Phenotypic Mutation 'iconoclast'

• Allele: iconoclast
• Mutation Type: missense
• Chromosome: 4
• Coordinate: 129,449,397 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Lck
• Gene Name: lymphocyte protein tyrosine kinase
• Synonym(s): Hck-3, p56
• Chromosomal Location: 129,442,142-129,467,415 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016] ; PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P06240
• SMART Domains: Protein: ENSMUSP00000066209; Gene: ENSMUSG00000000409; AA Change: L300P

Domain	Start	End	E-Value	Type
SH3	64	120	3.53e-17	SMART
SH2	125	215	2.07e-34	SMART
TyrKc	245	494	2.66e-133	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000067240)
• SMART Domains: Protein: ENSMUSP00000099656; Gene: ENSMUSG00000000409; AA Change: L300P

Domain	Start	End	E-Value	Type
SH3	64	120	3.53e-17	SMART
SH2	125	215	2.07e-34	SMART
TyrKc	245	494	2.66e-133	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000102596)
• SMART Domains: Protein: ENSMUSP00000119263; Gene: ENSMUSG00000000409

Domain	Start	End	E-Value	Type
PDB:1Q69|B	7	33	9e-12	PDB
SCOP:d1awj__	45	92	2e-8	SMART
PDB:1LCK|A	53	92	3e-20	PDB
Blast:SH3	64	92	4e-13	BLAST

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000125777; Gene: ENSMUSG00000000409; AA Change: L311P

Domain	Start	End	E-Value	Type
SH3	75	131	3.53e-17	SMART
SH2	136	226	2.07e-34	SMART
TyrKc	256	505	2.66e-133	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000167288)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• MMRRC Submission: 030958-UCD
• Last Updated: 2018-01-05 3:13 PM by Eva Marie Y. Moresco
• Record Created: unknown
• Record Posted: 2009-02-05
• Science Writers: Eva Marie Y. Moresco, Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Philippe Krebs, Bruce Beutler

Accession Number

NCBI RefSeq: NM­_010693; MGI: 96756

Alleles Listed at MGI

All alleles(18) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(13) Chemically induced(1)

Phenotypic Description

The iconoclast phenotype was discovered among ENU-mutagenized G3 mutant mice in an in vivo CD8⁺ T cell cytotoxicity screen.  G3 mice were immunized with irradiated 5E1 cells (syngeneic class I MHC-deficient cells transformed by human adenovirus type 5 early region 1). One week later, the same mice were injected with control C57BL/6J cells, and an antigen-specific CTL target population (C57BL/6J splenocytes externally loaded with a peptide derived from the adenovirus E1B protein).  Iconoclast mice exhibit a reduced ability to kill antigen-specific targets, demonstrating impaired CD8⁺ cytotoxic T lymphocyte (CTL) function (Figure 1).  Examination of CD4⁺ and CD8⁺ T cells in iconoclast mice revealed reduced numbers of these cells in the periphery.  Development of CD4⁺ and CD8⁺ T cells in the thymus is aberrant, with reduced expression of the T cell receptor (TCR) component CD3ε. Thymic atrophy (10X fewer cells) is observed.

Nature of Mutation

The iconoclast mutation was mapped to Chromosome 4 between markers D4mit178 and D4mit253, and corresponds to a T to C transition at position 1086 of the Lck transcript, in exon 8 of 12 total exons.

 

1070 CTGCAGCACCCGCGGCTAGTCCGGCTTTATGCA

295  -L--Q--H--P--R--L--V--R--L--Y--A-

 

The mutated nucleotide is indicated in red lettering, and results in a leucine to proline change at amino acid 300.

Protein Prediction

Figure 2. The structure of Lck. A, Domain structure of Lck. B, 3D structure of of inactive Src. The unique domain is not part of this structure. The position of the iconoclast mutation is indicated. Image is interactive; click to see another Lck mutation. UCSF Chimera structure is based on PDB  2SRC, Xu et al, Mol. Cell 3, 629-638 (1999). Click on the 3D structure to view it rotate.

The lymphocyte protein tyrosine kinase (Lck) is one of at least nine members of the Src family of nonreceptor tyrosine kinases, oncogenic proteins originally found to be components of acutely transforming retroviruses (1). Lck is a protein of 56 kDa [also known as p56(lck)], and consists of 509 amino acids. The domain organization of Lck follows that of other Src family kinases (Figure 2A). Lck contains tandem Src-homology (SH) 3 and SH2 domains, which are separated by a short linker segment from a C-terminal tyrosine kinase domain terminating in a short C-terminal tail. The SH3 and SH2 domains mediate interactions with proline-rich and phosphotyrosine-containing sequences, respectively, contributing to differences in the binding specificities of the various Src family kinases, as well as participating in a kinase autoinhibitory mechanism (see below). The SH3 domain (amino acids 63-121) consists of five β strands, while the larger SH2 domain (amino acids 122-223) contains six β strands packed between two α helices (2-4). The kinase domain of Src family kinases (amino acids 238-496 in Lck) consists of two lobes, designated the N- and C-lobes, linked by a flexible hinge. The smaller N-lobe contains a five-stranded β sheet and the important αC helix (see below); the larger C-lobe contains mainly α helices and provides most of the interactions with peptide substrates (2;3;5). ATP binds at the interface between the two lobes, stabilized by a glycine-rich segment and by direct binding to the catalytic loop of the kinase. The activation loop contains a tyrosine conserved in all Src family kinases, which must be phosphorylated for full kinase activation.

 

The elucidation of crystal structures for Src, Hck, Lck, and PKA, revealed a classical regulatory mechanism common to Src family kinases, in which the phosphorylation status of two critical tyrosines, one in the C-terminal tail and one in the activation loop, dictates the activation status of these enzymes. Src family kinases are held in a closed, inactive conformation by intramolecular interactions between a phosphorylated tyrosine in the C-terminal tail (Y505 in Lck) and the SH2 domain (Figure 2B, PDB ID 2SRC) (2-4;6). This interaction couples the SH2 domain to the C-terminal tail, and also holds the SH2 and SH3 domains in a rigid conformation that disfavors kinase activation (7).  Mutation of tyrosine 505 to phenylalanine, analogous to a Y572F mutation in Src, results in constitutive Lck kinase activation and confers transforming ability to the mutant protein (8-11). The phosphorylation status of Lck Y505 is controlled by the actions of the c-Src kinase (Csk) and the phosphatase CD45 (12-15).

