Phenotypic Mutation 'Magnified'

• Allele: Magnified
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 95,608,490 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Trpc1
• Gene Name: transient receptor potential cation channel, subfamily C, member 1
• Synonym(s): Mtrp1, Trp1, Trrp1
• Chromosomal Location: 95,587,135-95,632,428 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight and a severe loss of salivary gland fluid secretion due to attenuation of store-operated Ca2+ currents. Surprisingly, no abnormalities are seen in store-operated or mechanosensitive cation channels in vascular smooth muscle cells. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamic Acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000057640] [ENSMUSP00000140994] [ENSMUSP00000139672] [ENSMUSP00000140550 ^†] [ENSMUSP00000139577 ^†] † probably from a misspliced transcript
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000057640; Gene: ENSMUSG00000032839; AA Change: E233G

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC
ANK	62	93	1.41e2	SMART
ANK	99	129	2.11e1	SMART
ANK	174	203	1.33e2	SMART
Pfam:TRP_2	209	271	2.6e-27	PFAM
transmembrane domain	367	386	N/A	INTRINSIC
Pfam:Ion_trans	407	673	5.9e-17	PFAM
coiled coil region	770	794	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000053785)
• SMART Domains: Protein: ENSMUSP00000140994; Gene: ENSMUSG00000032839; AA Change: E101G

Domain	Start	End	E-Value	Type
Blast:ANK	15	44	7e-12	BLAST
Pfam:TRP_2	50	105	1e-18	PFAM
transmembrane domain	201	222	N/A	INTRINSIC
transmembrane domain	237	254	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000186235)
• SMART Domains: Protein: ENSMUSP00000139672; Gene: ENSMUSG00000032839; AA Change: E267G

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC
ANK	62	93	1.41e2	SMART
ANK	99	129	2.11e1	SMART
ANK	174	203	1.33e2	SMART
Pfam:TRP_2	209	271	1.8e-29	PFAM
transmembrane domain	367	386	N/A	INTRINSIC
transmembrane domain	407	424	N/A	INTRINSIC
Pfam:Ion_trans	441	661	1.2e-21	PFAM
coiled coil region	770	794	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000189137)
• SMART Domains: Protein: ENSMUSP00000140550; Gene: ENSMUSG00000032839

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000139577; Gene: ENSMUSG00000032839

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.6942
• Is this an essential gene?: Probably nonessential (E-score: 0.105)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-10-23 1:57 PM by Diantha La Vine
• Record Created: 2018-12-25 3:54 AM by Bruce Beutler
• Record Posted: 2019-01-22
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Zhao Zhang and Bruce Beutler

Accession Number

NCBI RefSeq: NM_011643, NM_001311123; MGI:109528

Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (other)(1) Endonuclease-mediated(2) Targeted(5)

Phenotypic Description

Figure 1. Magnified mice exhibited increased body weights compared to wild-type littermates. Scaled body weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The magnified phenotype was identified among G3 mice of the pedigree R6499, some of which showed increased body weights compared wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 44 mutations (X-axis) identified in the G1 male of pedigree R6499. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 44 mutations. The increased body weight phenotype was linked to a mutation in Trpc1:  an A to G transition at base pair 95,726,437 (v38) on chromosome 9, or base pair 23,951 in the GenBank genomic region NC_000075.  Linkage was found with a recessive model of inheritance, wherein 15 variant homozygotes departed phenotypically from 28 homozygous reference mice and 38 heterozygous mice with a P value of 2.26 x 10^-5 (Figure 2). 

The mutation corresponds to residue 1,271 in the mRNA sequence NM_178666 within exon 5 of 13 total exons.

