Phenotypic Mutation 'add' (pdf version)
Gene Symbol Tomt
Gene Name transmembrane O-methyltransferase
Synonym(s) Comt2, F930017I19Rik
Accession Number

NCBI RefSeq: NM_001081679; MGI: 3707696

Allele add
Institutional SourceBeutler Lab
Mapped Yes 
Chromosome 7
Chromosomal Location 101,898,373-101,903,785 bp (-)
Type of Mutation MISSENSE
DNA Base Change
(Sense Strand)
G to T at 101,902,129 bp (GRCm38)
Amino Acid Change Arginine changed to Leucine
Ref Sequences
R48L in NCBI: NP_001075148.1 (fasta)
SMART Domains

DomainStartEndE-ValueType
Pfam:Methyltransf_3 65 223 1.1e-13 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using NCBI: NP_001075148.1)
Phenotypic Category behavior/neurological, hearing/vestibular/ear, nervous system
Penetrance 100% 
Alleles Listed at MGI

All alleles(4) : Gene trapped(3) Chemically induced(1)

Lab Alleles APN: IGL00433:Tomt
UTSW: X0018:Tomt
Mode of Inheritance Autosomal Recessive
Local Stock Embryos, Sperm, gDNA
Repository

MMRRC: 30528-UCD

Last Updated 12/12/2013 6:56 PM by Stephen Lyon
Record Created unknown
Record Posted 08/21/2008
Phenotypic Description
The add phenotype was identified as a neurological phenotype among G3 mice homozygous for ENU-induced mutations (1). Add mice exhibit bidirectional lateralized circling, head tossing, and repetitive short-lasting arching of the neck (‘stargazing’) by 3 weeks of age. These behaviors are attenuated during sleep. Add homozygotes have normal fertility, but are leaner than their wild type littermates, likely due to excessive activity. Add mutants are relatively aggressive, and when three or more homozygous males are confined in a single cage, they invariably attack one another, sustaining many wounds as a result.
 
Add homozygotes display a defective auditory startle response, and an increased threshold for auditory brain stem response (ABR) [90 decibels (dB) in add mutants compared with 40 dB in wild type mice], confirming that add mice are deaf. In distortion product otoacoustic emissions (DPOAE) tests (for middle ear function), acoustic signals for the primary stimulus frequencies, but not the cubic distortion frequency, were recorded from add mice, demonstrating that outer hair cell function is dramatically impaired. Quantitative analyses of movement behavior in the open field test and horizontal beam test demonstrate vestibular dysfunction in add mutants.
 
Add mutants display progressive degeneration of the organ of Corti. At postnatal day 5 (P5) inner ear morphology is normal in add mice, but by eight weeks of age there is severe degeneration including a complete loss of both inner hair cells (IHCs) and outer hair cells (OHCs) (Figure 1). Randomly oriented and disorganized stereociliary bundles are observed by P4 using scanning electron microscopy, indicating that hair cell defects exist before the degeneration of the organ of Corti. Spiral ganglion neuron density is also reduced by eight weeks of age in add mice. No other gross anatomical abnormalities were detected upon histological analysis of the cerebrum of add mutants.

 

Nature of Mutation
The add mutation was mapped to Chromosome 7, and corresponds to a G to T transversion at position 220 of the Tomt2 transcript (also known as Comt2), in exon 2 of 4 total exons.
 
204 CTTCGGATTGAGGAGCGGGCTTTCAGCTATGTGCTC
43  -L--R--I--E--E--R--A--F--S--Y--V--L-
 
The mutated nucleotide is indicated in red lettering, and causes an arginine to leucine substitution at position 48 of the TOMT2 protein.
 