 

In addition to the SH2-C-terminal tail interaction, the closed conformation of Src family kinases is also maintained by the docking of the SH3 domain onto an internal polyproline type II helical sequence formed by the linker between the SH2 and kinase domains (2-4). This polyproline helix is sandwiched between the SH3 domain and the back surface of the N-terminal lobe of the catalytic domain.  It is thought that the binding of the SH2 domain to the phosphorylated tail segment is important for correctly positioning the SH2-kinase domain linker for interaction with the SH3 domain. Consistent with this hypothesis, maximal activation of Hck by the SH3-binding protein HIV-1 Nef occurs when the SH3 domain is displaced (16). In Lck, the polyproline sequence in the SH2-kinase domain linker (amino acids 224-237) follows the consensus PxxP motif preferred by SH3 domains (PQKP, amino acids 229-232).

 

Figure 3. Crystal structure of the kinase domain of human Lck in the active conformation. The position of the iconoclast mutation is indicated. UCSF Chimera structure is based on PDB  3LCK, Yamaguchi and Hendrickson, Nature 384, 484-489 (1996). Click on the 3D structure to view it rotate.

The kinase activity of Lck and other Src family kinases is also regulated by phosphorylation of a tyrosine residue within the activation loop (Y394 in Lck, Y416 in Src), which serves to orient the αC helix of the kinase domain N-lobe (2-5). Lck autocatalytically phosphorylates its activation loop tyrosine in trans, an event that has been shown to activate the kinase in response to crosslinking of CD4 or CD8 in mouse thymocytes and in transfected fibroblasts (17;18). When the activation loop tyrosine is dephosphorylated, the αC helix rotates outward, assuming a conformation unable to coordinate the α- and β-phosphates of ATP within the catalytic cleft, as seen in the crystal structure of inactive Src phosphorylated in its C-terminal tail. By comparison, in the structure of the active Lck kinase domain phosphorylated on its activation loop tyrosine, the entire activation loop is restructured so it no longer impedes the rotation of αC helix towards the kinase domain and into position to coordinate nucleotide binding to the catalytic site. Phosphorylation of the activation loop also increases the accessibility of the SH3 domain for ligands, and it has been proposed that Src activity may generally control the availability of its regulatory domains (19). Together, phosphorylation of the tyrosine in the C-terminal tail and dephosphorylation of the activation loop tyrosine promote a closed, inactive conformation in which the lobes of the kinase domain are closely apposed and the αC helix is shifted outwards.

 

Unique to each Src family kinase is a 60-80 amino acid sequence at the extreme N-terminus, the structure of which is unknown. In Lck, the unique region (amino acids 1-62) functions to target the protein to the plasma membrane and/or lipid rafts through the attachment of fatty acid chains to select residues. Lck contains a conserved glycine residue at position 2 which is cotranslationally myristoylated following removal of the start methionine. Myristoylation of glycine 2 is required for the subsequent reversible palmitoylation of cysteines 3 and 5 (20;21). The unique region also mediates Lck binding to CD4 and CD8, coreceptors for the T cell receptor, through the interaction of a dicysteine motif in Lck (CxxC, amino acids 20-23) with two cysteines in the cytoplasmic domains of CD4 and CD8α (CxCP) (22;23). A Zn²⁺ ion is necessary for this interaction (24;25). NMR structures of portions of the CD4 or CD8 cytoplasmic tail and the unique region of Lck demonstrate that the four cysteines, located within short α-helices on each molecule, coordinate Zn²⁺ with a tetrahedral conformation to form a “zinc clasp” (26). Association of CD4 and CD8 with Lck is not thought to be regulated by changes in cellular Zn²⁺ concentration, and except for a requirement for CD4 phosphorylation on serine 408, the mechanism by which the complexes are dissociated is unknown (27).

 

The iconoclast mutation lies in the N-lobe of the Lck kinase domain, within the loop connecting helix αC and strand β4, and likely results in a protein with reduced function(Figure 3, PDB ID 3LCK). The effect of the mutation on kinase activity, expression level, or localization has not been tested.

Expression/Localization

Lck expression is specific to lymphoid cells, being found predominantly in CD4⁺ and CD8⁺ T cells, at lower levels in B cells, but not in monocytes, granulocytes, or non-hematopoietic cells (28). In humans, expression of Lck transcripts is induced concomitantly with the appearance of lymphoid cells in the developing thymus (28). Its expression is highest in thymocytes with rearranged α, β, and γ T cell receptor (TCR) genes, and lowest in thymocytes with germline α, β, and γ TCR genes (29). Lck mRNA is detected in leukemia T cell lines and B cell lines, and in some human colon carcinoma and non-lymphoid tumor cell lines (29-31). 

 

Transcription of the human lck gene is controlled by two widely separated promoters, designated type I and type II, leading to transcripts that differ in the nucleotide sequence of the 5’ untranslated region. The type I proximal promoter is located immediately upstream of exon 1, while the type II distal promoter is located about 25 kb upstream from the type I promoter (32;33). The utilization of the two promoters appears to depend on the cell type, with the type I proximal promoter active mainly in thymocytes, and the type II distal promoter active mainly in mature peripheral T cells (33;34). B cell lines exclusively utilize the type I promoter (35).  Transformed lymphoid cells use both types of promoters (35). Interestingly, a similar type II promoter sequence is found in humans and mice, but mice lack the type I proximal promoter sequence (33). Both the proximal and distal promoters from humans function appropriately when introduced transgenically into mice (36).

 

Subcellularly, Lck is associated with the plasma membrane in T cells; it can be recovered in the soluble cytoplasmic fraction of unstimulated CD4⁺ T cells (37;38).  Lck rapidly translocates to lipid rafts within the first ten seconds after TCR/CD4 engagement (37). Lck has also been detected in association with pericentrosomal vesicles, but the significance of this finding is unknown (38).