1255 GAACTCAGCCTTGTGGAGGTGGAATTCAGGAAT 261  -E--L--S--L--V--E--V--E--F--R--N-

The mutated nucleotide is indicated in red. The mutation results in glutamic acid to glycine substitution at position 267 (E267G) in the TRPC1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction

Figure 3. Domain organization and topography of TRPC1. A, Domain. B, Topography. The magnified mutation results in glutamic acid to glycine substitution at position 267. This image is interactive. Other mutations found in TRPC1 are noted in red. Click on each mutation for more information. Abbreviations: ANK, ankyrin repeats; TM, transmembrane domains; CC, coiled-coil

TRPC1 is one of seven members (TRPC1 through TRPC7) of the transient receptor potential canonical (TRPC) family of cation channels. The 809-amino acid TRPC1 has large intracellular N- and C-terminal tails, six transmembrane (TM)-spanning domains, and a putative hydrophobic, pore-forming region between the fifth and sixth TM domains (Figure 3). TRPC1 has four (NOTE: SMART shows only three) ankyrin repeats within its N-terminal tail. Ankyrin repeats span over 33 residues and are highly divergent, but contain a basic core motif of an initial β-hairpin followed by two anti-parallel α-helices connected by a tight hairpin loop. TRPC1 also has a TRP box (comprised of the EWKFAR sequence) of unknown function as well as a C-terminal coiled-coil that putatively mediates protein-protein interactions. TRPC1 has a calmodulin-binding domain encompassing the C-terminal coiled-coil that partially overlaps with an inositol 1,4,5-trisphosphate (IP₃) receptor (IP₃R)-binding domain (1).

The TRPC1 gene undergoes alternative splicing to generate five splice variants, but only three (α, β, and ε) are translated (2;3). The α and β isoforms are predicted to be 91 and 88 kDa, respectively. The TRPC1β isoform lacks 34 amino acids in the third ankyrin repeat, while the ε isoform has a 7 amino acid deletion downstream of the first TM domain.

The TRPC channels are able to form homomeric and heteromeric complexes, which broadens the channel properties. It is unclear whether TRPC1 monomers alone can form functional channels, or if TRPC1 only has a regulatory role on channels formed by other TRP proteins [reviewed in (4)]. TRPC1 can form complexes with TRPC3 (5;6), TRPC4 (7), TRPC5 (7;8), TRPC6 (6), TRPC7 (6), and TRPC3/TRPC7 (9). TRPC1 can also interact with proteins in other TRP families, including TRPV6 (10) and TRPV4 (11). The interaction between TRPC1 and TRPV6 suppresses TRPV6 translocation to the plasma membrane, inhibiting TRPV6-associated currents (10). The interaction between TRPC1 and TRPV4 promotes more efficient translocation to the plasma membrane compared to homomeric complexes (11).

TRPC1 also interacts with proteins involved in the regulation of membrane lipid raft domains, the actin cytoskeletal network, and channel trafficking (Table 1). Asp639 and Asp640 within the TRPC1 C-terminal domain interact with two C-terminal lysines (Lys684 and Lys685) on the regulatory protein STIM1 (stromal interaction molecule 1) (12). TRPC1 interacts with STIM1 within endoplasmic reticulum (ER)-plasma membrane (PM) junctions in response to calcium store depletion, and STIM1 is required for TRPC1 activation (12-14). The calcium-release activated calcium current channel Orai1 is also required for STIM1-mediated TRPC1 activation after calcium store depletion (14-17). Orai1-mediated calcium influx triggers the recruitment of TRPC1 to the plasma membrane whereby it is activated by STIM1. The N- and C-termini of TRPC1 have several Cav1 binding sites. The N-terminal site is between amino acid 322 and 349, and is required for TRPC1 plasma membrane localization (18). The C-terminal Cav1-interacting domain is between amino acids 626 and 635; the relevance of this site is unknown (18;19). The association between Cav1 and TRPC1 putatively blocks binding of STIM1 to TRPC1, and is proposed to retain TRPC1 in the sub-plasma membrane region within the ER-PM junction in close proximity to the assembly site of Orai1 and STIM1. The close proximity to Orai1 and STIM1 would promote a rapid response of TRPC1-containing vesicles to changes in calcium concentrations; the mechanism by which Cav1 dissociates from TRPC1 to promote STIM1 association is unknown. Homer binds TRPC1 at amino acids 644 to 650, preventing spontaneous channel activation as well as TRPC1—IP₃R interactions (20).

