Phenotypic Mutation 'caer'

• Allele: caer
• Mutation Type: missense
• Chromosome: 4
• Coordinate: 65,043,128 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Pappa
• Gene Name: pregnancy-associated plasma protein A
• Synonym(s): PAPP-A, PAG1, 8430414N03Rik, IGFBP-4ase
• Chromosomal Location: 65,042,411-65,275,746 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Threonine changed to Lysine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000081545]
• AlphaFold: Q8R4K8
• SMART Domains: Protein: ENSMUSP00000081545; Gene: ENSMUSG00000028370; AA Change: T117K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	24	66	N/A	INTRINSIC
low complexity region	69	87	N/A	INTRINSIC
LamGL	114	263	1.55e-54	SMART
NL	396	438	4.15e-8	SMART
NL	441	471	6.73e-1	SMART
Pfam:Peptidase_M43	500	657	2.5e-10	PFAM
Blast:FN3	669	929	1e-165	BLAST
CCP	1212	1277	1.39e-9	SMART
CCP	1282	1339	1.08e-6	SMART
CCP	1343	1407	1.64e-6	SMART
CCP	1412	1468	8.06e-6	SMART
NL	1544	1581	3.24e-10	SMART
low complexity region	1584	1591	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000084501)
• Meta Mutation Damage Score: 0.2417
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:32 PM by Diantha La Vine
• Record Created: 2018-12-22 5:54 AM by Bruce Beutler
• Record Posted: 2019-02-27
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Nanda Regmi, Jonathan Rios, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_021362; MGI:97479

Alleles Listed at MGI

All Mutations and Alleles(4) : Targeted (4)

Phenotypic Description

Figure 1. Caer mice exhibited reduced body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Caer mice exhibited reduced bone mineral content in the tibia. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Caer mice exhibited reduced bone mineral densities in the tibia. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Caer mice exhibited reduced bone mineral content in the femur. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Caer mice exhibited reduced bone mineral densities in the femur. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Caer mice exhibited reduced lean mass. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The caer phenotype was identified among G3 mice of the pedigree R6462, some of which showed reduced body weights compared to wild-type littermates (Figure 1). Some mice also showed reduced bone mineral content and densities of both tibias (Figure 2 and Figure 3, respectively) and femurs (Figure 4 and Figure 5, respectively). Mice also showed reduced lean mass (Figure 6).

Nature of Mutation

Figure 7. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R6462. Weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. All of the above anomalies were linked to a mutation in Pappa:  a C to A transversion at base pair 65,124,891 (v38) on chromosome 4, or base pair 718 in the GenBank genomic region NC_000070. The strongest association was found with a recessive model of inheritance to the reduced body weight phenotype, wherein two variant homozygotes departed phenotypically from 19 homozygous reference mice and 37 heterozygous mice with a P value of 1.248 x 10^-13 (Figure 7).  

The mutation corresponds to residue 718 in the mRNA sequence NM_021362 within exon 1 of 22 total exons.

702 CCCCGCGACGCCTTTACACTGCAAGTGTGGCTG 112 -P--R--D--A--F--T--L--Q--V--W--L-

The mutated nucleotide is indicated in red. The mutation results in a threonine to lysine substitution at position 117 (T117K) in the PAPPA protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.978).

Protein Prediction

Figure 8. Domain organization of PAPP-A. The caer mutation results in a threonine to lysine substitution at position 117 within the laminin G-like domain. This image is interactive. Other mutations found in PAPP-A are noted in red. Click on each allele for more information. Abbreviations: SP, signal peptide; LNR: Lin12/Notch repeats; CCP, complement control protein

Pappa encodes pregnancy-associated plasma protein A (PAPP-A; alternatively, IGFBP4 protease or differentially expressed in placenta 1 [DIPLA1]), a member of the pappalysin subfamily of the metzincin protease family along with PAPP-A2 (see the record for Lilliputian) and ulilysin. PAPP-A shares 62% homology to PAPP-A2 (1).