At the time the add mutation was identified, Tomt2 was not annotated in the genomic assembly of Ensembl (release v41). It had been previously annotated in earlier Ensembl releases but withdrawn due to lack of evidence. RT-PCR with 5’ and 3’RACE confirmed that Tomt2 is an expressed transcript and established its 5’ and 3’ ends. An inner ear EST clone also contained part of the Tomt2 sequence.
Protein Prediction
Along with the monoamine oxidases (MAO), catechol-O-methyltransferase (classical COMT, hereafter COMT1) is responsible for the catabolism of the catecholamines dopamine, norepinephrine, and epinephrine by catalyzing the transfer of methyl groups to these molecules. TOMT2 (hereafter COMT2) shares 35% sequence identity with COMT1. COMT1 has 6 exons and encodes two isoforms, a shorter soluble form (S-COMT) and a longer membrane bound form (MB-COMT) (2). In contrast, COMT2 has 4 exons; the COMT2 protein contains 258 amino acids and is homologous to the longer COMT1 isoform that predominates in the brain. COMT2 is conserved in vertebrates, and mouse and human COMT2 share 92% sequence identity.
 
Like COMT1, COMT2 possesses methyltransferase activity as measured in COMT2-expressing cell lysates using norepinephrine as a substrate. However, COMT2 specific activity is approximately 50% lower than that of COMT1. The add mutation results in an arginine to leucine change at position 48 of COMT2. Mutant COMT2 lacks methyltransferase activity, as does COMT1 when the add mutation is introduced into the homologous site in the Comt1 cDNA.
Expression/Localization
RT-PCR analysis demonstrates Comt2 mRNA is expressed most abundantly in brain, muscle and liver, with lower levels in thymus and spleen, and no detectable expression in lung and testes. Comt2 transcript is strongly and specifically expressed in the IHCs and OHCs of the cochlea and vestibule, as detected by in situ hybridization on brain sections of neonates (postnatal day 4) or adult animals. No expression is observed in any other brain region. The subcellular localization of COMT2 is currently unknown.
Background
Catecholamines such as epinephrine, norepinephrine and dopamine have important functions as hormones and neuromodulators. Levels of catecholamines are tightly controlled through multiple pathways including their enzymatic modification. Once cleared from the neuronal synapse by the dopamine transporter (DAT) or by glial uptake mechanisms, dopamine is degraded by either COMT1 or monoamine oxidases-A and –B (MAO-A and MAO-B), the major mammalian enzymes responsible for dopamine catabolism known to date. COMT1 catalyzes the magnesium-dependent transfer of methyl groups from S-adenosyl methionine to a hydroxyl group on dopamine, converting it to 3-methoxytyramine (3). COMT1 also functions in the parallel monoamine oxidase-limited pathway to convert dopacetic acid (DOPAC) to homovanillic acid (HVA).
 
COMT1 is widely expressed in the central nervous system (4;5), and a growing body of work suggests that a major function of COMT1 is to regulate dopamine levels in the prefrontal cortex (PFC) (3). A gene encoding a COMT has been described on human chromosome 22. Hemizygous deletion of the COMT locus, observed in 22q11 microdeletion syndromes (Velocardiofacial syndrome, VCFS, OMIM #192430; DiGeorge syndrome, DGS, OMIM #188400) is strongly associated with schizophrenia in humans (6), as are specific COMT haplotypes (7-9), although the pathogenic mechanisms have not been fully elucidated. Excess dopamine signaling may contribute to symptoms of schizophrenia by triggering neuronal hyperstimulation. Indeed, dopamine antagonists are the primary treatment for schizophrenia.
Both in humans and rodents, increased dopamine signaling is associated with increased locomotor activity. While DAT-deficient mice exhibit an increase in locomotor activity and increased persistent levels of synaptic dopamine (10), targeted deletion or chemical inhibition of COMT1 results in relatively minor changes in both locomotor behavior and dopamine levels in the brain under normal conditions and when the DAT is inhibited using the specific inhibitor GBR 12909 (11-13). Furthermore, evidence indicates some COMT1 activity is retained in tissues of Comt1-null mice (12), suggesting that additional COMT enzymes are encoded in the mammalian genome.
 

