Phenotypic Mutation 'Magnified' (pdf version)
AlleleMagnified
Mutation Type missense
Chromosome9
Coordinate95,726,437 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Trpc1
Gene Name transient receptor potential cation channel, subfamily C, member 1
Synonym(s) Trrp1, Mtrp1, Trp1
Chromosomal Location 95,705,082-95,750,375 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight and a severe loss of salivary gland fluid secretion due to attenuation of store-operated Ca2+ currents. Surprisingly, no abnormalities are seen in store-operated or mechanosensitive cation channels in vascular smooth muscle cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011643, NM_001311123; MGI:109528

Mapped Yes 
Amino Acid Change Glutamic Acid changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000057640] [ENSMUSP00000140994] [ENSMUSP00000139672] [ENSMUSP00000140550] [ENSMUSP00000139577]
SMART Domains Protein: ENSMUSP00000057640
Gene: ENSMUSG00000032839
AA Change: E233G

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 2.6e-27 PFAM
transmembrane domain 367 386 N/A INTRINSIC
Pfam:Ion_trans 407 673 5.9e-17 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000053785)
SMART Domains Protein: ENSMUSP00000140994
Gene: ENSMUSG00000032839
AA Change: E101G

DomainStartEndE-ValueType
Blast:ANK 15 44 7e-12 BLAST
Pfam:TRP_2 50 105 1e-18 PFAM
transmembrane domain 201 222 N/A INTRINSIC
transmembrane domain 237 254 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000186235)
SMART Domains Protein: ENSMUSP00000139672
Gene: ENSMUSG00000032839
AA Change: E267G

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 1.8e-29 PFAM
transmembrane domain 367 386 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
Pfam:Ion_trans 441 661 1.2e-21 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000189137)
SMART Domains Protein: ENSMUSP00000140550
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000139577
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Meta Mutation Damage Score 0.6942 question?
Is this an essential gene? Probably nonessential (E-score: 0.151) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - increased
Body Weight (Female) - increased
Body Weight (Male) - increased
Body Weight (Z-score) - increased
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.487; ML prob: 0.48; human score: -0.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (other)(1) Endonuclease-mediated(2) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Trpc1 APN 9 95726494 missense probably damaging 1.00
IGL02094:Trpc1 APN 9 95743281 missense probably damaging 1.00
IGL02412:Trpc1 APN 9 95736861 missense probably damaging 1.00
IGL02494:Trpc1 APN 9 95708307 missense probably damaging 1.00
IGL02943:Trpc1 APN 9 95708853 splice site probably benign
IGL03025:Trpc1 APN 9 95710260 missense probably damaging 1.00
IGL03221:Trpc1 APN 9 95706900 missense probably damaging 1.00
Enlarged UTSW 9 95721471 critical splice acceptor site probably null
luxus UTSW 9 95721132 critical splice donor site probably null
PIT4581001:Trpc1 UTSW 9 95736921 missense probably benign 0.21
R0034:Trpc1 UTSW 9 95749761 missense probably damaging 0.98
R1973:Trpc1 UTSW 9 95723255 missense probably benign
R2033:Trpc1 UTSW 9 95706843 missense probably damaging 0.99
R2117:Trpc1 UTSW 9 95717584 missense probably damaging 1.00
R2262:Trpc1 UTSW 9 95706933 missense probably damaging 1.00
R2910:Trpc1 UTSW 9 95749842 missense probably benign 0.00
R2918:Trpc1 UTSW 9 95723129 missense probably damaging 1.00
R3156:Trpc1 UTSW 9 95721132 critical splice donor site probably null
R3427:Trpc1 UTSW 9 95732196 missense probably benign 0.12
R4093:Trpc1 UTSW 9 95706865 missense probably benign 0.12
R4384:Trpc1 UTSW 9 95732108 missense probably benign 0.13
R4787:Trpc1 UTSW 9 95721415 missense probably benign 0.02
R5327:Trpc1 UTSW 9 95721471 critical splice acceptor site probably null
R5576:Trpc1 UTSW 9 95721324 missense probably damaging 0.97
R6320:Trpc1 UTSW 9 95721250 missense probably damaging 1.00
R6499:Trpc1 UTSW 9 95726437 missense probably damaging 1.00
R6714:Trpc1 UTSW 9 95723273 missense probably damaging 1.00
R7179:Trpc1 UTSW 9 95721144 missense possibly damaging 0.82
R7265:Trpc1 UTSW 9 95708275 missense probably benign
R8169:Trpc1 UTSW 9 95710270 nonsense probably null
R8288:Trpc1 UTSW 9 95721381 missense probably damaging 1.00
R8342:Trpc1 UTSW 9 95726548 missense probably damaging 1.00
X0026:Trpc1 UTSW 9 95732044 missense probably benign 0.36
Z1176:Trpc1 UTSW 9 95723216 missense probably damaging 0.99
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-10-23 1:57 PM by Diantha La Vine
Record Created 2018-12-25 3:54 AM by Bruce Beutler
Record Posted 2019-01-22
Phenotypic Description

