Phenotypic Mutation 'Debil'

• Allele: Debil
• Mutation Type: missense
• Chromosome: 13
• Coordinate: 20,373,161 bp (GRCm38)
• Base Change: T ⇒ C (forward strand)
• Gene: Elmo1
• Gene Name: engulfment and cell motility 1
• Synonym(s): C230095H21Rik, 6330578D22Rik, CED-12
• Chromosomal Location: 20,090,596-20,608,353 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the engulfment and cell motility protein family. These proteins interact with dedicator of cytokinesis proteins to promote phagocytosis and cell migration. Increased expression of this gene and dedicator of cytokinesis 1 may promote glioma cell invasion, and single nucleotide polymorphisms in this gene may be associated with diabetic nephropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired Sertoli cell phagocytosis of apoptotic male germ cells. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000072334]
• SMART Domains: Protein: ENSMUSP00000072334; Gene: ENSMUSG00000041112; AA Change: L424P

Domain	Start	End	E-Value	Type
Pfam:DUF3361	115	280	3.8e-64	PFAM
Pfam:ELMO_CED12	303	481	2.8e-42	PFAM
PH	555	676	2.32e0	SMART
low complexity region	704	717	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000072519)
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9397
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Candidate Explorer Status: CE: excellent candidate; Verification probability: 0.823; ML prob: 0.766; human score: 1.5
• Mode of Inheritance: Unknown
• Last Updated: 2019-10-29 9:58 AM by Diantha La Vine
• Record Created: 2018-12-28 11:58 AM by Bruce Beutler
• Record Posted: 2019-01-07
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_198093, NM_080288; MGI:2153044

Alleles Listed at MGI

All Mutations and Alleles(20) : Gene trapped(16) Radiation induced(1) Targeted(3)

Phenotypic Description

Figure 1. Debil mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Debil mice exhibit reduced frequencies of peripheral central memory CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Debil mice exhibit reduced frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The debil phenotype was identified among G3 mice of the pedigree R6512, some of which showed increased frequencies of CD8+ T cells in CD3+ T cells (Figure 1) with concomitant reduced frequencies of central memory CD8 T cells in CD8 T cells (Figure 2) and NK cells (Figure 3) in the peripheral blood.

Nature of Mutation

Figure 4. Linkage mapping of the reduced NK cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 41 mutations (X-axis) identified in the G1 male of pedigree R6512. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 41 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Elmo1:  a T to C transition at base pair 20,373,161 (v38) on chromosome 13, or base pair 282,655 in the GenBank genomic region NC_000079 encoding Elmo1. The strongest association was found with a recessive model of inheritance to the normalized NK cell frequency, wherein 14 variant homozygotes departed phenotypically from 25 homozygous reference mice and 34 heterozygous mice with a P value of 6.542 x 10^-7 (Figure 4).

 

The mutation corresponds to residue 1,609 in the mRNA sequence NM_080288 within exon 15 of 22 total exons.

 

1593 GAGCTGACCAAGATGCTGTGTGAGATCCTCAAA 419  -E--L--T--K--M--L--C--E--I--L--K-

 

The mutated nucleotide is indicated in red. The mutation results in a leucine to proline substitution at position 424 (L424P) in the ELMO1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction

Figure 5 Domain organization of ELMO1. The debil mutation results in a leucine to proline substitution at position 424. Mutations found in the ELMO1 protein are shown in red. Click on each mutation for more information. Abbreviations: PH, pleckstrin homology domain; SH3, SH3-binding motif.

ELMO1 (engulfment and cell motility protein 1; alternatively, CED-12) has an ELMO domain (amino acids 391 to 492), a pleckstrin homology (PH) domain (amino acids 555 to 676), and a Pro-rich SH3-binding motif (amino acids 707 to 714) (Figure 5). Amino acids 1 to 280 bind to RhoG (1), ezrin/radixin/moesin (ERM) proteins (2), and Salmonella IpgB1 (3). The function of the ELMO domain is unknown. PH domains domains bind proteins such as the beta/gamma subunits of heterotrimeric G proteins and protein kinase C as well as phosphatidylinositol within biological membranes. PH domains recruit proteins to different membranes, thus targeting them to appropriate cellular compartments or enabling them to interact with other components of the signal transduction pathways. The ELMO and PH domains as well as the SH3-binding motif as well as an α-helical extension of the PH domain mediate the interaction with DOCK180 (4-6).