Pharmacological and immunohistochemical evidence suggests that dopamine may regulate the processing of auditory signals within the mammalian cochlea. The cochlea contains two types of sensory hair cells with different functions and innervation patterns (Figure 2). OHCs are critical for the amplification of sound signals and are minimally innervated by afferent neurons. IHCs transmit sound information to the central nervous system (CNS) and receive the preponderance of afferent innervation. The medial olivocochlear complex (MOC), which originates in the medial nucleus of the superior olivary complex, modulates OHC activity via numerous efferent fibers that directly synapse on OHCs. The lateral olivocochlear complex (LOC) sends efferents into the cochlea that synapse with the dendrites of afferent neurons that innervate IHCs (14;15). While the full complement of neurotransmitters that are expressed by efferent neurons projecting to OHCs and IHCs is not known, a small number of the LOC-derived efferent fibers have been shown to be dopaminergic (16). Dopamine can modulate the activity of afferent neurons that synapse on IHCs (14;15). However, a role for dopamine or other catecholamines in the control of OHC function has not been demonstrated. Likewise, there is little information on the function of catecholamines in vestibular hair cells and their innervating neurons during the detection of head movement.

 
 
The human COMT2 gene is located on chromosome 11q13.4 at the Deafness, Neurosensory, Autosomal Recessive 63 (DFNB63) locus, which has been linked to nonsyndromic hearing impairment (17-19). The causative gene within the DFNB63 locus has not been identified. Direct sequencing of the five exons of COMT2 from 192 unrelated congenitally deaf progeny of consanguineous Iranian parents identified several point mutations (1). A homozygous stop mutation (Y71X) caused by a C to G transversion at position 213 is predicted to truncate the protein before the catalytic domain, likely affecting methyltransferase activity. A homozygous missense mutation (L16P) caused by a T to C transition at position 47 was also found, but the effect of the mutation on protein expression and methyltransferase activity is less clear. The gene grouping name DFNB refers to autosomal recessive genes that cause nonsyndromic hearing impairment, and consistent with this, both the Y71X and L16P mutations identified in COMT2 are strictly recessive. Finally, two heterozygous nucleotide alterations (c.353G>A and c.503G>A) were identified in three other Iranian families that result in amino acid substitutions R118H and R168Q. None of these variants was identified in 192 (384 chromosomes) ethnically-matched control individuals.
Putative Mechanism
In contrast to the previously described Comt1 gene that is widely expressed in many cell types and tissues, Comt2 is most highly expressed in IHCs and OHCs of the cochlea as well as in vestibular hair cells, with lower levels of expression elsewhere in the brain (detectable by RT-PCR, but beneath the level required for detection by in situ hybridization in whole brain slices). COMT1-null mice display a normal startle response to an acoustic stimulus (12), but COMT2 is essential for auditory and vestibular function. The strong localized expression of COMT2 in sensory hair cells of the inner ear suggests that the deafness in add mice is a direct consequence of defects in the auditory sense organs and not of neuronal circuit dysfunction in the CNS. Consistent with this model, the organ of Corti degenerates in add mice, where degenerative changes in hair cells are observed prior to the degeneration of afferent neurons. COMT2 is also strongly expressed in vestibular hair cells, suggesting that the circling behavior in add mice is similarly caused by degeneration of the vestibular sensory epithelia. The molecular mechanism that causes the inner ear pathology in add mice still needs to be determined. Dopamine modulates the activity of IHC afferent neurons, and it has been proposed that this neuromodulatory role is necessary to protect the dendrites of IHC afferent neurons from degenerative changes triggered by overstimulation (14;15). However, enhanced dopamine signaling in DAT-null mice (in which synaptic availability of dopamine is increased) does not cause deafness (10), and a function for catecholamines in regulating the function of OHCs or vestibular hair cells and their innervating neurons has not previously been demonstrated.
 
COMT1 inhibition or targeted deletion has surprisingly mild effects on both extracellular and tissue dopamine levels. The mild phenotype of Comt1-/- mice has been variously attributed to compensatory changes in dopamine metabolism, neurotransmission or signal transduction, or to changes in morphology or density of dopamine-producing or -responsive neurons that may be induced by the chronic absence of COMT during development (12;13), although none of these possibilities have been tested experimentally. Although COMT2 expression appears only in sensory hair cells of the inner ear by in situ hybridization, we note that it is possible to recover the COMT2 mRNA from whole brain lysates, indicating that the gene is expressed in the CNS, perhaps in small groups of cell or at very low levels. Add mice appear to be more aggressive than their wild-type littermates, indicating potential defects outside the inner ear. It will be important to determine the precise function of COMT2 in the CNS, and equally important to address whether COMT1 and COMT2 may have redundant functions in the degradation of dopamine, and that one COMT gene may be ectopically upregulated and compensate when the other is lacking. DAT-deficient mice display increased persistent levels of synaptic dopamine and increased spontaneous locomotor activity compared to wild type mice (10). It is possible that the lack of increased locomotor activity in COMT1-null compared to wild type mice may be explained by the presence of a redundant COMT enzyme. Examination of the phenotypes of double mutant COMT1- and COMT2-deficient mice is thus essential.
 