Figure 1. Magnified mice exhibited increased body weights compared to wild-type littermates. Scaled body weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The magnified phenotype was identified among G3 mice of the pedigree R6499, some of which showed increased body weights compared wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 44 mutations (X-axis) identified in the G1 male of pedigree R6499. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 44 mutations. The increased body weight phenotype was linked to a mutation in Trpc1:  an A to G transition at base pair 95,726,437 (v38) on chromosome 9, or base pair 23,951 in the GenBank genomic region NC_000075.  Linkage was found with a recessive model of inheritance, wherein 15 variant homozygotes departed phenotypically from 28 homozygous reference mice and 38 heterozygous mice with a P value of 2.26 x 10-5 (Figure 2). 

 

The mutation corresponds to residue 1,271 in the mRNA sequence NM_178666 within exon 5 of 13 total exons.

 

1255 GAACTCAGCCTTGTGGAGGTGGAATTCAGGAAT

261  -E--L--S--L--V--E--V--E--F--R--N-

 

The mutated nucleotide is indicated in red. The mutation results in glutamic acid to glycine substitution at position 267 (E267G) in the TRPC1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 3. Domain organization and topography of TRPC1. A, Domain. B, Topography. The magnified mutation results in glutamic acid to glycine substitution at position 267. This image is interactive. Other mutations found in TRPC1 are noted in red. Click on each mutation for more information. Abbreviations: ANK, ankyrin repeats; TM, transmembrane domains; CC, coiled-coil

TRPC1 is one of seven members (TRPC1 through TRPC7) of the transient receptor potential canonical (TRPC) family of cation channels. The 809-amino acid TRPC1 has large intracellular N- and C-terminal tails, six transmembrane (TM)-spanning domains, and a putative hydrophobic, pore-forming region between the fifth and sixth TM domains (Figure 3). TRPC1 has four (NOTE: SMART shows only three) ankyrin repeats within its N-terminal tail. Ankyrin repeats span over 33 residues and are highly divergent, but contain a basic core motif of an initial β-hairpin followed by two anti-parallel α-helices connected by a tight hairpin loop. TRPC1 also has a TRP box (comprised of the EWKFAR sequence) of unknown function as well as a C-terminal coiled-coil that putatively mediates protein-protein interactions. TRPC1 has a calmodulin-binding domain encompassing the C-terminal coiled-coil that partially overlaps with an inositol 1,4,5-trisphosphate (IP3) receptor (IP3R)-binding domain (1).

 

The TRPC1 gene undergoes alternative splicing to generate five splice variants, but only three (α, β, and ε) are translated (2;3). The α and β isoforms are predicted to be 91 and 88 kDa, respectively. The TRPC1β isoform lacks 34 amino acids in the third ankyrin repeat, while the ε isoform has a 7 amino acid deletion downstream of the first TM domain.

 

The TRPC channels are able to form homomeric and heteromeric complexes, which broadens the channel properties. It is unclear whether TRPC1 monomers alone can form functional channels, or if TRPC1 only has a regulatory role on channels formed by other TRP proteins [reviewed in (4)]. TRPC1 can form complexes with TRPC3 (5;6), TRPC4 (7), TRPC5 (7;8), TRPC6 (6), TRPC7 (6), and TRPC3/TRPC7 (9). TRPC1 can also interact with proteins in other TRP families, including TRPV6 (10) and TRPV4 (11). The interaction between TRPC1 and TRPV6 suppresses TRPV6 translocation to the plasma membrane, inhibiting TRPV6-associated currents (10). The interaction between TRPC1 and TRPV4 promotes more efficient translocation to the plasma membrane compared to homomeric complexes (11).