 

The debil mutation results in a leucine to proline substitution at position 424 (L424P) in the ELMO1 protein; residue 424 is within the ELMO domain. 

 

Please see the record Edinburg for more information about Elmo1.

Putative Mechanism

ELMO1 is an adaptor protein that interacts with members of the DOCK family (see the records frazz, moonlight, and snowdrop for information about DOCK2, DOCK7, and DOCK8, respectively) to promote the activation of the small GTPase RAC, phagocytosis, and cell migration (7-10).

 

ELMO1 functions downstream of the phagocytic receptor BAI1 (see the record for bunting) during apoptotic cell clearance (11;12).  BAI1 functions in the recognition and subsequent internalization of apoptotic cells (12). In macrophages, BAI1 functions as a pattern recognition receptor in the phagocytic uptake of Gram-negative bacteria (12). BAI1 interacts with ELMO1, which subsequently activates DOCK180 (13).

 

ELMO1 functions in G-protein coupled receptor (GPCR)-mediated chemotaxis upon stimulation of CXCR4 and CCR7 (see the record for lanzhou) (14-16). CD4+ T cells from Elmo1-deficient (Elmo1^-/-) mice exhibited impaired polarization, Rac activation, and chemotaxis in response to CCR7 and CXCR4 stimulation (15;16). GPCRs couple with a heterotrimeric G protein to mediate its downstream effects. G proteins, which consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex. Activation of chemokine receptors promotes an interaction between ELMO1 and Gβγ, which causes translocation of ELMO1 to the membrane. ELMO1/DOCK180 or ELMO1/DOCK2 subsequently activate Rac1.

 

ELMO1 interacts with ERM proteins (2), which function in cell migration, cell adhesion, cell shape maintenance, and microvilli formation by cross-linking the plasma membrane with the actin cytoskeleton. ERM proteins are involved in cell cortex organization at two important stages of T lymphocyte physiology: during the polarization and migration in response to chemokines, and during the formation of the immunological synapse upon antigen recognition.

 

Elmo1-deficient (Elmo1^-/-; Elmo1^{tm1.2Ravi/tm1.2Ravi}) mice are overtly normal (11). Elmo1^-/- mice exhibited disrupted seminiferous epithelium, multinucleated giant cells, uncleared apoptotic germ cells, and decreased sperm output (11). A second Elmo1^-/- mouse model (Elmo1^{tm1a(EUCOMM)Wtsi/tm1a(EUCOMM)Wtsi}) exhibited reduced numbers of mature B cells, natural killer T cells, and CD4+ CD25+ regulatory T cells with concomitant increased numbers of effector memory CD4+ T cells. Some mice also exhibited decreased fasted circulating glucose levels.

 

The phenotype of the debil mice indicate loss of ELMO1-associated function.

Primers

PCR Primer
Debil_pcr_F: ATCAAAGTCTGTGTTCTCTGTGTTC
Debil_pcr_R: ATGTAGGAAACCCGAGCCAG

Sequencing Primer
Debil_seq_F: AGAGGCTGTCGTGATCCACTTTAC
Debil_seq_R: CCCGAGCCAGAGAAGGGAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 413 nucleotides is amplified (chromosome 13, + strand):

1   atcaaagtct gtgttctctg tgttctattt agccataggt ggaggatgac ccagaggctg
61  tcgtgatcca ctttacgtct ttctttggag cgagcctgga gccttctgtg tctgggcaca
121 ctccctttcc tgaccgatcc ctcttctctc cacagatcgt gctagagaac agcagccgag
181 aagataaaca tgagtgcccc ttcggccgca gcagtataga gctgaccaag atgctgtgtg
241 agatcctcaa agtgggcgag ctgcgtgagt actcgtgtag atgccccgtg ggtgcagagt
301 ttagcagacc ctcagcttcc aaggttgaac ccccacctct gtgtccaatt cagagcactt
361 agaccttcac atcccttcat tatggtccct tctctggctc gggtttccta cat

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Katoh, H., and Negishi, M. (2003) RhoG Activates Rac1 by Direct Interaction with the Dock180-Binding Protein Elmo. Nature. 424, 461-464.

  2. Grimsley, C. M., Lu, M., Haney, L. B., Kinchen, J. M., and Ravichandran, K. S. (2006) Characterization of a Novel Interaction between ELMO1 and ERM Proteins. J Biol Chem. 281, 5928-5937.