Background

Figure 4. TCR signaling pathway. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs).  Binding of these ligands to the TCR initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex. Lck and Fyn are regulated by the phosphorylation of two key tyrosine residues, an activating tyrosine located in the activation loop, and an inhibitory tyrosine located in the C-terminal tail.  CD45 dephosphorylates the C-terminal inhibitory tyrosine, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2(Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1.  SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1).  This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca²⁺) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways.  Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP₃) and DAG resulting in Ca²⁺-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ and Ras, respectively.  PKCθ regulates nuclear factor-κB activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1). Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors.

Signaling through the T cell receptor (TCR) plays a critical role at multiple stages of thymocyte differentiation, T-cell activation, and homeostasis [reviewed in (39;40)]. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs). Binding of these ligands to the TCR initiates signaling and T cell activation (Figure 4). The TCR is composed of two separate peptide chains (TCRα/β for most T cells), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ; see the record for tumormouse) and a ζ homodimer (41). Signaling by the TCR complex depends on the phosphorylation of immunoreceptor tyrosine-based activation motifs (ITAMS) present on the CD3 and ζ chains [reviewed in (42;43)].  One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex where they phosphorylate ITAMS. In the case of Lck, recruitment to the TCR complex depends on association with CD4, which recognizes MHC class II, or CD8, which recognizes MHC class I (22). Phosphorylation of the ITAM motifs results in recruitment of the ZAP-70 (ζ-chain-associated protein of 70 kDa) and Syk (spleen tyrosine kinase), which trans- and auto-phosphorylate, forming binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. ZAP-70 and Syk phosphorylate the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76). LAT serves as a docking site for a number of proteins including the adaptor proteins Src homologous and collagen (Shc) and growth factor receptor-bound (Grb) 2, phosphatidylinositol 3-kinase (PI3K), and phospholipase C (PLC). A number of these proteins also associate with and are activated by Lck (44). Eventually, the tyrosine phosphorylation cascade initiated by Lck culminates in the intracellular mobilization of calcium (Ca²⁺) ions and activation of important signaling cascades within the lymphocyte necessary for T cell activation and proliferation (42). These include the critical transcription factors NF-κB, NFAT (nuclear factor of activated T cells) and AP-1 (activator protein 1), which regulate the production of multiple cytokines, most notably interleukin-2 (IL-2).

 

As discussed above (see Protein Prediction), Lck activity is regulated by the phosphorylation status of two key tyrosine residues, one in the kinase domain and one at the C terminus. Phosphorylation of the kinase domain Y394 enhances kinase activity, whereas phosphorylation of Y505 has an inhibitory effect (40). Inhibition or activation of Lck by phosphorylation or dephosphorylation of Y505 occurs through the c-Src tyrosine kinase (CSK) or the transmembrane phosphatase CD45 (mutated in belittle), respectively [reviewed in (45)].  In addition, CD45 is able to dephosphorylate Y394 in the active site of Lck, suggesting that CD45 can also downregulate the activity of Lck (46-48). Lck is also inhibited by the protein tyrosine phosphatase SHP1 (see the record for spin), which can dephosphorylate Y394 (49). Conformationally, Lck may therefore exist in an equilibrium state, where subpopulations of molecules simultaneously exist as (1) open and activated (phosphorylated on Y394), (2) open and not activated – or ‘primed’, and (3) closed and not activated (45). CD4 or CD8 coreceptor ligation might shift the equilibrium toward open and activated states by clustering and activating Lck molecules, culminating in a tyrosine kinase cascade.  Lck is also regulated by degradation through the c-Cbl ubiquitin ligase, which is part of the ubiquitin-mediated pathway (50).

 

Development of thymocytes into mature T cells occurs in the thymus through a differentiation program characterized by the expression of certain cell-surface markers [reviewed in (40)]. The most immature stage of thymocyte development is known as the double negative (DN) stage due to the lack of expression of the T cell coreceptors CD4 and CD8. Differentiation proceeds through several stages known as DN1-4 during which the thymocytes initiate the αβ T-cell developmental pathway. The DN3 stage is the first critical checkpoint during thymocyte development. Progression and expansion past DN3 requires surface expression of the product of a productive chromosomally rearranged TCRβ chain, which pairs with an invariant pre-TCRα chain and then forms a complex with CD3 and TCRζ. This complex is known as the pre-TCR and produces a TCR-like signal. Cells unable to generate a proper pre-TCR signal are arrested and die at the DN3 stage. After progressing through the DN4 stage, thymocytes then express both CD4 and CD8 and are known as double positive (DP) cells. Progression past this state to single positive CD4 or CD8 cells requires a TCR signal that occurs through a newly rearranged TCRα chain and the previously expressed TCRβ chain. The strength of interaction of the final TCRαβ receptor to self-MHC molecules expressed on stromal or APCs in the thymus determines whether or not thymocytes are positively selected and survive to become a single positive (SP) CD4 or CD8 T cell. Strong interactions and increased TCR signaling likely represents autoreactivity and results in negative selection, while moderate interactions indicates usefulness of the TCR and results in positive selection. Cells that are unable to effectively bind MHC are eliminated. 

 

In animal models that are Lck-deficient or are transgenic for a dominant-negative form of Lck, severe combined immunodeficiency (SCID)-like phenotypes are observed. These animals demonstrate severe T cell developmental defects with pronounced thymic deficiency and a dramatic reduction in DP thymocytes, indicating a significant although incomplete block at the DN3 stage of development where pre-TCR signaling is required for further differentiation (51;52). Mature single-positive thymocytes are absent and peripheral T cells are much reduced. A complete block at the DN3 stage occurred in mice that were deficient for both the Lck and Fyn kinases, showing some functional overlap between these two proteins (53;54). 

 

Due to the severe developmental block found in Lck deficient mice, the role of Lck in subsequent T cell differentiation and activation events could not be evaluated. The development of conditional transgenic mice in combination with the knockout model allowed the study of Lck during the subsequent steps of T cell development and maturation. Interestingly, increasing Lck activity using various conditional transgenes was sufficient to promote DP cells specifically to the CD4 lineage (55;56), suggesting that the mechanism for CD4 or CD8 positive selection depends on the strength and/or the duration of the TCR signal (39;40). Similarly, using conditional transgenic mice in an Lck-deficient background revealed that Lck was necessary for the homeostatic expansion, but not the survival of naïve peripheral T cells (57;58). Further studies demonstrated that peripheral T cell survival still depended on TCR signaling, but that Fyn and Lck were functionally redundant in this context (59). Other studies have demonstrated that Lck is necessary for any process that requires TCR signaling including Fas-dependent activation-induced cell death resulting from repeated TCR stimulation (60), and the development and function of CD4⁺ regulatory T cells (T_regs). Signaling through the CD28 coreceptor and Lck results in upregulation of the T_reg master-regulatory transcription factor Foxp3 (see the record for crusty) (61).