 

TRPC1 also interacts with proteins involved in the regulation of membrane lipid raft domains, the actin cytoskeletal network, and channel trafficking (Table 1). Asp639 and Asp640 within the TRPC1 C-terminal domain interact with two C-terminal lysines (Lys684 and Lys685) on the regulatory protein STIM1 (stromal interaction molecule 1) (12). TRPC1 interacts with STIM1 within endoplasmic reticulum (ER)-plasma membrane (PM) junctions in response to calcium store depletion, and STIM1 is required for TRPC1 activation (12-14). The calcium-release activated calcium current channel Orai1 is also required for STIM1-mediated TRPC1 activation after calcium store depletion (14-17). Orai1-mediated calcium influx triggers the recruitment of TRPC1 to the plasma membrane whereby it is activated by STIM1. The N- and C-termini of TRPC1 have several Cav1 binding sites. The N-terminal site is between amino acid 322 and 349, and is required for TRPC1 plasma membrane localization (18). The C-terminal Cav1-interacting domain is between amino acids 626 and 635; the relevance of this site is unknown (18;19). The association between Cav1 and TRPC1 putatively blocks binding of STIM1 to TRPC1, and is proposed to retain TRPC1 in the sub-plasma membrane region within the ER-PM junction in close proximity to the assembly site of Orai1 and STIM1. The close proximity to Orai1 and STIM1 would promote a rapid response of TRPC1-containing vesicles to changes in calcium concentrations; the mechanism by which Cav1 dissociates from TRPC1 to promote STIM1 association is unknown. Homer binds TRPC1 at amino acids 644 to 650, preventing spontaneous channel activation as well as TRPC1—IP3R interactions (20).

 

Table 1. Select TRPC1 interacting proteins [reviewed in (21)]

 

Interacting protein

References

Signaling proteins

CaM

(19)

Gq/11

(19)

Orai1/2/3

(17)

PLCg

(22)

PMCA

(23)

STIM1

(13)

IP3R

(1)

TRPP1 (alternatively, PKD2)

(24)

Scaffolding and trafficking proteins

b-Tubulin

(25)

Cav-1

(19)

Cortactin

(26)

Enkurin

(27)

Homer/-1/-2/-3

(20)

MxA

(28)

RhoA

(29)

SNAP-25

(30)

VAMP

(30)

 

The magnified mutation results in glutamic acid to glycine substitution at position 267 (E267G) within an undefined region in the N-terminal tail.

Expression/Localization

TRPC1 is ubiquitously expressed with high levels in human fetal and adult brain, in adult heart, testes, and ovary, and at lower levels in fetal liver and kidney (31). TRPC1 localizes to the endoplasmic reticulum, plasma membrane, intracellular vesicles, and primary cilium.

Background
Figure 4. TRPC1 functions in store-operated calcium entry (SOCE). Agonist binding to G protein-coupled receptors induces Ca2+ store depletion, STIM1 organization in puncta and translocation to the plasma membrane, activation of Ca2+ entry through Orai1, and/or TRPC-dependent store-operated calcium channels. TRPC1-associated SOCE promotes salivary fluid secretion, smooth and skeletal muscle function, endothelial cell migration and permeability, wound healing, smooth muscle cell and embryonic stem cell proliferation, neuronal differentiation, vasocontraction, liver cell volume regulation, regulation of platelet aggregation, and protection against cell death.