Table 1. Select TRPC1 interacting proteins [reviewed in (21)]

	Interacting protein	References
Signaling proteins	CaM	(19)
	Gq/11	(19)
	Orai1/2/3	(17)
	PLCg	(22)
	PMCA	(23)
	STIM1	(13)
	IP3R	(1)
	TRPP1 (alternatively, PKD2)	(24)
Scaffolding and trafficking proteins	b-Tubulin	(25)
	Cav-1	(19)
	Cortactin	(26)
	Enkurin	(27)
	Homer/-1/-2/-3	(20)
	MxA	(28)
	RhoA	(29)
	SNAP-25	(30)
	VAMP	(30)

The magnified mutation results in glutamic acid to glycine substitution at position 267 (E267G) within an undefined region in the N-terminal tail.

Expression/Localization

TRPC1 is ubiquitously expressed with high levels in human fetal and adult brain, in adult heart, testes, and ovary, and at lower levels in fetal liver and kidney (31). TRPC1 localizes to the endoplasmic reticulum, plasma membrane, intracellular vesicles, and primary cilium.

Background

Figure 4. TRPC1 functions in store-operated calcium entry (SOCE). Agonist binding to G protein-coupled receptors induces Ca 2+ store depletion, STIM1 organization in puncta and translocation to the plasma membrane, activation of Ca 2+ entry through Orai1, and/or TRPC-dependent store-operated calcium channels. TRPC1-associated SOCE promotes salivary fluid secretion, smooth and skeletal muscle function, endothelial cell migration and permeability, wound healing, smooth muscle cell and embryonic stem cell proliferation, neuronal differentiation, vasocontraction, liver cell volume regulation, regulation of platelet aggregation, and protection against cell death.

The TRP ion channel family has seven subfamilies: TRPC, TRP Melastatin (TRPM), TRP Ankyrin (TRPA), TRP Mucolipin (TRPML), TRP Polycystin (TRPP), TRP NOPMC (TRPN), and TRP Vanilloid (TRPV). TRP channels can be activated through the activation of phospholipase C (PLC) by G protein-coupled receptors and receptor tyrosine kinases. Activation of PLC leads to hydrolysis of PIP₂, producing diacylglycerol (DAG) and inositol (1,4,5) triphosphate (IP₃). Strong evidence supports roles for PIP₂ hydrolysis and DAG production in modulating TRP channel activity. The TRP channels can also be activated by ligands that range from exogenous small organic molecules (e.g. capsaicin), endogenous lipids or products of lipid metabolism (e.g. DAG), purine nucleotides and their metabolites (e.g. adenosine diphosphoribose (ADP-ribose)), to inorganic ions (e.g. Ca²⁺ and Mg²⁺) (32). A third mechanism is one of direct TRP channel activation by temperature changes, light changes, mechanical stimuli, coupling to IP₃ receptors, cell swelling, channel phosphorylation through protein kinases A, C, and G (PKA, PKC, and PKG, respectively), and Ca²⁺/Calmodulin signaling (32-37).

TRP channels have roles in olfaction, nociception, speech, regulation of blood circulation, pain signal transduction, gut motility, mineral absorption, fluid balance, epithelial Ca²⁺ transport, development of airway and bladder hypersensitivities, and cell survival, cell growth, and cell death (33). The TRP channels function by facilitating the transmembrane flow of cations (i.e. Na⁺ and Ca²⁺) down electrochemical gradients to depolarize the cell as well as to mediate signal transduction (32;38).