 

Although Lck primarily has a role in T cell development and activation, it also functions in B and natural killer (NK) cells. Lck protein is also found in B-1 cells, a minor but important subset of B cells (31). B-1 cells secrete large quantities of IgM, IgG3 and IgA, mostly specific for multivalent self-antigens, and are thought to be responsible for natural immunity (62). Engagement of the B cell receptor (BCR) in most B cells leads to robust mobilization of intracellular calcium and proliferation, but B-1 cells are characterized by more modest responses, and increased apoptosis (63;64). Examination of these cells in Lck null animals suggests that expression of Lck in these cells is required for BCR signaling and is responsible for the characteristic B-1 response (65;66). In a subset of peripheral NK cells, Lck associates with the MHC-class I activating receptor, CD160 and is necessary in activating downstream signaling pathways (67).  Lck also associates with and is necessary for signaling through the NK cell receptor protein 1 (NKR-P1) family, which includes the NK marker NK1.1 (see the record for Unnatural) (68).

 

Due to its critical role in TCR signaling, alterations in Lck activity or expression are involved in the progression of diverse immune diseases in humans. In patients with the autoimmune diseases Systemic Lupus Erthematosus (SLE; OMIM #152700) and type I diabetes (IDDM1, OMIM #222100), reduced levels of Lck were observed in periphal blood lymphocytes (PBLs) (69;70). In IDDM patients, this reduced level of Lck correlated with diminished responses following T cell activation. In SLE, downregulated Lck is also associated with reduced T cell proliferative responses to antigens. However, it is likely that the abnormal and prolonged localization of CD45 to Lck-containing lipid rafts in PBLs from SLE patients results in inappropriate Lck dephosphorylation, which may contribute to T cell autoreactivity. Increased Lck activity results in increased ubiquitin-mediated Lck proteolysis and reduced levels of total Lck in these patients [reviewed in (71)]. Increased Lck levels and activity have also been found in patients with T-lymphoblastic leukemia (T-ALL) (72;73). Lck deficiency or reduction in Lck activity is associated with selective CD4⁺ lymphopenia, causing various syndromes including SCID and common variable immunodeficiency (CVID; OMIM #240500) (74-76).    

 

Several studies have shown that Lck plays important roles in the life cycle of various viruses. Herpesvirus saimiri (HVS) is an oncogenic virus that infects T lymphocytes. Successful infection and replication depends on the ability of the virus to downregulate normal T cell responses, which it does so partly by targeting Lck, and thus the TCR complex, for lysosomal degradation (77;78). Similarly, human immunodeficiency virus (HIV) induces dysfunctional T cell responses in humans. In HIV-infected patients, T cells exhibit reduced recruitment of Lck to the immunological synapse and lipid rafts resulting in decreased TCR signaling (79), although other studies suggest that HIV infection and expression of HIV proteins could upregulate Lck inappropriately, leading to T cell apoptosis (80). Interestingly, HIV replication is influenced by the presence of Lck. In the absence of Lck, HIV replication is reduced due to the decreased recruitment of HIV to the plasma membrane and the inability of the virus to be released from the cell (81).

Putative Mechanism

The iconoclast mutation is located on the back of the N-lobe of the Lck kinase domain, within the loop connecting helix αC and strand β4 (loop αC/β4, amino acids 294-303), opposite the catalytic cleft. The crystal structure of chicken Src shows that the αC/β4 loop stays in the same place whether the αC helix is in its active or inactive conformation (4). Despite its stationary position, mutational analysis using an S. pombe regulation assay indicates that select point mutations within the αCβ4 loop prevent negative regulation by Csk (82). This assay monitors tyrosine phosphorylation of yeast proteins and lethality induced by expression of Src, which are rescued by coexpression of Csk. Mutation of Q324 (R302 in Lck) to either arginine or glutamic acid in Src greatly impaired the ability of Src to be regulated by Csk, resulting in high levels of phosphotyrosine-containing proteins despite coexpression of Csk. However, mutation of either R318 or E320 in Src (Q296 and Q298 in Lck) did not affect Src regulation by Csk. The reasons why some, but not other mutations within loop αC/β4 prevent regulation by Csk remain unclear. Q324 may be important because it forms multiple hydrogen bonds with the SH2-kinase domain linker (2-4), and has been suggested to keep the interaction of the linker with the αC helix fixed at one end (82). In contrast to this activating mutation, the iconoclast mutation apparently results in reduced protein function. The substitution of a rigid proline residue for leucine likely disrupts the secondary structure and/or hydrogen bond formation of the αC/β4 loop, and may prevent the αC helix from assuming the active conformation necessary for kinase activation.

Primers

Primers cannot be located by automatic search.

Genotyping

Iconoclast genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Icono(F): 5’- ACGATCTAGTCCGCCATTACACCAG -3’

Icono(R): 5’- AGGAACTGCTCTTCCATCCCCATAG -3’

 

PCR program (use SIGMA JumpStart REDTaq)

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Icono_seq (F): 5’- CCCTCGGGACTGATTGGAAAG  -3’

Icono_seq (R): 5'- TAGCTCAGCGTTTGAGAGCAC -3'

 

The following sequence of 1527 nucleotides (from Genbank genomic region NC_000070 for linear genomic sequence of Lck) is amplified:

 

