Phenotypic Mutation 'cpg7' (pdf version)
Allelecpg7
Mutation Type missense
Chromosome9
Coordinate106,225,349 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Tlr9
Gene Name toll-like receptor 9
Chromosomal Location 106,222,598-106,226,883 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_031178; MGI: 1932389

MappedYes 
Amino Acid Change Arginine changed to Leucine
Institutional SourceBeutler Lab
Gene Model not available
AlphaFold Q9EQU3
PDB Structure Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: R613L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 333 361 8e-6 BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 4e-11 BLAST
Pfam:TIR 870 1029 7.4e-11 PFAM
Predicted Effect probably benign

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
(Using ENSMUST00000062241)
Meta Mutation Damage Score Not available question?
Is this an essential gene? Probably nonessential (E-score: 0.103) question?
Phenotypic Category Autosomal Semidominant
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(1) Gene trapped(1) Chemically induced(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 1.00
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.90
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 1.00
IGL02851:Tlr9 APN 9 106224730 nonsense probably null
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 1.00
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
Meager UTSW 9 106224139 missense probably damaging 1.00
PIT4498001:Tlr9 UTSW 9 106223522 missense probably benign 0.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.01
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign
R1940:Tlr9 UTSW 9 106224647 missense probably damaging 1.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.47
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 critical splice donor site probably null
R6393:Tlr9 UTSW 9 106224937 missense probably damaging 1.00
R6397:Tlr9 UTSW 9 106225106 missense probably damaging 1.00
R6455:Tlr9 UTSW 9 106223999 missense probably damaging 1.00
R7385:Tlr9 UTSW 9 106225264 missense probably damaging 1.00
R7455:Tlr9 UTSW 9 106224530 missense probably benign 0.00
R7561:Tlr9 UTSW 9 106225949 missense probably benign 0.00
R8889:Tlr9 UTSW 9 106222635 start gained probably benign
R8892:Tlr9 UTSW 9 106222635 start gained probably benign
R8926:Tlr9 UTSW 9 106226014 missense probably benign
R9221:Tlr9 UTSW 9 106224773 missense probably damaging 1.00
R9228:Tlr9 UTSW 9 106225553 missense possibly damaging 0.49
R9581:Tlr9 UTSW 9 106224311 missense probably damaging 1.00
R9689:Tlr9 UTSW 9 106223522 missense probably benign 0.00
R9697:Tlr9 UTSW 9 106223524 nonsense probably null
R9788:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
Z1176:Tlr9 UTSW 9 106223663 missense probably benign 0.03
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm, gDNA
MMRRC Submission 031919-UCD
Last Updated 2019-04-01 11:22 AM by Stephen Lyon
Record Created unknown
Record Posted 2009-11-09
Phenotypic Description

 
The Liesgen or CpG7 mouse was found among ENU-mutagenized G3 mice during a screen to identify mutants susceptible  to low doses of dextran sodium sulfate (DSS)-induced colitis (DSS-induced Colitis Screen).  The screen uses weight loss as an indication of colitis.  The Liesgen mouse showed severe bleeding and increased weight loss relative to wild type C57BL/6J mice on day 4 and day 5 of DSS exposure (17% at day 5; Figure 1), and died on day 5.     
 
Peritoneal macrophages from CpG7 mice produce normal amounts of tumor necrosis factor (TNF)-α in response to all toll-like receptors (TLRs) tested, except oligodeoxynucleotides containing CpG motifs (CpG ODN), which are recognized by TLR9 (TLR Signaling Screen).   Because the causal mutation is in Tlr9 (see below), the mutation is now known as CpG7.
Nature of Mutation
The CpG7 mouse genome was sequenced using the SOLiD technique, and a G to T transversion was identified at position 1944 of the Tlr9 transcript on Chromosome 9, in exon 2 of 2 total exons. The mutation has been confirmed by DNA sequencing using the Sanger method (Figure 2).
 