TRPC1 functions in store-operated calcium entry (SOCE) in several tissues/cell types, including salivary gland, keratinocytes, smooth muscle, neuronal and endothelial cells, and platelets (Figure 4) (39). SOCE occurs upon internal calcium store depletion in the ER and stimulation of calcium mobilizing receptors. SOCE is activated in response to an increase in the level of IP₃ caused by stimulation of cell surface receptors that are associated with the activation of PLC and hydrolysis of the plasma membrane lipid phosphatidylinositol bisphosphate, PIP₂. SOCE regulates several cell functions, including cell proliferation, survival, differentiation, secretion, and migration (39). More specifically, TRPC1-associated SOCE promotes salivary fluid secretion, smooth and skeletal muscle function, endothelial cell migration and permeability, wound healing, smooth muscle cell and embryonic stem cell proliferation, neuronal differentiation, vasocontraction, liver cell volume regulation, regulation of platelet aggregation, and protection against cell death [reviewed in (39;40)].

Trpc1-deficient (Trpc1^-/-) mice are overtly healthy and have normal lifespans, but exhibited reduced neurotransmitter-regulated salivary gland fluid secretion (41). Trpc1^-/- mice also showed increased body weights (42). Loss of Trpc1 expression resulted in elimination of sustained Ca²⁺-dependent potassium channel activity in salivary gland acinar cells (41).

Putative Mechanism

The body weight phenotype observed in the magnified mice mimics that of Trpc1^-/- mice (42), indicating loss of TRPC1-associated function. The mechanism by which loss of TRPC1 function leads to increased body weight/length is unknown, but indicates that TRPC1 functions in growth and development.

Primers

PCR Primer
Magnified_pcr_F: CGCCATAAGGATAGTCTCAAGGG
Magnified_pcr_R: AGCTGTGGACAACATTTTCCAATG

Sequencing Primer
Magnified_seq_F: CATAAGGATAGTCTCAAGGGGATTTG
Magnified_seq_R: GTAAAACTAACAAGGGTATGTTTGTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 515 nucleotides is amplified (chromosome 9, - strand):

1   agctgtggac aacattttcc aatgtttgtt ttcaaaatac ttaagtttta ggtgtttctt
61  cttatggaaa tatcttgaaa tatttataca tttataaaga ttggagagta aaactaacaa
121 gggtatgttt gtgttttttt gttttgtttt gttttttaca ttgggtaatt aaattctatc
181 acaggtttcg tcttgatatc tatagatgtc tggccagtcc agctctgata atgttaacag
241 aggaagatcc aattctgaga gcgtttgaac ttagtgctga cttaaaggaa ctcagccttg
301 tggaggtgga attcaggtgg gaaaaagtag atgttgtttg ttatgtcttt tgttgtagac
361 tcttctgcct caatcttttc ataagctgac taatgttgtt gacacttaga atttattttc
421 tctgtctaag gaacatgtct tggtgctatt tagtctattc ctcctctgtc ctttctcttt
481 aacccccaaa tccccttgag actatcctta tggcg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Boulay, G., Brown, D. M., Qin, N., Jiang, M., Dietrich, A., Zhu, M. X., Chen, Z., Birnbaumer, M., Mikoshiba, K., and Birnbaumer, L. (1999) Modulation of Ca(2+) Entry by Polypeptides of the Inositol 1,4, 5-Trisphosphate Receptor (IP3R) that Bind Transient Receptor Potential (TRP): Evidence for Roles of TRP and IP3R in Store Depletion-Activated Ca(2+) Entry. Proc Natl Acad Sci U S A. 96, 14955-14960.

  2. Ong, E. C., Nesin, V., Long, C. L., Bai, C. X., Guz, J. L., Ivanov, I. P., Abramowitz, J., Birnbaumer, L., Humphrey, M. B., and Tsiokas, L. (2013) A TRPC1 Protein-Dependent Pathway Regulates Osteoclast Formation and Function. J Biol Chem. 288, 22219-22232.