PAPP-A has several domains, including a signaling peptide (amino acids 1-22), a laminin G-like domain, three Lin12/Notch repeats (LNRs), a metalloprotease region (amino acids 272-583), and five complement control protein (CCP) domains (alternatively, short consensus repeat [SCR] or Sushi domains; amino acids 1210-1279, 1280-1341, 1342-1409, 1410-1470, and 1473-1553) (Figure 8) (2). PAPP-A is initially translated as a 1,624 proprotein; cleavage of the signal peptide and a propeptide (amino acids 23-80) generates the mature 1,544 amino acid peptide (3).

Laminin G-like domains are 180 to 200 amino acid modules found in extracellular matrix (ECM) glycoproteins such as laminin, perlecan, and agrin (4). Laminin G-like domains are comprised of a 14-stranded β sandwich with a calcium ion bound to one edge of the sandwich (4). In the above-mentioned ECM proteins, the laminin G-like domains mediate binding to heparin, integrins, and the cell surface receptor α-dystroglycan (α-DG) as well as to sulfated carbohydrates and extracellular ligands (4;5). Association between the laminin G-like domain-containing ECM proteins and heparin or α-DG is essential for basement membrane assembly as well as muscle and nerve cell function. The function of the laminin G-like domain in PAPP-A is unknown.

LNRs are typically found only in Notch receptors. LNRs bind calcium and determine proteolytic specificity. The LNRs are approximately 35 to 40 amino acids in length. Each LNR contains six cysteine residues engaged in three disulfide bonds and three conserved aspartate and asparagine residues, which are proposed to coordinate a calcium ion (6). Single amino acid mutations in the PAPP-A LNRs result in loss of calcium binding and subsequent loss of activity towards insulin-like growth factor binding protein 4 (IGFBP4), a PAPP-A substrate; cleavage of another substrate, IGFBP5, was not disrupted (7).

The CCP domains have a consensus sequence spanning approximately 60 residues containing four invariant cysteine residues forming two disulfide-bridges (I-III and II-IV), a highly conserved tryptophan, and conserved glycine, proline, and hydrophobic residues (8). CCP domains fold into a small and compact hydrophobic core enveloped by six beta-strands and stabilized by the disulfide bridges; the topology of the other strands relative to this central conserved core is variable (9;10). The CCP domains mediate recognition processes such as the binding of complement factors to fragments C3b and C4b (8). The third and fourth CCP domains of PAPP-A bind cell surface molecules displaying glycosaminoglycans (GAGs).

PAPP-A has 14 putative N-glycosylation sites, seven putative O-glycosylation sites, and 82 cysteines that are involved in disulfide bond formation (2). PAPP-A forms a disulfide-linked homodimer, and is found as a disulfide-linked 2:2 heterotetramer with the proform of PRG2 (proMBP) in pregnancy serum. Formation of the PAPP-A/proMBP complex results in rearrangement of disulfide bonds in proximity to the PAPP-A active site, which renders PAPP-A inactive towards its substrates (11-13).

Human PAPPA produces a major transcript of approximately 12-kb and a minor transcript of approximately 8.5 kb in the placenta (2). A short transcript, designated DIPLA1, and a DIPLA1 antisense transcript, DIPAS, was cloned from the 3-prime end of PAPPA (14). DIPLA1 and DIPAS are encoded by one exon and contain several upstream open reading frames. DIPLA1 is expressed only in the placenta (14).

The caer mutation results in a threonine to lysine substitution at position 117 (T117K); Thr117 is within the laminin G-like domain.

Expression/Localization

PAPPA is predominantly expressed in the placenta (2). PAPP-A is expressed in ovarian follicles, follicular fluid, luteal cells, and fallopian tubes of nonpregnant women and in the seminal vesicles and seminal fluid of males. PAPP-A is also expressed in the kidney, spleen, breast, brain, skin, and prostate (15).

Serum PAPP-A levels are often increased in patients with severe sepsis and may be associated with sepsis-related myocardial dysfunction (16). Maternal serum levels of PAPP-A increases exponentially until term. Women with low PAPP-A expression levels during their first trimester were more likely to have a child born small (£10th percentile) for their gestational age (17-22).