2062                        acgatctag tccgccatta caccagtgag ctccggcgga
2101 atgcgttcac ctgtgcccat cctagcagcc tctctctctc ccgcacccag tccttcttag
2161 ggactctcca aacgtctttc attccccttc agtggatgag gggtatagaa cctgacccta
2221 gaccctgccg gctaatgttg aatgacccac gttttccctc ccataccagt cggtttcccc
2281 tgcgaggaaa gtggagagag ggtaggggct ggagggagca tccaaggtct ctagtgaccg
2341 cattaacctt ctcttttgtc tatgcagacg cctctgatgg gctgtgcaca aagttgagcc
2401 gtccttgcca gacccagaag ccccagaaac catggtggga ggacgaatgg gaagttccca
2461 gggaaacact gaagttggtg gagcggctgg gagctggcca gttcggggaa gtgtggatgg
2521 gtgagtgtga ccctcgggac tgattggaaa gaggagagag aatgtgagct tcctctcaca
2581 ctggcctatt caggatggct gcctagttcg tcaggatctt gacctctgta acttctccac
2641 ccgtacccca tcagggtact acaacggaca cacgaaggtg gcggtgaaga gtctgaaaca
2701 agggagcatg tcccccgacg ccttcctggc tgaggctaac ctcatgaagc agctgcagca
2761 cccgcggcta gtccggcttt atgcagtggt cacccaggaa cccatctaca tcatcacgga
2821 atacatggag aacggtgggt gccctgctat gtccagccgc ttgagggcgc tattgtggtc
2881 ccactacctt ttggacccag ggaaggaagg cgcttttacc tctgatcttc taaagactct
2941 tttctgggtc cctaagcttt ggaagaacgt tccatctgat agtccctgat cttcagtttc
3001 tgttcctttc ttccaatgcc cacctgggtt tcagaatgct tgacctaaga aatggtgtat
3061 ggtgcctgaa gagaccagaa aggagtgtgg gataccctgg agttacagac aattgtgagc
3121 tactggggat caaacgcggg tcctctggaa gagcagccag tgctctcaaa cgctgagcta
3181 cctttctagc ccaaatatgt agtatgtttg ttaaggatcc aagagtctga ctgcctggat
3241 agagttgagg ctttataatt gtatggcttt gggctgatcc catcacggct ttctgctcca
3301 aatagttctt tttaatctgt aaaatagcgg gtttagggcc agcaagatgg ctcagcaggt
3361 aaaggtgctt gctgacaagc ctgatgagca ggagttcaat gcctggaatc cacaggagag
3421 agggaaagag ctggctctta ccagagttgt cctctggtct ccatacgtgt gtaatggctc
3481 atgcatgtgc cgcctcctat gaataaatac atgtaattaa agcatagcgg cactagtgga
3541 agagctgcat ctctacatag ttgctatggg gatggaagag cagttcct

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

   1. Bishop, J. M. (1985) Viral Oncogenes. Cell. 42, 23-38.

   2. Xu, W., Harrison, S. C., and Eck, M. J. (1997) Three-Dimensional Structure of the Tyrosine Kinase c-Src. Nature. 385, 595-602.

   3. Sicheri, F., Moarefi, I., and Kuriyan, J. (1997) Crystal Structure of the Src Family Tyrosine Kinase Hck. Nature. 385, 602-609.

   4. Williams, J. C., Weijland, A., Gonfloni, S., Thompson, A., Courtneidge, S. A., Superti-Furga, G., and Wierenga, R. K. (1997) The 2.35 A Crystal Structure of the Inactivated Form of Chicken Src: A Dynamic Molecule with Multiple Regulatory Interactions. J. Mol. Biol. 274, 757-775.

   5. Yamaguchi, H., and Hendrickson, W. A. (1996) Structural Basis for Activation of Human Lymphocyte Kinase Lck upon Tyrosine Phosphorylation. Nature. 384, 484-489.

   6. Gonfloni, S., Williams, J. C., Hattula, K., Weijland, A., Wierenga, R. K., and Superti-Furga, G. (1997) The Role of the Linker between the SH2 Domain and Catalytic Domain in the Regulation and Function of Src. EMBO J. 16, 7261-7271.

   7. Young, M. A., Gonfloni, S., Superti-Furga, G., Roux, B., and Kuriyan, J. (2001) Dynamic Coupling between the SH2 and SH3 Domains of c-Src and Hck Underlies their Inactivation by C-Terminal Tyrosine Phosphorylation. Cell. 105, 115-126.

   8. Amrein, K. E., and Sefton, B. M. (1988) Mutation of a Site of Tyrosine Phosphorylation in the Lymphocyte-Specific Tyrosine Protein Kinase, p56lck, Reveals its Oncogenic Potential in Fibroblasts. Proc. Natl. Acad. Sci. U. S. A. 85, 4247-4251.

   9. Marth, J. D., Cooper, J. A., King, C. S., Ziegler, S. F., Tinker, D. A., Overell, R. W., Krebs, E. G., and Perlmutter, R. M. (1988) Neoplastic Transformation Induced by an Activated Lymphocyte-Specific Protein Tyrosine Kinase (pp56lck). Mol. Cell. Biol. 8, 540-550.

 10. Kmiecik, T. E., and Shalloway, D. (1987) Activation and Suppression of pp60c-Src Transforming Ability by Mutation of its Primary Sites of Tyrosine Phosphorylation. Cell. 49, 65-73.

 11.Cartwright, C. A., Eckhart, W., Simon, S., and Kaplan, P. L. (1987) Cell Transformation by pp60c-Src Mutated in the Carboxy-Terminal Regulatory Domain. Cell. 49, 83-91.

 12. Mustelin, T., Coggeshall, K. M., and Altman, A. (1989) Rapid Activation of the T-Cell Tyrosine Protein Kinase pp56lck by the CD45 Phosphotyrosine Phosphatase. Proc. Natl. Acad. Sci. U. S. A. 86, 6302-6306.

 13. Ostergaard, H. L., Shackelford, D. A., Hurley, T. R., Johnson, P., Hyman, R., Sefton, B. M., and Trowbridge, I. S. (1989) Expression of CD45 Alters Phosphorylation of the Lck-Encoded Tyrosine Protein Kinase in Murine Lymphoma T-Cell Lines. Proc. Natl. Acad. Sci. U. S. A. 86, 8959-8963.

 14. Bergman, M., Mustelin, T., Oetken, C., Partanen, J., Flint, N. A., Amrein, K. E., Autero, M., Burn, P., and Alitalo, K. (1992) The Human p50csk Tyrosine Kinase Phosphorylates p56lck at Tyr-505 and Down Regulates its Catalytic Activity. EMBO J. 11, 2919-2924.