1928 GGCAACGGTATGGGCCGCATGTGGGATGAGGGG
608  -G--N--G--M--G--R--M--W--D--E--G-
 
The mutated nucleotide is indicated in red lettering, and results in conversion of an arginine to a leucine at residue 613 of the TLR9 protein.
Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 3. Protein and domain structure of TLR9. (A) Schematic representation of TLR9 based on crystalized structures of mouse TLR9 LRR (PBD 3WPF) and human TLR2 TIR (1FYW) domains. The residue affected by the CpG7 mutation is highlighted. 3D image was created using UCSF Chimera. (B) TLR9 is a 1032 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane (TM) domain (blue) and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain (green). The CpG7 mutation (red asterisk) results in an arginine to a leucine substitution at residue 613 of the TLR9 protein in the predicted twentieth LRR. This image is interactive. Click on the image to view other mutations found in TLR9. Click on each mutation for more specific information.
The arginine residue in TLR9 altered due to the CpG7 mutation is located in the twentieth leucine rich repeat (LRR) in the TLR9 ectodomain (Figure 3). TLR9 has twenty-five such repeats.  It is unknown if normal levels of the altered protein are expressed, but the substitution of a neutral amino acid for a polar residue may affect the characteristic structure of the LRR and disrupt the normal sensing of CpG DNA by TLR9.  
 

Please see the record for CpG1 for information about Tlr9.

Primers Primers cannot be located by automatic search.
Genotyping
CpG7 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.   
 
Primers for PCR amplification
CpG7(F): 5’- TTCAACGCTGTCAGAAGCCACC -3’
CpG7 (R): 5’- ACAGTAAGTCTACGAAGGCTGCCC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
CpG7_seq (F): 5’- GTCCATGCTACAGAGCCTTAG -3’
CpG7_seq(R): 5’- GAGACGATACTGTTGCTACTGAC -3’
 
The following sequence of 1037 nucleotides (from Genbank genomic region NC_000075 for linear genomic sequence of Tlr9) is amplified: 
 
2204                                                ttcaacg ctgtcagaag
2221 ccacccctga agaggcagat gatgcagagc aggaggagct gttgtctgcg gatcctcacc
2281 cagctccgct gagcacccct gcttctaaga acttcatgga caggtgtaag aacttcaagt
2341 tcaccatgga cctgtctcgg aacaacctgg tgactatcaa gccagagatg tttgtcaatc
2401 tctcacgcct ccagtgtctt agcctgagcc acaactccat tgcacaggct gtcaatggct
2461 ctcagttcct gccgctgact aatctgcagg tgctggacct gtcccataac aaactggact
2521 tgtaccactg gaaatcgttc agtgagctac cacagttgca ggccctggac ctgagctaca
2581 acagccagcc ctttagcatg aagggtatag gccacaattt cagttttgtg acccatctgt
2641 ccatgctaca gagccttagc ctggcacaca atgacattca tacccgtgtg tcctcacatc
2701 tcaacagcaa ctcagtgagg tttcttgact tcagcggcaa cggtatgggc cgcatgtggg
2761 atgagggggg cctttatctc catttcttcc aaggcctgag tggcctgctg aagctggacc
2821 tgtctcaaaa taacctgcat atcctccggc cccagaacct tgacaacctc cccaagagcc
2881 tgaagctgct gagcctccga gacaactacc tatctttctt taactggacc agtctgtcct
2941 tcctacccaa cctggaagtc ctagacctgg caggcaacca gctaaaggcc ctgaccaatg
3001 gcaccctgcc taatggcacc ctcctccaga aactcgatgt cagtagcaac agtatcgtct
3061 ctgtggtccc agccttcttc gctctggcgg tcgagctgaa agaggtcaac ctcagccaca
3121 acattctcaa gacggtggat cgctcctggt ttgggcccat tgtgatgaac ctgacagttc
3181 tagacgtgag aagcaaccct ctgcactgtg cctgtggggc agccttcgta gacttactgt
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsKatharina Brandl, Bruce Beutler
Edit History
2011-01-07 9:01 AM (current)
2010-12-08 3:33 PM
2010-11-08 12:07 PM
2010-08-06 10:14 AM
2010-06-23 11:34 AM
2010-06-23 11:34 AM
2010-04-29 11:22 AM
2010-02-22 8:57 AM