Background

Figure 9. PAPP-A functions in the processing of IGFBP4. In IGF-1R-associated signaling, the MAPK and Akt/mTOR pathways are essential for cell proliferation, differentiation, protein synthesis, cell survival, and metabolism. PI3K signals mTORC1 via Akt, which inactivates TSC to prevent inibition of mTORC1. mTORC1 mediates several downstream effects in the cell including suppression of autophagy, activation of transcription leading to mitochondrial metabolism, increased protein synthesis, proliferation, and growth factor production.

PAPP-A is a secreted metalloproteinase that cleaves IGFBP2, IGFBP4, and IGFBP5. PAPP-A cleaves the Met135/Lys136 bond in IGFBP4 and the Ser143/Lys144 bond in IGFBP5 (23-26). IGFBPs are carrier proteins that bind insulin-like growth factors (IGFs), regulating the bioavailability of IGFs by prolonging their half-life and circulation turnover. IGFBP5 is a factor involved in bone metabolism, and also has IGF-I-independent functions. IGFPB5 is able to bind its putative receptor, facilitating its entry into the cytoplasm and subsequent interaction with other proteins. IGF release and IGF-related signaling is mediated by the cleavage of the IGFBPs by proteases (Figure 9). IGFs are essential for the regulation of growth and development by influencing the proliferation, differentiation, and apoptosis of osteoblasts (23;27). IGFs bind to two types of receptors (IGF-IR and IGF-IIR), subsequently activating downstream tyrosine kinase pathways. In IGF-I-associated signaling, both the IRS-1/phosphoinositide 3-kinase/serine–threonine kinase pathway and the Ras/mitogen-activated protein kinase/extracellular signal-regulated kinase pathway are activated, which subsequently promote cell proliferation, tissue differentiation, and protection from apoptosis.

Pappa-deficient (Pappa^-/-) mice showed reduced body sizes and weights (60 to 70% of wild-type mice) as well as delayed bone ossification (28). The Pappa^-/- mice also showed increased lifespans by 30 to 40% as well as reduced incidences of spontaneous tumors (29). Pappa^-/- mice had resistance to age-dependent thymic involution (30), and Pappa^-/- female mice showed reduced ovarian function and fertility (31). In contrast, transgenic overexpression of PAPP-A in skeletal muscle resulted in increased skeletal muscle weight and muscle fiber area (32). Mice with transgenic overexpression of PAPP-A in osteoblasts showed increased calvarial bone thickness, bone marrow cavities, skull bone mineral densities, total bone area in the femur and tibia, and bone formation rates (33). Osteoblasts from mice with transgenic overexpression of PAPP-A in osteoblasts showed increased IGFBP4 proteolysis and free IGF-I concentration (33).

Putative Mechanism

Through its role in cleaving IGFBPs (and subsequent release of bioactive IGF), PAPP-A functions as a growth-promoting enzyme. IGFBP4 cleavage is required to activate most, if not all, IGF2-mediated growth-promoting activity. The reduced body size phenotype of the Pappa^-/- mice is similar to that in IGF2 knockout mice (34) and IGFBP4 knockout mice (35). The phenotype of the caer mice mimics that of the Pappa^-/- mice, indicating loss of PAPP-A function.

Primers

PCR Primer
caer_pcr_F: TTGCCAACCAGGAGGAGTTG
caer_pcr_R: CCATTCCGCAGATGGGTTAAAG

Sequencing Primer
caer_seq_F: ACATGCGGCTCTGGAGTTG
caer_seq_R: CAGATGGGTTAAAGAGAGTCTCTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 786 nucleotides is amplified (chromosome 4, + strand):