Interestingly, the hyperactive behavior of DAT-null mice is distinct from that of add mice, as DAT knockouts display generalized hyperactivity while add mice perform a specific circling behavior. Imbalance in forebrain dopamine signaling has been hypothesized as a generalized cause of lateralized circling in rodents (20). The circling (ci2) rat is a spontaneous autosomal recessive mutant that displays lateralized circling behavior, deafness, progressive retinopathy, locomotor hyperactivity, ataxia and ‘stargazing’ behavior (21;22), which have been attributed to an abnormal asymmetry in dopaminergic activity in the striatum (23;24). The genetic lesion(s) in ci2 rats is unknown, but the phenotype has been mapped to the distal arm of rat Chromosome 10, homologous to mouse Chromosome 11 (21). It may be revealing to examine the relative dopamine levels in each striatum of add mice.
 
Vestibular defects can result in circling behavior as animals physically compensate for vestibular dysfunction, and several mouse mutants, including the shaker-2 mutant (25), display both phenotypes. Vestibular defects causing circling may result in abnormal sensory input that leads to either wiring and/or signaling abnormalities in central neurons. It is unclear whether the hearing and vestibular defects in add mice occur independently of circling behavior.
Genotyping
Add genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion. The same primers are used for PCR amplification and for sequencing.
 
Primers
Add(F): 5’- GCAGGAGGTTGCAAAGAGCACAGGC -3’
Add(R): 5’- GTGATCTCTGCCTCCCTCAGCACCTG -3’
 
PCR program (use SIGMA JumpStart REDTaq)
1) 94°C             2:00
2) 94°C             0:15
3) 60°C             0:20
4) 72°C             1:00
5) repeat steps (2-4) 34X
6) 72°C             5:00
7) 4°C              ∞
 
The following sequence of 678 nucleotides (from Genbank genomic region NC_000073 for linear genomic sequence of Comt2) is amplified:
3899                                                                gc
3901 aggaggttgc aaagagcaca ggctgaactc aaatcccagt tctgctgtgt ctttggcaaa
3961 ggacagcctc tcagacatgt ttgtataagc gtggaaattg cataaataag tctgcacaaa
4021 tgacaggcaa atggtacatc taggtttccc cgccagcctc cctctatcct aggacccagg
4081 tagggacaat gtcccctgcc attgcactgg cattcctgcc actcgtggta acactgctgg
4141 tgagataccg gcaccatttc cgactgctgg tgcgtacagt cctgctgaga ggatttcgag
4201 actgcctgtc aggacttcgg attgaggagc gggctttcag ctatgtgctc acccatgccc
4261 tgcctggaga ccctggtcac atcctcacca cgcttgacca ttggagcagc tgctgcgagt
4321 acctgagcca catgggccct gttaaaggtg agtgttcctt tccctaccct tctgtttgag
4381 aaataaaccc aagacggtga agaaaaacct cgcatggccc actgcttacc tgggtaaatt
4441 aggaagtttc gtgattgcgt tatgacattt tccccccctc atttagaaat gaggagtctg
4501 gaccaagtta ttcagttatc cagcagacat ttattgccac tcttttgtgc caggtgctga
4561 gggaggcaga gatcac
 
Primer binding sites are underlined; the mutated G is highlighted in red.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsXin Du, Pia Viviani, Claudia Haller, Bruce Beutler
Edit History
02/01/2011 1:46 PM (current)
02/01/2011 9:53 AM
10/08/2010 2:03 PM
09/09/2010 8:49 AM
04/09/2010 2:18 PM
04/09/2010 2:18 PM
02/03/2010 9:04 AM