  3. Sakura, H., and Ashcroft, F. M. (1997) Identification of Four trp1 Gene Variants Murine Pancreatic Beta-Cells. Diabetologia. 40, 528-532.

  4. Dietrich, A., Fahlbusch, M., and Gudermann, T. (2014) Classical Transient Receptor Potential 1 (TRPC1): Channel Or Channel Regulator? Cells. 3, 939-962.

  5. Lintschinger, B., Balzer-Geldsetzer, M., Baskaran, T., Graier, W. F., Romanin, C., Zhu, M. X., and Groschner, K. (2000) Coassembly of Trp1 and Trp3 Proteins Generates Diacylglycerol- and Ca2+-Sensitive Cation Channels. J Biol Chem. 275, 27799-27805.

  6. Storch, U., Forst, A. L., Philipp, M., Gudermann, T., and Mederos y Schnitzler, M. (2012) Transient Receptor Potential Channel 1 (TRPC1) Reduces Calcium Permeability in Heteromeric Channel Complexes. J Biol Chem. 287, 3530-3540.

  7. Hofmann, T., Schaefer, M., Schultz, G., and Gudermann, T. (2002) Subunit Composition of Mammalian Transient Receptor Potential Channels in Living Cells. Proc Natl Acad Sci U S A. 99, 7461-7466.

  8. Strubing, C., Krapivinsky, G., Krapivinsky, L., and Clapham, D. E. (2001) TRPC1 and TRPC5 Form a Novel Cation Channel in Mammalian Brain. Neuron. 29, 645-655.

  9. Zagranichnaya, T. K., Wu, X., and Villereal, M. L. (2005) Endogenous TRPC1, TRPC3, and TRPC7 Proteins Combine to Form Native Store-Operated Channels in HEK-293 Cells. J Biol Chem. 280, 29559-29569.

  10. Schindl, R., Fritsch, R., Jardin, I., Frischauf, I., Kahr, H., Muik, M., Riedl, M. C., Groschner, K., and Romanin, C. (2012) Canonical Transient Receptor Potential (TRPC) 1 Acts as a Negative Regulator for Vanilloid TRPV6-Mediated Ca2+ Influx. J Biol Chem. 287, 35612-35620.

  11. Ma, X., Cheng, K. T., Wong, C. O., O'Neil, R. G., Birnbaumer, L., Ambudkar, I. S., and Yao, X. (2011) Heteromeric TRPV4-C1 Channels Contribute to Store-Operated Ca(2+) Entry in Vascular Endothelial Cells. Cell Calcium. 50, 502-509.

  12. Zeng, W., Yuan, J. P., Kim, M. S., Choi, Y. J., Huang, G. N., Worley, P. F., and Muallem, S. (2008) STIM1 Gates TRPC Channels, but Not Orai1, by Electrostatic Interaction. Mol Cell. 32, 439-448.

  13. Huang, G. N., Zeng, W., Kim, J. Y., Yuan, J. P., Han, L., Muallem, S., and Worley, P. F. (2006) STIM1 Carboxyl-Terminus Activates Native SOC, I(Crac) and TRPC1 Channels. Nat Cell Biol. 8, 1003-1010.

  14. Ong, H. L., Cheng, K. T., Liu, X., Bandyopadhyay, B. C., Paria, B. C., Soboloff, J., Pani, B., Gwack, Y., Srikanth, S., Singh, B. B., Gill, D. L., and Ambudkar, I. S. (2007) Dynamic Assembly of TRPC1-STIM1-Orai1 Ternary Complex is Involved in Store-Operated Calcium Influx. Evidence for Similarities in Store-Operated and Calcium Release-Activated Calcium Channel Components. J Biol Chem. 282, 9105-9116.

  15. Kim, M. S., Zeng, W., Yuan, J. P., Shin, D. M., Worley, P. F., and Muallem, S. (2009) Native Store-Operated Ca2+ Influx Requires the Channel Function of Orai1 and TRPC1. J Biol Chem. 284, 9733-9741.