1   ttgccaacca ggaggagttg gactgtattt ttgaaaggtg gggggagtgg agcacacacc
61  ttgaggagga aagcgagaaa gaaaagaaaa aagcaagtgg aaggggggct cgcacgagaa
121 aggaggcaaa tagtagtgcg agctaaagct ggcagctccg ggcggcggtg caggggcgca
181 gggggggcgg gggggaccgt cggacatgcg gctctggagt tgggtgctgc gcctggggct
241 gctgagcgcc gcgctgggct gcgggctggc cgagcgcccc cgccgggtcc gaagagaccc
301 tcgggccgtg cgccccccgc gccccgccgc tggaccggcc acctgcgcca cccgggcggc
361 ccgcggtcgc cgcgcctcgc cgccgccgcc tccgggcggt gcctgggaag ccgtgcgcgt
421 cccccggcgg cggcagcagc gggcggcgag gggcgccgag gagccgagcc cgcctagccg
481 ggcgctctat ttcagcgggc gaggggagca gctgcgcctc cgggccgacc tggagctacc
541 ccgcgacgcc tttacactgc aagtgtggct gcgagccgag ggtggccaga agtctccagc
601 agtgatcaca ggtaaggaga aaggggtccc ccctgtctgg cggaccaccc tgcgggtctc
661 tgcaggcccc tcctgggttc ttgcggatgt ctggggtgca ggtggcgggt gggtctgcgg
721 gagccgtccc gggagcagca cagggagtaa ggaagagaga ctctctttaa cccatctgcg
781 gaatgg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Farr, M., Strube, J., Geppert, H. G., Kocourek, A., Mahne, M., and Tschesche, H. (2000) Pregnancy-Associated Plasma Protein-E (PAPP-E). Biochim Biophys Acta. 1493, 356-362.

  2. Kristensen, T., Oxvig, C., Sand, O., Moller, N. P., and Sottrup-Jensen, L. (1994) Amino Acid Sequence of Human Pregnancy-Associated Plasma Protein-A Derived from Cloned cDNA. Biochemistry. 33, 1592-1598.

  3. Haaning, J., Oxvig, C., Overgaard, M. T., Ebbesen, P., Kristensen, T., and Sottrup-Jensen, L. (1996) Complete cDNA Sequence of the Preproform of Human Pregnancy-Associated Plasma Protein-A. Evidence for Expression in the Brain and Induction by cAMP. Eur J Biochem. 237, 159-163.

  4. Hohenester, E., Tisi, D., Talts, J. F., and Timpl, R. (1999) The Crystal Structure of a Laminin G-Like Module Reveals the Molecular Basis of Alpha-Dystroglycan Binding to Laminins, Perlecan, and Agrin. Mol Cell. 4, 783-792.

  5. Timpl, R., Tisi, D., Talts, J. F., Andac, Z., Sasaki, T., and Hohenester, E. (2000) Structure and Function of Laminin LG Modules. Matrix Biol. 19, 309-317.

  6. Aster, J. C., Simms, W. B., Zavala-Ruiz, Z., Patriub, V., North, C. L., and Blacklow, S. C. (1999) The Folding and Structural Integrity of the First LIN-12 Module of Human Notch1 are Calcium-Dependent. Biochemistry. 38, 4736-4742.

  7. Boldt, H. B., Kjaer-Sorensen, K., Overgaard, M. T., Weyer, K., Poulsen, C. B., Sottrup-Jensen, L., Conover, C. A., Giudice, L. C., and Oxvig, C. (2004) The Lin12-Notch Repeats of Pregnancy-Associated Plasma Protein-A Bind Calcium and Determine its Proteolytic Specificity. J Biol Chem. 279, 38525-38531.

  8. Reid, K. B., and Day, A. J. (1989) Structure-Function Relationships of the Complement Components. Immunol Today. 10, 177-180.

  9. Norman, D. G., Barlow, P. N., Baron, M., Day, A. J., Sim, R. B., and Campbell, I. D. (1991) Three-Dimensional Structure of a Complement Control Protein Module in Solution. J Mol Biol. 219, 717-725.

  10. Gaboriaud, C., Rossi, V., Bally, I., Arlaud, G. J., and Fontecilla-Camps, J. C. (2000) Crystal Structure of the Catalytic Domain of Human Complement c1s: A Serine Protease with a Handle. EMBO J. 19, 1755-1765.

  11. Glerup, S., Boldt, H. B., Overgaard, M. T., Sottrup-Jensen, L., Giudice, L. C., and Oxvig, C. (2005) Proteinase Inhibition by Proform of Eosinophil Major Basic Protein (Pro-MBP) is a Multistep Process of Intra- and Intermolecular Disulfide Rearrangements. J Biol Chem. 280, 9823-9832.

