). Lck mRNA is detected in leukemia T cell lines and B cell lines, and in some human colon carcinoma and non-lymphoid tumor cell lines (29-31).
Transcription of the human lck gene is controlled by two widely separated promoters, designated type I and type II, leading to transcripts that differ in the nucleotide sequence of the 5’ untranslated region. The type I proximal promoter is located immediately upstream of exon 1, while the type II distal promoter is located about 25 kb upstream from the type I promoter (32;33). The utilization of the two promoters appears to depend on the cell type, with the type I proximal promoter active mainly in thymocytes, and the type II distal promoter active mainly in mature peripheral T cells (33;34). B cell lines exclusively utilize the type I promoter (35). Transformed lymphoid cells use both types of promoters (35). Interestingly, a similar type II promoter sequence is found in humans and mice, but mice lack the type I proximal promoter sequence (33). Both the proximal and distal promoters from humans function appropriately when introduced transgenically into mice (36).
Subcellularly, Lck is associated with the plasma membrane in T cells; it can be recovered in the soluble cytoplasmic fraction of unstimulated CD4+ T cells (37;38). Lck rapidly translocates to lipid rafts within the first ten seconds after TCR/CD4 engagement (37). Lck has also been detected in association with pericentrosomal vesicles, but the significance of this finding is unknown (38).
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
As discussed above (see Protein Prediction), Lck activity is regulated by the phosphorylation status of two key tyrosine residues, one in the kinase domain and one at the C terminus. Phosphorylation of the kinase domain Y394 enhances kinase activity, whereas phosphorylation of Y505 has an inhibitory effect (40). Inhibition or activation of Lck by phosphorylation or dephosphorylation of Y505 occurs through the c-Src tyrosine kinase (CSK) or the transmembrane phosphatase CD45 (mutated in belittle), respectively [reviewed in (45)]. In addition, CD45 is able to dephosphorylate Y394 in the active site of Lck, suggesting that CD45 can also downregulate the activity of Lck (46-48). Lck is also inhibited by the protein tyrosine phosphatase SHP1 (see the record for spin), which can dephosphorylate Y394 (49). Conformationally, Lck may therefore exist in an equilibrium state, where subpopulations of molecules simultaneously exist as (1) open and activated (phosphorylated on Y394), (2) open and not activated – or ‘primed’, and (3) closed and not activated (45). CD4 or CD8 coreceptor ligation might shift the equilibrium toward open and activated states by clustering and activating Lck molecules, culminating in a tyrosine kinase cascade. Lck is also regulated by degradation through the c-Cbl ubiquitin ligase, which is part of the ubiquitin-mediated pathway (50).
Development of thymocytes into mature T cells occurs in the thymus through a differentiation program characterized by the expression of certain cell-surface markers [reviewed in (40)]. The most immature stage of thymocyte development is known as the double negative (DN) stage due to the lack of expression of the T cell coreceptors CD4 and CD8. Differentiation proceeds through several stages known as DN1-4 during which the thymocytes initiate the αβ T-cell developmental pathway. The DN3 stage is the first critical checkpoint during thymocyte development. Progression and expansion past DN3 requires surface expression of the product of a productive chromosomally rearranged TCRβ chain, which pairs with an invariant pre-TCRα chain and then forms a complex with CD3 and TCRζ. This complex is known as the pre-TCR and produces a TCR-like signal. Cells unable to generate a proper pre-TCR signal are arrested and die at the DN3 stage. After progressing through the DN4 stage, thymocytes then express both CD4 and CD8 and are known as double positive (DP) cells. Progression past this state to single positive CD4 or CD8 cells requires a TCR signal that occurs through a newly rearranged TCRα chain and the previously expressed TCRβ chain. The strength of interaction of the final TCRαβ receptor to self-MHC molecules expressed on stromal or APCs in the thymus determines whether or not thymocytes are positively selected and survive to become a single positive (SP) CD4 or CD8 T cell. Strong interactions and increased TCR signaling likely represents autoreactivity and results in negative selection, while moderate interactions indicates usefulness of the TCR and results in positive selection. Cells that are unable to effectively bind MHC are eliminated.
In animal models that are Lck-deficient or are transgenic for a dominant-negative form of Lck, severe combined immunodeficiency (SCID)-like phenotypes are observed. These animals demonstrate severe T cell developmental defects with pronounced thymic deficiency and a dramatic reduction in DP thymocytes, indicating a significant although incomplete block at the DN3 stage of development where pre-TCR signaling is required for further differentiation (51;52). Mature single-positive thymocytes are absent and peripheral T cells are much reduced. A complete block at the DN3 stage occurred in mice that were deficient for both the Lck and Fyn kinases, showing some functional overlap between these two proteins (53;54).