 15. Okada, M., Nada, S., Yamanashi, Y., Yamamoto, T., and Nakagawa, H. (1991) CSK: A Protein-Tyrosine Kinase Involved in Regulation of Src Family Kinases. J. Biol. Chem. 266, 24249-24252.

 16. Moarefi, I., LaFevre-Bernt, M., Sicheri, F., Huse, M., Lee, C. H., Kuriyan, J., and Miller, W. T. (1997) Activation of the Src-Family Tyrosine Kinase Hck by SH3 Domain Displacement. Nature. 385, 650-653.

 17. Luo, K. X., and Sefton, B. M. (1990) Cross-Linking of T-Cell Surface Molecules CD4 and CD8 Stimulates Phosphorylation of the Lck Tyrosine Protein Kinase at the Autophosphorylation Site. Mol. Cell. Biol. 10, 5305-5313.

 18. Veillette, A., and Fournel, M. (1990) The CD4 Associated Tyrosine Protein Kinase p56lck is Positively Regulated through its Site of Autophosphorylation. Oncogene. 5, 1455-1462.

 19. Gonfloni, S., Weijland, A., Kretzschmar, J., and Superti-Furga, G. (2000) Crosstalk between the Catalytic and Regulatory Domains Allows Bidirectional Regulation of Src. Nat. Struct. Biol. 7, 281-286.

 20. Paige, L. A., Nadler, M. J., Harrison, M. L., Cassady, J. M., and Geahlen, R. L. (1993) Reversible Palmitoylation of the Protein-Tyrosine Kinase p56lck. J. Biol. Chem. 268, 8669-8674.

 21. Koegl, M., Zlatkine, P., Ley, S. C., Courtneidge, S. A., and Magee, A. I. (1994) Palmitoylation of Multiple Src-Family Kinases at a Homologous N-Terminal Motif. Biochem. J. 303 ( Pt 3), 749-753.

 22. Turner, J. M., Brodsky, M. H., Irving, B. A., Levin, S. D., Perlmutter, R. M., and Littman, D. R. (1990) Interaction of the Unique N-Terminal Region of Tyrosine Kinase p56lck with Cytoplasmic Domains of CD4 and CD8 is Mediated by Cysteine Motifs. Cell. 60, 755-765.

 23. Veillette, A., Bookman, M. A., Horak, E. M., and Bolen, J. B. (1988) The CD4 and CD8 T Cell Surface Antigens are Associated with the Internal Membrane Tyrosine-Protein Kinase p56lck. Cell. 55, 301-308.

 24. Huse, M., Eck, M. J., and Harrison, S. C. (1998) A Zn2+ Ion Links the Cytoplasmic Tail of CD4 and the N-Terminal Region of Lck. J. Biol. Chem. 273, 18729-18733.

 25. Lin, R. S., Rodriguez, C., Veillette, A., and Lodish, H. F. (1998) Zinc is Essential for Binding of p56(Lck) to CD4 and CD8alpha. J. Biol. Chem. 273, 32878-32882.

 26. Kim, P. W., Sun, Z. Y., Blacklow, S. C., Wagner, G., and Eck, M. J. (2003) A Zinc Clasp Structure Tethers Lck to T Cell Coreceptors CD4 and CD8. Science. 301, 1725-1728.

 27. Pitcher, C., Honing, S., Fingerhut, A., Bowers, K., and Marsh, M. (1999) Cluster of Differentiation Antigen 4 (CD4) Endocytosis and Adaptor Complex Binding Require Activation of the CD4 Endocytosis Signal by Serine Phosphorylation. Mol. Biol. Cell. 10, 677-691.

 28. Perlmutter, R. M., Marth, J. D., Lewis, D. B., Peet, R., Ziegler, S. F., and Wilson, C. B. (1988) Structure and Expression of Lck Transcripts in Human Lymphoid Cells. J. Cell. Biochem. 38, 117-126.

 29. Koga, Y., Kimura, N., Minowada, J., and Mak, T. W. (1988) Expression of the Human T-Cell-Specific Tyrosine Kinase YT16 (Lck) Message in Leukemic T-Cell Lines. Cancer Res. 48, 856-859.

 30. Veillette, A., Foss, F. M., Sausville, E. A., Bolen, J. B., and Rosen, N. (1987) Expression of the Lck Tyrosine Kinase Gene in Human Colon Carcinoma and Other Non-Lymphoid Human Tumor Cell Lines. Oncogene Res. 1, 357-374.

 31. Majolini, M. B., D'Elios, M. M., Galieni, P., Boncristiano, M., Lauria, F., Del Prete, G., Telford, J. L., and Baldari, C. T. (1998) Expression of the T-Cell-Specific Tyrosine Kinase Lck in Normal B-1 Cells and in Chronic Lymphocytic Leukemia B Cells. Blood. 91, 3390-3396.

 32. Garvin, A. M., Pawar, S., Marth, J. D., and Perlmutter, R. M. (1988) Structure of the Murine Lck Gene and its Rearrangement in a Murine Lymphoma Cell Line. Mol. Cell. Biol. 8, 3058-3064.

 33. Takadera, T., Leung, S., Gernone, A., Koga, Y., Takihara, Y., Miyamoto, N. G., and Mak, T. W. (1989) Structure of the Two Promoters of the Human Lck Gene: Differential Accumulation of Two Classes of Lck Transcripts in T Cells. Mol. Cell. Biol. 9, 2173-2180.

 34. Reynolds, P. J., Lesley, J., Trotter, J., Schulte, R., Hyman, R., and Sefton, B. M. (1990) Changes in the Relative Abundance of Type I and Type II Lck mRNA Transcripts Suggest Differential Promoter Usage during T-Cell Development. Mol. Cell. Biol. 10, 4266-4270.

 35. Rouer, E., Dreyfus, F., Melle, J., and Benarous, R. (1994) Pattern of Expression of Five Alternative Transcripts of the Lck Gene in Different Hematopoietic Malignancies: Correlation of the Level of Lck Messenger RNA I B with the Immature Phenotype of the Malignancy. Cell Growth Differ. 5, 659-666.

 36. Wildin, R. S., Garvin, A. M., Pawar, S., Lewis, D. B., Abraham, K. M., Forbush, K. A., Ziegler, S. F., Allen, J. M., and Perlmutter, R. M. (1991) Developmental Regulation of Lck Gene Expression in T Lymphocytes. J. Exp. Med. 173, 383-393.