  12. Overgaard, M. T., Glerup, S., Boldt, H. B., Rodacker, V., Olsen, I. M., Christiansen, M., Sottrup-Jensen, L., Giudice, L. C., and Oxvig, C. (2004) Inhibition of Proteolysis by the Proform of Eosinophil Major Basic Protein (proMBP) Requires Covalent Binding to its Target Proteinase. FEBS Lett. 560, 147-152.

  13. Overgaard, M. T., Haaning, J., Boldt, H. B., Olsen, I. M., Laursen, L. S., Christiansen, M., Gleich, G. J., Sottrup-Jensen, L., Conover, C. A., and Oxvig, C. (2000) Expression of Recombinant Human Pregnancy-Associated Plasma Protein-A and Identification of the Proform of Eosinophil Major Basic Protein as its Physiological Inhibitor. J Biol Chem. 275, 31128-31133.

  14. Garcia, J., and Castrillo, J. L. (2005) Identification of Two Novel Human Genes, DIPLA1 and DIPAS, Expressed in Placenta Tissue. Gene. 344, 241-250.

  15. Soe, R., Overgaard, M. T., Thomsen, A. R., Laursen, L. S., Olsen, I. M., Sottrup-Jensen, L., Haaning, J., Giudice, L. C., Conover, C. A., and Oxvig, C. (2002) Expression of Recombinant Murine Pregnancy-Associated Plasma Protein-A (PAPP-A) and a Novel Variant (PAPP-Ai) with Differential Proteolytic Activity. Eur J Biochem. 269, 2247-2256.

  16. Zhang, Z., Dai, H., Yu, Y., Yang, J., Chen, J., and Wu, L. (2014) Elevated Pregnancy-Associated Plasma Protein A Predicts Myocardial Dysfunction and Death in Severe Sepsis. Ann Clin Biochem. 51, 22-29.

  17. Leung, T. Y., Sahota, D. S., Chan, L. W., Law, L. W., Fung, T. Y., Leung, T. N., and Lau, T. K. (2008) Prediction of Birth Weight by Fetal Crown-Rump Length and Maternal Serum Levels of Pregnancy-Associated Plasma Protein-A in the First Trimester. Ultrasound Obstet Gynecol. 31, 10-14.

  18. Baer, R. J., Lyell, D. J., Norton, M. E., Currier, R. J., and Jelliffe-Pawlowski, L. L. (2016) First Trimester Pregnancy-Associated Plasma Protein-A and Birth Weight. Eur J Obstet Gynecol Reprod Biol. 198, 1-6.

  19. Lo, T. K., Chan, K. Y., Chan, S. S., Kan, A. S., Hui, A. P., and Tang, M. H. (2015) Pregnancy-Associated Plasma Protein A for Prediction of Fetal Growth Restriction. Int J Gynaecol Obstet. 130, 200.

  20. Peterson, S. E., and Simhan, H. N. (2008) First-Trimester Pregnancy-Associated Plasma Protein A and Subsequent Abnormalities of Fetal Growth. Am J Obstet Gynecol. 198, e43-5.

  21. Smith, G. C., Stenhouse, E. J., Crossley, J. A., Aitken, D. A., Cameron, A. D., and Connor, J. M. (2002) Early-Pregnancy Origins of Low Birth Weight. Nature. 417, 916.

  22. Smith, G. C., Stenhouse, E. J., Crossley, J. A., Aitken, D. A., Cameron, A. D., and Connor, J. M. (2002) Early Pregnancy Levels of Pregnancy-Associated Plasma Protein a and the Risk of Intrauterine Growth Restriction, Premature Birth, Preeclampsia, and Stillbirth. J Clin Endocrinol Metab. 87, 1762-1767.

  23. Govoni, K. E., Baylink, D. J., and Mohan, S. (2005) The Multi-Functional Role of Insulin-Like Growth Factor Binding Proteins in Bone. Pediatr Nephrol. 20, 261-268.

  24. Conover, C. A. (2008) Insulin-Like Growth Factor-Binding Proteins and Bone Metabolism. Am J Physiol Endocrinol Metab. 294, E10-4.