  3. Handa, Y., Suzuki, M., Ohya, K., Iwai, H., Ishijima, N., Koleske, A. J., Fukui, Y., and Sasakawa, C. (2007) Shigella IpgB1 Promotes Bacterial Entry through the ELMO-Dock180 Machinery. Nat Cell Biol. 9, 121-128.

  4. Komander, D., Patel, M., Laurin, M., Fradet, N., Pelletier, A., Barford, D., and Cote, J. F. (2008) An Alpha-Helical Extension of the ELMO1 Pleckstrin Homology Domain Mediates Direct Interaction to DOCK180 and is Critical in Rac Signaling. Mol Biol Cell. 19, 4837-4851.

  5. Lu, M., Kinchen, J. M., Rossman, K. L., Grimsley, C., deBakker, C., Brugnera, E., Tosello-Trampont, A. C., Haney, L. B., Klingele, D., Sondek, J., Hengartner, M. O., and Ravichandran, K. S. (2004) PH Domain of ELMO Functions in Trans to Regulate Rac Activation Via Dock180. Nat Struct Mol Biol. 11, 756-762.

  6. Sevajol, M., Reiser, J. B., Chouquet, A., Perard, J., Ayala, I., Gans, P., Kleman, J. P., and Housset, D. (2012) The C-Terminal Polyproline-Containing Region of ELMO Contributes to an Increase in the Life-Time of the ELMO-DOCK Complex. Biochimie. 94, 823-828.

  7. Sanui, T., Inayoshi, A., Noda, M., Iwata, E., Oike, M., Sasazuki, T., and Fukui, Y. (2003) DOCK2 is Essential for Antigen-Induced Translocation of TCR and Lipid Rafts, but Not PKC-Theta and LFA-1, in T Cells. Immunity. 19, 119-129.

  8. Grimsley, C. M., Kinchen, J. M., Tosello-Trampont, A. C., Brugnera, E., Haney, L. B., Lu, M., Chen, Q., Klingele, D., Hengartner, M. O., and Ravichandran, K. S. (2004) Dock180 and ELMO1 Proteins Cooperate to Promote Evolutionarily Conserved Rac-Dependent Cell Migration. J Biol Chem. 279, 6087-6097.

  9. Hiramoto, K., Negishi, M., and Katoh, H. (2006) Dock4 is Regulated by RhoG and Promotes Rac-Dependent Cell Migration. Exp Cell Res. 312, 4205-4216.

  10. Komander, D., Patel, M., Laurin, M., Fradet, N., Pelletier, A., Barford, D., and Cote, J. F. (2008) An Alpha-Helical Extension of the ELMO1 Pleckstrin Homology Domain Mediates Direct Interaction to DOCK180 and is Critical in Rac Signaling. Mol Biol Cell. 19, 4837-4851.

  11. Elliott, M. R., Zheng, S., Park, D., Woodson, R. I., Reardon, M. A., Juncadella, I. J., Kinchen, J. M., Zhang, J., Lysiak, J. J., and Ravichandran, K. S. (2010) Unexpected Requirement for ELMO1 in Clearance of Apoptotic Germ Cells in Vivo. Nature. 467, 333-337.

  12. Park, D., Tosello-Trampont, A. C., Elliott, M. R., Lu, M., Haney, L. B., Ma, Z., Klibanov, A. L., Mandell, J. W., and Ravichandran, K. S. (2007) BAI1 is an Engulfment Receptor for Apoptotic Cells Upstream of the ELMO/Dock180/Rac Module. Nature. 450, 430-434.

  13. Lu, M., and Ravichandran, K. S. (2006) Dock180-ELMO Cooperation in Rac Activation. Methods Enzymol. 406, 388-402.

  14. Wang, Y., Xu, X., Pan, M., and Jin, T. (2016) ELMO1 Directly Interacts with Gbetagamma Subunit to Transduce GPCR Signaling to Rac1 Activation in Chemotaxis. J Cancer. 7, 973-983.

  15. Stevenson, C., de la Rosa, G., Anderson, C. S., Murphy, P. S., Capece, T., Kim, M., and Elliott, M. R. (2014) Essential Role of Elmo1 in Dock2-Dependent Lymphocyte Migration. J Immunol. 192, 6062-6070.

  16. Sanui, T., Inayoshi, A., Noda, M., Iwata, E., Stein, J. V., Sasazuki, T., and Fukui, Y. (2003) DOCK2 Regulates Rac Activation and Cytoskeletal Reorganization through Interaction with ELMO1. Blood. 102, 2948-2950.