  16. Liao, Y., Erxleben, C., Yildirim, E., Abramowitz, J., Armstrong, D. L., and Birnbaumer, L. (2007) Orai Proteins Interact with TRPC Channels and Confer Responsiveness to Store Depletion. Proc Natl Acad Sci U S A. 104, 4682-4687.

  17. Cheng, K. T., Liu, X., Ong, H. L., and Ambudkar, I. S. (2008) Functional Requirement for Orai1 in Store-Operated TRPC1-STIM1 Channels. J Biol Chem. 283, 12935-12940.

  18. Brazer, S. C., Singh, B. B., Liu, X., Swaim, W., and Ambudkar, I. S. (2003) Caveolin-1 Contributes to Assembly of Store-Operated Ca2+ Influx Channels by Regulating Plasma Membrane Localization of TRPC1. J Biol Chem. 278, 27208-27215.

  19. Lockwich, T. P., Liu, X., Singh, B. B., Jadlowiec, J., Weiland, S., and Ambudkar, I. S. (2000) Assembly of Trp1 in a Signaling Complex Associated with Caveolin-Scaffolding Lipid Raft Domains. J Biol Chem. 275, 11934-11942.

  20. Yuan, J. P., Kiselyov, K., Shin, D. M., Chen, J., Shcheynikov, N., Kang, S. H., Dehoff, M. H., Schwarz, M. K., Seeburg, P. H., Muallem, S., and Worley, P. F. (2003) Homer Binds TRPC Family Channels and is Required for Gating of TRPC1 by IP3 Receptors. Cell. 114, 777-789.

  21. Ong, H. L., and Ambudkar, I. S. (2015) Molecular Determinants of TRPC1 Regulation within ER-PM Junctions. Cell Calcium. 58, 376-386.

  22. Tu, C. L., Chang, W., and Bikle, D. D. (2005) Phospholipase cgamma1 is Required for Activation of Store-Operated Channels in Human Keratinocytes. J Invest Dermatol. 124, 187-197.

  23. Singh, B. B., Liu, X., Tang, J., Zhu, M. X., and Ambudkar, I. S. (2002) Calmodulin Regulates Ca(2+)-Dependent Feedback Inhibition of Store-Operated Ca(2+) Influx by Interaction with a Site in the C Terminus of TrpC1. Mol Cell. 9, 739-750.

  24. Tsiokas, L., Arnould, T., Zhu, C., Kim, E., Walz, G., and Sukhatme, V. P. (1999) Specific Association of the Gene Product of PKD2 with the TRPC1 Channel. Proc Natl Acad Sci U S A. 96, 3934-3939.

  25. Bollimuntha, S., Cornatzer, E., and Singh, B. B. (2005) Plasma Membrane Localization and Function of TRPC1 is Dependent on its Interaction with Beta-Tubulin in Retinal Epithelium Cells. Vis Neurosci. 22, 163-170.

  26. Formigli, L., Sassoli, C., Squecco, R., Bini, F., Martinesi, M., Chellini, F., Luciani, G., Sbrana, F., Zecchi-Orlandini, S., Francini, F., and Meacci, E. (2009) Regulation of Transient Receptor Potential Canonical Channel 1 (TRPC1) by Sphingosine 1-Phosphate in C2C12 Myoblasts and its Relevance for a Role of Mechanotransduction in Skeletal Muscle Differentiation. J Cell Sci. 122, 1322-1333.

  27. Sutton, K. A., Jungnickel, M. K., Wang, Y., Cullen, K., Lambert, S., and Florman, H. M. (2004) Enkurin is a Novel Calmodulin and TRPC Channel Binding Protein in Sperm. Dev Biol. 274, 426-435.

  28. Lussier, M. P., Cayouette, S., Lepage, P. K., Bernier, C. L., Francoeur, N., St-Hilaire, M., Pinard, M., and Boulay, G. (2005) MxA, a Member of the Dynamin Superfamily, Interacts with the Ankyrin-Like Repeat Domain of TRPC. J Biol Chem. 280, 19393-19400.