 37. Filipp, D., Zhang, J., Leung, B. L., Shaw, A., Levin, S. D., Veillette, A., and Julius, M. (2003) Regulation of Fyn through Translocation of Activated Lck into Lipid Rafts. J. Exp. Med. 197, 1221-1227.

 38. Ley, S. C., Marsh, M., Bebbington, C. R., Proudfoot, K., and Jordan, P. (1994) Distinct Intracellular Localization of Lck and Fyn Protein Tyrosine Kinases in Human T Lymphocytes. J. Cell Biol. 125, 639-649.

 39. Zamoyska, R., Basson, A., Filby, A., Legname, G., Lovatt, M., and Seddon, B. (2003) The Influence of the Src-Family Kinases, Lck and Fyn, on T Cell Differentiation, Survival and Activation. Immunol. Rev. 191, 107-118.

 40. Palacios, E. H., and Weiss, A. (2004) Function of the Src-Family Kinases, Lck and Fyn, in T-Cell Development and Activation. Oncogene. 23, 7990-8000.

 41. Klausner, R. D., Lippincott-Schwartz, J., and Bonifacino, J. S. (1990) The T Cell Antigen Receptor: Insights into Organelle Biology. Annu. Rev. Cell Biol. 6, 403-431.

 42. Pitcher, L. A., and van Oers, N. S. (2003) T-Cell Receptor Signal Transmission: Who Gives an ITAM? Trends Immunol. 24, 554-560.

 43. Love, P. E., and Shores, E. W. (2000) ITAM Multiplicity and Thymocyte Selection: How Low can You Go? Immunity. 12, 591-597.

 44. Mustelin, T., and Tasken, K. (2003) Positive and Negative Regulation of T-Cell Activation through Kinases and Phosphatases. Biochem. J. 371, 15-27.

 45. Hermiston, M. L., Xu, Z., and Weiss, A. (2003) CD45: A Critical Regulator of Signaling Thresholds in Immune Cells. Annu. Rev. Immunol. 21, 107-137.

 46. Ashwell, J. D., and D'Oro, U. (1999) CD45 and Src-Family Kinases: And Now for Something Completely Different. Immunol. Today. 20, 412-416.

 47. McNeill, L., Salmond, R. J., Cooper, J. C., Carret, C. K., Cassady-Cain, R. L., Roche-Molina, M., Tandon, P., Holmes, N., and Alexander, D. R. (2007) The Differential Regulation of Lck Kinase Phosphorylation Sites by CD45 is Critical for T Cell Receptor Signaling Responses. Immunity. 27, 425-437.

 48. Wong, N. K., Lai, J. C., Birkenhead, D., Shaw, A. S., and Johnson, P. (2008) CD45 Down-Regulates Lck-Mediated CD44 Signaling and Modulates Actin Rearrangement in T Cells. J. Immunol. 181, 7033-7043.

 49. Chiang, G. G., and Sefton, B. M. (2001) Specific Dephosphorylation of the Lck Tyrosine Protein Kinase at Tyr-394 by the SHP-1 Protein-Tyrosine Phosphatase. J. Biol. Chem. 276, 23173-23178.

 50. Hawash, I. Y., Kesavan, K. P., Magee, A. I., Geahlen, R. L., and Harrison, M. L. (2002) The Lck SH3 Domain Negatively Regulates Localization to Lipid Rafts through an Interaction with c-Cbl. J. Biol. Chem. 277, 5683-5691.

 51. Molina, T. J., Kishihara, K., Siderovski, D. P., van Ewijk, W., Narendran, A., Timms, E., Wakeham, A., Paige, C. J., Hartmann, K. U., and Veillette, A. (1992) Profound Block in Thymocyte Development in Mice Lacking p56lck. Nature. 357, 161-164.

 52. Levin, S. D., Anderson, S. J., Forbush, K. A., and Perlmutter, R. M. (1993) A Dominant-Negative Transgene Defines a Role for p56lck in Thymopoiesis. EMBO J. 12, 1671-1680.

 53. Groves, T., Smiley, P., Cooke, M. P., Forbush, K., Perlmutter, R. M., and Guidos, C. J. (1996) Fyn can Partially Substitute for Lck in T Lymphocyte Development. Immunity. 5, 417-428.

 54. van Oers, N. S., Lowin-Kropf, B., Finlay, D., Connolly, K., and Weiss, A. (1996) Alpha Beta T Cell Development is Abolished in Mice Lacking both Lck and Fyn Protein Tyrosine Kinases. Immunity. 5, 429-436.

 55. Hernandez-Hoyos, G., Sohn, S. J., Rothenberg, E. V., and Alberola-Ila, J. (2000) Lck Activity Controls CD4/CD8 T Cell Lineage Commitment. Immunity. 12, 313-322.

 56.Legname, G., Seddon, B., Lovatt, M., Tomlinson, P., Sarner, N., Tolaini, M., Williams, K., Norton, T., Kioussis, D., and Zamoyska, R. (2000) Inducible Expression of a p56Lck Transgene Reveals a Central Role for Lck in the Differentiation of CD4 SP Thymocytes. Immunity. 12, 537-546.

 57. Seddon, B., Legname, G., Tomlinson, P., and Zamoyska, R. (2000) Long-Term Survival but Impaired Homeostatic Proliferation of Naive T Cells in the Absence of p56lck. Science. 290, 127-131.

 58. Tewari, K., Walent, J., Svaren, J., Zamoyska, R., and Suresh, M. (2006) Differential Requirement for Lck during Primary and Memory CD8+ T Cell Responses. Proc. Natl. Acad. Sci. U. S. A. 103, 16388-16393.

 59. Seddon, B., and Zamoyska, R. (2002) TCR Signals Mediated by Src Family Kinases are Essential for the Survival of Naive T Cells. J. Immunol. 169, 2997-3005.

 60. Sharif-Askari, E., Gaucher, D., Halwani, R., Ma, J., Jao, K., Abdallah, A., Haddad, E. K., and Sekaly, R. P. (2007) P56Lck Tyrosine Kinase Enhances the Assembly of Death-Inducing Signaling Complex during Fas-Mediated Apoptosis. J. Biol. Chem. 282, 36048-36056.