Due to the severe developmental block found in Lck deficient mice, the role of Lck in subsequent T cell differentiation and activation events could not be evaluated. The development of conditional transgenic mice in combination with the knockout model allowed the study of Lck during the subsequent steps of T cell development and maturation. Interestingly, increasing Lck activity using various conditional transgenes was sufficient to promote DP cells specifically to the CD4 lineage (55;56), suggesting that the mechanism for CD4 or CD8 positive selection depends on the strength and/or the duration of the TCR signal (39;40). Similarly, using conditional transgenic mice in an Lck-deficient background revealed that Lck was necessary for the homeostatic expansion, but not the survival of naïve peripheral T cells (57;58). Further studies demonstrated that peripheral T cell survival still depended on TCR signaling, but that Fyn and Lck were functionally redundant in this context (59). Other studies have demonstrated that Lck is necessary for any process that requires TCR signaling including Fas-dependent activation-induced cell death resulting from repeated TCR stimulation (60), and the development and function of CD4+ regulatory T cells (Tregs). Signaling through the CD28 coreceptor and Lck results in upregulation of the Treg master-regulatory transcription factor Foxp3 (see the record for crusty) (61).
Although Lck primarily has a role in T cell development and activation, it also functions in B and natural killer (NK) cells. Lck protein is also found in B-1 cells, a minor but important subset of B cells (31). B-1 cells secrete large quantities of IgM, IgG3 and IgA, mostly specific for multivalent self-antigens, and are thought to be responsible for natural immunity (62). Engagement of the B cell receptor (BCR) in most B cells leads to robust mobilization of intracellular calcium and proliferation, but B-1 cells are characterized by more modest responses, and increased apoptosis (63;64). Examination of these cells in Lck null animals suggests that expression of Lck in these cells is required for BCR signaling and is responsible for the characteristic B-1 response (65;66). In a subset of peripheral NK cells, Lck associates with the MHC-class I activating receptor, CD160 and is necessary in activating downstream signaling pathways (67). Lck also associates with and is necessary for signaling through the NK cell receptor protein 1 (NKR-P1) family, which includes the NK marker NK1.1 (see the record for Unnatural) (68).
Due to its critical role in TCR signaling, alterations in Lck activity or expression are involved in the progression of diverse immune diseases in humans. In patients with the autoimmune diseases Systemic Lupus Erthematosus (SLE; OMIM #152700) and type I diabetes (IDDM1, OMIM #222100), reduced levels of Lck were observed in periphal blood lymphocytes (PBLs) (69;70). In IDDM patients, this reduced level of Lck correlated with diminished responses following T cell activation. In SLE, downregulated Lck is also associated with reduced T cell proliferative responses to antigens. However, it is likely that the abnormal and prolonged localization of CD45 to Lck-containing lipid rafts in PBLs from SLE patients results in inappropriate Lck dephosphorylation, which may contribute to T cell autoreactivity. Increased Lck activity results in increased ubiquitin-mediated Lck proteolysis and reduced levels of total Lck in these patients [reviewed in (71)]. Increased Lck levels and activity have also been found in patients with T-lymphoblastic leukemia (T-ALL) (72;73). Lck deficiency or reduction in Lck activity is associated with selective CD4+ lymphopenia, causing various syndromes including SCID and common variable immunodeficiency (CVID; OMIM #240500) (74-76).
Several studies have shown that Lck plays important roles in the life cycle of various viruses. Herpesvirus saimiri (HVS) is an oncogenic virus that infects T lymphocytes. Successful infection and replication depends on the ability of the virus to downregulate normal T cell responses, which it does so partly by targeting Lck, and thus the TCR complex, for lysosomal degradation (77;78). Similarly, human immunodeficiency virus (HIV) induces dysfunctional T cell responses in humans. In HIV-infected patients, T cells exhibit reduced recruitment of Lck to the immunological synapse and lipid rafts resulting in decreased TCR signaling (79), although other studies suggest that HIV infection and expression of HIV proteins could upregulate Lck inappropriately, leading to T cell apoptosis (80). Interestingly, HIV replication is influenced by the presence of Lck. In the absence of Lck, HIV replication is reduced due to the decreased recruitment of HIV to the plasma membrane and the inability of the virus to be released from the cell (81).