  29. Mehta, D., Ahmmed, G. U., Paria, B. C., Holinstat, M., Voyno-Yasenetskaya, T., Tiruppathi, C., Minshall, R. D., and Malik, A. B. (2003) RhoA Interaction with Inositol 1,4,5-Trisphosphate Receptor and Transient Receptor Potential Channel-1 Regulates Ca2+ Entry. Role in Signaling Increased Endothelial Permeability. J Biol Chem. 278, 33492-33500.

  30. Redondo, P. C., Harper, A. G., Salido, G. M., Pariente, J. A., Sage, S. O., and Rosado, J. A. (2004) A Role for SNAP-25 but Not VAMPs in Store-Mediated Ca2+ Entry in Human Platelets. J Physiol. 558, 99-109.

  31. Wes, P. D., Chevesich, J., Jeromin, A., Rosenberg, C., Stetten, G., and Montell, C. (1995) TRPC1, a Human Homolog of a Drosophila Store-Operated Channel. Proc Natl Acad Sci U S A. 92, 9652-9656.

  32. Ramsey, I. S., Delling, M., and Clapham, D. E. (2006) An Introduction to TRP Channels. Annu Rev Physiol. 68, 619-647.

  33. Alawi, K., and Keeble, J. (2010) The Paradoxical Role of the Transient Receptor Potential Vanilloid 1 Receptor in Inflammation. Pharmacol Ther. 125, 181-195.

  34. van de Graaf, S. F., Rescher, U., Hoenderop, J. G., Verkaart, S., Bindels, R. J., and Gerke, V. (2008) TRPV5 is Internalized Via Clathrin-Dependent Endocytosis to Enter a Ca2+-Controlled Recycling Pathway. J Biol Chem. 283, 4077-4086.

  35. Holzer, P. (2011) Transient Receptor Potential (TRP) Channels as Drug Targets for Diseases of the Digestive System. Pharmacol Ther. 131, 142-170.

  36. Holzer, P. (2011) TRP Channels in the Digestive System. Curr Pharm Biotechnol. 12, 24-34.

  37. Hoenderop, J. G., Voets, T., Hoefs, S., Weidema, F., Prenen, J., Nilius, B., and Bindels, R. J. (2003) Homo- and Heterotetrameric Architecture of the Epithelial Ca2+ Channels TRPV5 and TRPV6. EMBO J. 22, 776-785.

  38. Vesey, D. A. (2010) Transport Pathways for Cadmium in the Intestine and Kidney Proximal Tubule: Focus on the Interaction with Essential Metals. Toxicol Lett. 198, 13-19.

  39. Ong, H. L., and Ambudkar, I. S. (2011) The Dynamic Complexity of the TRPC1 Channelosome. Channels (Austin). 5, 424-431.

  40. Beech, D. J. (2005) TRPC1: Store-Operated Channel and More. Pflugers Arch. 451, 53-60.

  41. Liu, X., Cheng, K. T., Bandyopadhyay, B. C., Pani, B., Dietrich, A., Paria, B. C., Swaim, W. D., Beech, D., Yildrim, E., Singh, B. B., Birnbaumer, L., and Ambudkar, I. S. (2007) Attenuation of Store-Operated Ca2+ Current Impairs Salivary Gland Fluid Secretion in TRPC1(-/-) Mice. Proc Natl Acad Sci U S A. 104, 17542-17547.

  42. Dietrich, A., Kalwa, H., Storch, U., Mederos y Schnitzler, M., Salanova, B., Pinkenburg, O., Dubrovska, G., Essin, K., Gollasch, M., Birnbaumer, L., and Gudermann, T. (2007) Pressure-Induced and Store-Operated Cation Influx in Vascular Smooth Muscle Cells is Independent of TRPC1. Pflugers Arch. 455, 465-477.