  25. Laursen, L. S., Overgaard, M. T., Nielsen, C. G., Boldt, H. B., Hopmann, K. H., Conover, C. A., Sottrup-Jensen, L., Giudice, L. C., and Oxvig, C. (2002) Substrate Specificity of the Metalloproteinase Pregnancy-Associated Plasma Protein-A (PAPP-A) Assessed by Mutagenesis and Analysis of Synthetic Peptides: Substrate Residues Distant from the Scissile Bond are Critical for Proteolysis. Biochem J. 367, 31-40.

  26. Laursen, L. S., Overgaard, M. T., Soe, R., Boldt, H. B., Sottrup-Jensen, L., Giudice, L. C., Conover, C. A., and Oxvig, C. (2001) Pregnancy-Associated Plasma Protein-A (PAPP-A) Cleaves Insulin-Like Growth Factor Binding Protein (IGFBP)-5 Independent of IGF: Implications for the Mechanism of IGFBP-4 Proteolysis by PAPP-A. FEBS Lett. 504, 36-40.

  27. Mohan, S., Richman, C., Guo, R., Amaar, Y., Donahue, L. R., Wergedal, J., and Baylink, D. J. (2003) Insulin-Like Growth Factor Regulates Peak Bone Mineral Density in Mice by both Growth Hormone-Dependent and -Independent Mechanisms. Endocrinology. 144, 929-936.

  28. Conover, C. A., Bale, L. K., Overgaard, M. T., Johnstone, E. W., Laursen, U. H., Fuchtbauer, E. M., Oxvig, C., and van Deursen, J. (2004) Metalloproteinase Pregnancy-Associated Plasma Protein A is a Critical Growth Regulatory Factor during Fetal Development. Development. 131, 1187-1194.

  29. Conover, C. A., and Bale, L. K. (2007) Loss of Pregnancy-Associated Plasma Protein A Extends Lifespan in Mice. Aging Cell. 6, 727-729.

  30. Vallejo, A. N., Michel, J. J., Bale, L. K., Lemster, B. H., Borghesi, L., and Conover, C. A. (2009) Resistance to Age-Dependent Thymic Atrophy in Long-Lived Mice that are Deficient in Pregnancy-Associated Plasma Protein A. Proc Natl Acad Sci U S A. 106, 11252-11257.

  31. Nyegaard, M., Overgaard, M. T., Su, Y. Q., Hamilton, A. E., Kwintkiewicz, J., Hsieh, M., Nayak, N. R., Conti, M., Conover, C. A., and Giudice, L. C. (2010) Lack of Functional Pregnancy-Associated Plasma Protein-A (PAPPA) Compromises Mouse Ovarian Steroidogenesis and Female Fertility. Biol Reprod. 82, 1129-1138.

  32. Rehage, M., Mohan, S., Wergedal, J. E., Bonafede, B., Tran, K., Hou, D., Phang, D., Kumar, A., and Qin, X. (2007) Transgenic Overexpression of Pregnancy-Associated Plasma Protein-A Increases the Somatic Growth and Skeletal Muscle Mass in Mice. Endocrinology. 148, 6176-6185.

  33. Qin, X., Wergedal, J. E., Rehage, M., Tran, K., Newton, J., Lam, P., Baylink, D. J., and Mohan, S. (2006) Pregnancy-Associated Plasma Protein-A Increases Osteoblast Proliferation in Vitro and Bone Formation in Vivo. Endocrinology. 147, 5653-5661.

  34. DeChiara, T. M., Efstratiadis, A., and Robertson, E. J. (1990) A Growth-Deficiency Phenotype in Heterozygous Mice Carrying an Insulin-Like Growth Factor II Gene Disrupted by Targeting. Nature. 345, 78-80.

  35. Ning, Y., Schuller, A. G., Bradshaw, S., Rotwein, P., Ludwig, T., Frystyk, J., and Pintar, J. E. (2006) Diminished Growth and Enhanced Glucose Metabolism in Triple Knockout Mice Containing Mutations of Insulin-Like Growth Factor Binding Protein-3, -4, and -5. Mol Endocrinol. 20, 2173-2186.