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The iconoclast mutation is located on the back of the N-lobe of the Lck kinase domain, within the loop connecting helix αC and strand β4 (loop αC/β4, amino acids 294-303), opposite the catalytic cleft. The crystal structure of chicken Src shows that the αC/β4 loop stays in the same place whether the αC helix is in its active or inactive conformation (4). Despite its stationary position, mutational analysis using an S. pombe regulation assay indicates that select point mutations within the αCβ4 loop prevent negative regulation by Csk (82). This assay monitors tyrosine phosphorylation of yeast proteins and lethality induced by expression of Src, which are rescued by coexpression of Csk. Mutation of Q324 (R302 in Lck) to either arginine or glutamic acid in Src greatly impaired the ability of Src to be regulated by Csk, resulting in high levels of phosphotyrosine-containing proteins despite coexpression of Csk. However, mutation of either R318 or E320 in Src (Q296 and Q298 in Lck) did not affect Src regulation by Csk. The reasons why some, but not other mutations within loop αC/β4 prevent regulation by Csk remain unclear. Q324 may be important because it forms multiple hydrogen bonds with the SH2-kinase domain linker (2-4), and has been suggested to keep the interaction of the linker with the αC helix fixed at one end (82). In contrast to this activating mutation, the iconoclast mutation apparently results in reduced protein function. The substitution of a rigid proline residue for leucine likely disrupts the secondary structure and/or hydrogen bond formation of the αC/β4 loop, and may prevent the αC helix from assuming the active conformation necessary for kinase activation.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Iconoclast genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
Primers for PCR amplification
Icono(F): 5’- ACGATCTAGTCCGCCATTACACCAG -3’
Icono(R): 5’- AGGAACTGCTCTTCCATCCCCATAG -3’
PCR program (use SIGMA JumpStart REDTaq)
1) 94°C 2:00
2) 94°C 0:30
3) 56°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 29X
6) 72°C 7:00
7) 4°C ∞
Primers for sequencing
Icono_seq (F): 5’- CCCTCGGGACTGATTGGAAAG -3’
Icono_seq (R): 5'- TAGCTCAGCGTTTGAGAGCAC -3'
The following sequence of 1527 nucleotides (from Genbank genomic region NC_000070 for linear genomic sequence of Lck) is amplified:
2062 acgatctag tccgccatta caccagtgag ctccggcgga
2101 atgcgttcac ctgtgcccat cctagcagcc tctctctctc ccgcacccag tccttcttag 2161 ggactctcca aacgtctttc attccccttc agtggatgag gggtatagaa cctgacccta 2221 gaccctgccg gctaatgttg aatgacccac gttttccctc ccataccagt cggtttcccc 2281 tgcgaggaaa gtggagagag ggtaggggct ggagggagca tccaaggtct ctagtgaccg 2341 cattaacctt ctcttttgtc tatgcagacg cctctgatgg gctgtgcaca aagttgagcc 2401 gtccttgcca gacccagaag ccccagaaac catggtggga ggacgaatgg gaagttccca 2461 gggaaacact gaagttggtg gagcggctgg gagctggcca gttcggggaa gtgtggatgg 2521 gtgagtgtga ccctcgggac tgattggaaa gaggagagag aatgtgagct tcctctcaca 2581 ctggcctatt caggatggct gcctagttcg tcaggatctt gacctctgta acttctccac 2641 ccgtacccca tcagggtact acaacggaca cacgaaggtg gcggtgaaga gtctgaaaca 2701 agggagcatg tcccccgacg ccttcctggc tgaggctaac ctcatgaagc agctgcagca 2761 cccgcggcta gtccggcttt atgcagtggt cacccaggaa cccatctaca tcatcacgga 2821 atacatggag aacggtgggt gccctgctat gtccagccgc ttgagggcgc tattgtggtc 2881 ccactacctt ttggacccag ggaaggaagg cgcttttacc tctgatcttc taaagactct 2941 tttctgggtc cctaagcttt ggaagaacgt tccatctgat agtccctgat cttcagtttc 3001 tgttcctttc ttccaatgcc cacctgggtt tcagaatgct tgacctaaga aatggtgtat 3061 ggtgcctgaa gagaccagaa aggagtgtgg gataccctgg agttacagac aattgtgagc 3121 tactggggat caaacgcggg tcctctggaa gagcagccag tgctctcaaa cgctgagcta 3181 cctttctagc ccaaatatgt agtatgtttg ttaaggatcc aagagtctga ctgcctggat 3241 agagttgagg ctttataatt gtatggcttt gggctgatcc catcacggct ttctgctcca 3301 aatagttctt tttaatctgt aaaatagcgg gtttagggcc agcaagatgg ctcagcaggt 3361 aaaggtgctt gctgacaagc ctgatgagca ggagttcaat gcctggaatc cacaggagag 3421 agggaaagag ctggctctta ccagagttgt cctctggtct ccatacgtgt gtaatggctc 3481 atgcatgtgc cgcctcctat gaataaatac atgtaattaa agcatagcgg cactagtgga 3541 agagctgcat ctctacatag ttgctatggg gatggaagag cagttcct PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Eva Marie Y. Moresco, Nora G. Smart | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Philippe Krebs, Bruce Beutler |