 61. Nazarov-Stoica, C., Surls, J., Bona, C., Casares, S., and Brumeanu, T. D. (2009) CD28 Signaling in T Regulatory Precursors Requires p56lck and Rafts Integrity to Stabilize the Foxp3 Message. J. Immunol. 182, 102-110.

 62. Hayakawa, K., Shinton, S. A., Asano, M., and Hardy, R. R. (2000) B-1 Cell Definition. Curr. Top. Microbiol. Immunol. 252, 15-22.

 63. Morris, D. L., and Rothstein, T. L. (1993) Abnormal Transcription Factor Induction through the Surface Immunoglobulin M Receptor of B-1 Lymphocytes. J. Exp. Med. 177, 857-861.

 64. Weiss, A., and Littman, D. R. (1994) Signal Transduction by Lymphocyte Antigen Receptors. Cell. 76, 263-274.

 65. Ulivieri, C., Valensin, S., Majolini, M. B., Matthews, R. J., and Baldari, C. T. (2003) Normal B-1 Cell Development but Defective BCR Signaling in Lck-/- Mice. Eur. J. Immunol. 33, 441-445.

 66. Dal Porto, J. M., Burke, K., and Cambier, J. C. (2004) Regulation of BCR Signal Transduction in B-1 Cells Requires the Expression of the Src Family Kinase Lck. Immunity. 21, 443-453.

 67. Giustiniani, J., Bensussan, A., and Marie-Cardine, A. (2009) Identification and Characterization of a Transmembrane Isoform of CD160 (CD160-TM), a Unique Activating Receptor Selectively Expressed upon Human NK Cell Activation. J. Immunol. 182, 63-71.

 68. Ljutic, B., Carlyle, J. R., Filipp, D., Nakagawa, R., Julius, M., and Zuniga-Pflucker, J. C. (2005) Functional Requirements for Signaling through the Stimulatory and Inhibitory Mouse NKR-P1 (CD161) NK Cell Receptors. J. Immunol. 174, 4789-4796.

 69. Jury, E. C., Kabouridis, P. S., Abba, A., Mageed, R. A., and Isenberg, D. A. (2003) Increased Ubiquitination and Reduced Expression of LCK in T Lymphocytes from Patients with Systemic Lupus Erythematosus. Arthritis Rheum. 48, 1343-1354.

 70. Nervi, S., Atlan-Gepner, C., Kahn-Perles, B., Lecine, P., Vialettes, B., Imbert, J., and Naquet, P. (2000) Specific Deficiency of p56lck Expression in T Lymphocytes from Type 1 Diabetic Patients. J. Immunol. 165, 5874-5883.

 71. Jury, E. C., and Kabouridis, P. S. (2004) T-Lymphocyte Signalling in Systemic Lupus Erythematosus: A Lipid Raft Perspective. Lupus. 13, 413-422.

 72. Tycko, B., Smith, S. D., and Sklar, J. (1991) Chromosomal Translocations Joining LCK and TCRB Loci in Human T Cell Leukemia. J. Exp. Med. 174, 867-873.

 73. Burnett, R. C., David, J. C., Harden, A. M., Le Beau, M. M., Rowley, J. D., and Diaz, M. O. (1991) The LCK Gene is Involved in the t(1;7)(p34;q34) in the T-Cell Acute Lymphoblastic Leukemia Derived Cell Line, HSB-2. Genes Chromosomes Cancer. 3, 461-467.

 74. Goldman, F. D., Ballas, Z. K., Schutte, B. C., Kemp, J., Hollenback, C., Noraz, N., and Taylor, N. (1998) Defective Expression of p56lck in an Infant with Severe Combined Immunodeficiency. J. Clin. Invest. 102, 421-429.

 75. Hubert, P., Bergeron, F., Ferreira, V., Seligmann, M., Oksenhendler, E., Debre, P., and Autran, B. (2000) Defective p56Lck Activity in T Cells from an Adult Patient with Idiopathic CD4+ Lymphocytopenia. Int. Immunol. 12, 449-457.

 76. Sawabe, T., Horiuchi, T., Nakamura, M., Tsukamoto, H., Nakahara, K., Harashima, S. I., Tsuchiya, T., and Nakano, S. (2001) Defect of Lck in a Patient with Common Variable Immunodeficiency. Int. J. Mol. Med. 7, 609-614.

 77. Park, J., Lee, B. S., Choi, J. K., Means, R. E., Choe, J., and Jung, J. U. (2002) Herpesviral Protein Targets a Cellular WD Repeat Endosomal Protein to Downregulate T Lymphocyte Receptor Expression. Immunity. 17, 221-233.

 78. Park, J., Cho, N. H., Choi, J. K., Feng, P., Choe, J., and Jung, J. U. (2003) Distinct Roles of Cellular Lck and p80 Proteins in Herpesvirus Saimiri Tip Function on Lipid Rafts. J. Virol. 77, 9041-9051.

 79. Nyakeriga, A. M., Fichtenbaum, C. J., Goebel, J., Nicolaou, S. A., Conforti, L., and Chougnet, C. A. (2009) Engagement of the CD4 Receptor Affects the Redistribution of Lck to the Immunological Synapse in Primary T Cells: Implications for T-Cell Activation during Human Immunodeficiency Virus Type 1 Infection. J. Virol. 83, 1193-1200.

 80. Witte, V., Laffert, B., Gintschel, P., Krautkramer, E., Blume, K., Fackler, O. T., and Baur, A. S. (2008) Induction of HIV Transcription by Nef Involves Lck Activation and Protein Kinase C Theta Raft Recruitment Leading to Activation of ERK1/2 but Not NF Kappa B. J. Immunol. 181, 8425-8432.

 81. Strasner, A. B., Natarajan, M., Doman, T., Key, D., August, A., and Henderson, A. J. (2008) The Src Kinase Lck Facilitates Assembly of HIV-1 at the Plasma Membrane. J. Immunol. 181, 3706-3713.

 82. Gonfloni, S., Williams, J. C., Hattula, K., Weijland, A., Wierenga, R. K., and Superti-Furga, G. (1997) The Role of the Linker between the SH2 Domain and Catalytic Domain in the Regulation and Function of Src. EMBO J. 16, 7261-7271.