The TRP ion channel family has seven subfamilies: TRPC, TRP Melastatin (TRPM), TRP Ankyrin (TRPA), TRP Mucolipin (TRPML), TRP Polycystin (TRPP), TRP NOPMC (TRPN), and TRP Vanilloid (TRPV). TRP channels can be activated through the activation of phospholipase C (PLC) by G protein-coupled receptors and receptor tyrosine kinases. Activation of PLC leads to hydrolysis of PIP2, producing diacylglycerol (DAG) and inositol (1,4,5) triphosphate (IP3). Strong evidence supports roles for PIP2 hydrolysis and DAG production in modulating TRP channel activity. The TRP channels can also be activated by ligands that range from exogenous small organic molecules (e.g. capsaicin), endogenous lipids or products of lipid metabolism (e.g. DAG), purine nucleotides and their metabolites (e.g. adenosine diphosphoribose (ADP-ribose)), to inorganic ions (e.g. Ca2+ and Mg2+) (32). A third mechanism is one of direct TRP channel activation by temperature changes, light changes, mechanical stimuli, coupling to IP3 receptors, cell swelling, channel phosphorylation through protein kinases A, C, and G (PKA, PKC, and PKG, respectively), and Ca2+/Calmodulin signaling (32-37).

 

TRP channels have roles in olfaction, nociception, speech, regulation of blood circulation, pain signal transduction, gut motility, mineral absorption, fluid balance, epithelial Ca2+ transport, development of airway and bladder hypersensitivities, and cell survival, cell growth, and cell death (33). The TRP channels function by facilitating the transmembrane flow of cations (i.e. Naand Ca2+) down electrochemical gradients to depolarize the cell as well as to mediate signal transduction (32;38).

 

TRPC1 functions in store-operated calcium entry (SOCE) in several tissues/cell types, including salivary gland, keratinocytes, smooth muscle, neuronal and endothelial cells, and platelets (Figure 4) (39). SOCE occurs upon internal calcium store depletion in the ER and stimulation of calcium mobilizing receptors. SOCE is activated in response to an increase in the level of IP3 caused by stimulation of cell surface receptors that are associated with the activation of PLC and hydrolysis of the plasma membrane lipid phosphatidylinositol bisphosphate, PIP2. SOCE regulates several cell functions, including cell proliferation, survival, differentiation, secretion, and migration (39). More specifically, TRPC1-associated SOCE promotes salivary fluid secretion, smooth and skeletal muscle function, endothelial cell migration and permeability, wound healing, smooth muscle cell and embryonic stem cell proliferation, neuronal differentiation, vasocontraction, liver cell volume regulation, regulation of platelet aggregation, and protection against cell death [reviewed in (39;40)].

 

Trpc1-deficient (Trpc1-/-) mice are overtly healthy and have normal lifespans, but exhibited reduced neurotransmitter-regulated salivary gland fluid secretion (41). Trpc1-/- mice also showed increased body weights (42). Loss of Trpc1 expression resulted in elimination of sustained Ca2+-dependent potassium channel activity in salivary gland acinar cells (41).

Putative Mechanism

The body weight phenotype observed in the magnified mice mimics that of Trpc1-/- mice (42), indicating loss of TRPC1-associated function. The mechanism by which loss of TRPC1 function leads to increased body weight/length is unknown, but indicates that TRPC1 functions in growth and development.

Primers PCR Primer
Magnified_pcr_F: CGCCATAAGGATAGTCTCAAGGG
Magnified_pcr_R: AGCTGTGGACAACATTTTCCAATG

Sequencing Primer
Magnified_seq_F: CATAAGGATAGTCTCAAGGGGATTTG
Magnified_seq_R: GTAAAACTAACAAGGGTATGTTTGTG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 515 nucleotides is amplified (chromosome 9, - strand):


1   agctgtggac aacattttcc aatgtttgtt ttcaaaatac ttaagtttta ggtgtttctt
61  cttatggaaa tatcttgaaa tatttataca tttataaaga ttggagagta aaactaacaa
121 gggtatgttt gtgttttttt gttttgtttt gttttttaca ttgggtaatt aaattctatc
181 acaggtttcg tcttgatatc tatagatgtc tggccagtcc agctctgata atgttaacag
241 aggaagatcc aattctgaga gcgtttgaac ttagtgctga cttaaaggaa ctcagccttg
301 tggaggtgga attcaggtgg gaaaaagtag atgttgtttg ttatgtcttt tgttgtagac
361 tcttctgcct caatcttttc ataagctgac taatgttgtt gacacttaga atttattttc
421 tctgtctaag gaacatgtct tggtgctatt tagtctattc ctcctctgtc ctttctcttt
481 aacccccaaa tccccttgag actatcctta tggcg


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsZhao Zhang and Bruce Beutler