Phenotypic Mutation 'Pintail' (pdf version)
AllelePintail
Mutation Type missense
Chromosome19
Coordinate41,376,146 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Pik3ap1
Gene Name phosphoinositide-3-kinase adaptor protein 1
Synonym(s) BCAP, 1810044J04Rik
Chromosomal Location 41,274,218-41,385,070 bp (-)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in B cell maturation. [provided by MGI curators]
Accession Number

NCBI Refseq: NM_031376; MGI:1933177

Mapped Yes 
Amino Acid Change Tyrosine changed to Histidine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000052777]
SMART Domains Protein: ENSMUSP00000052777
Gene: ENSMUSG00000025017
AA Change: Y45H

DomainStartEndE-ValueType
DBB 180 319 8.55e-75 SMART
SCOP:d1bd8__ 331 396 8e-5 SMART
Blast:ANK 336 365 1e-7 BLAST
low complexity region 533 552 N/A INTRINSIC
low complexity region 716 740 N/A INTRINSIC
low complexity region 802 808 N/A INTRINSIC
Predicted Effect probably benign

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
(Using ENSMUST00000059672)
Meta Mutation Damage Score 0.0898 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1 cells - decreased
Candidate Explorer Status CE: excellent candidate; human score: 0; ML prob: 0.446
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) :  Chemically induced (ENU)(2) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Pik3ap1 APN 19 41375890 missense possibly damaging 0.95
IGL01697:Pik3ap1 APN 19 41324579 missense probably damaging 1.00
IGL01743:Pik3ap1 APN 19 41292828 splice site probably benign
IGL02006:Pik3ap1 APN 19 41302593 missense probably benign
IGL02507:Pik3ap1 APN 19 41282012 splice site probably benign
IGL02601:Pik3ap1 APN 19 41302442 missense probably benign 0.08
Canvasback UTSW 19 41321630 missense possibly damaging 0.80
sooni UTSW 19 41327909 missense probably damaging 1.00
sothe UTSW 19 41356683 intron probably benign
FR4449:Pik3ap1 UTSW 19 41281946 small insertion probably benign
FR4548:Pik3ap1 UTSW 19 41281945 small insertion probably benign
FR4976:Pik3ap1 UTSW 19 41281945 small insertion probably benign
R0504:Pik3ap1 UTSW 19 41287490 missense probably damaging 1.00
R0505:Pik3ap1 UTSW 19 41324564 missense probably damaging 1.00
R0736:Pik3ap1 UTSW 19 41332319 missense possibly damaging 0.56
R0926:Pik3ap1 UTSW 19 41302525 missense probably benign 0.00
R1521:Pik3ap1 UTSW 19 41321558 missense probably damaging 1.00
R1681:Pik3ap1 UTSW 19 41308529 missense probably damaging 1.00
R1779:Pik3ap1 UTSW 19 41332234 missense probably damaging 1.00
R1924:Pik3ap1 UTSW 19 41302614 missense possibly damaging 0.79
R1945:Pik3ap1 UTSW 19 41274337 missense probably benign
R2327:Pik3ap1 UTSW 19 41296389 missense probably damaging 0.99
R2891:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2892:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2893:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2894:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2918:Pik3ap1 UTSW 19 41302531 missense probably benign 0.00
R4424:Pik3ap1 UTSW 19 41375881 missense probably benign 0.00
R4654:Pik3ap1 UTSW 19 41327909 missense probably damaging 1.00
R4811:Pik3ap1 UTSW 19 41302497 missense possibly damaging 0.67
R4855:Pik3ap1 UTSW 19 41327845 missense probably benign 0.13
R4885:Pik3ap1 UTSW 19 41375926 missense probably benign 0.28
R5119:Pik3ap1 UTSW 19 41281976 missense probably benign 0.18
R5261:Pik3ap1 UTSW 19 41376106 missense probably damaging 1.00
R5274:Pik3ap1 UTSW 19 41281952 missense possibly damaging 0.67
R5655:Pik3ap1 UTSW 19 41298241 missense possibly damaging 0.65
R5862:Pik3ap1 UTSW 19 41332345 missense probably damaging 1.00
R5924:Pik3ap1 UTSW 19 41296456 missense probably damaging 1.00
R6015:Pik3ap1 UTSW 19 41328201 missense probably benign 0.22
R6018:Pik3ap1 UTSW 19 41385016 start gained probably benign
R6515:Pik3ap1 UTSW 19 41376146 missense probably benign 0.00
R6792:Pik3ap1 UTSW 19 41321626 missense probably benign 0.14
R7135:Pik3ap1 UTSW 19 41332321 missense probably damaging 1.00
R7162:Pik3ap1 UTSW 19 41321526 missense probably benign 0.03
R7175:Pik3ap1 UTSW 19 41287490 missense probably damaging 0.98
R7313:Pik3ap1 UTSW 19 41296376 missense possibly damaging 0.93
R7664:Pik3ap1 UTSW 19 41321630 missense possibly damaging 0.80
R7786:Pik3ap1 UTSW 19 41321585 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:32 PM by Anne Murray
Record Created 2019-01-10 7:19 PM by Bruce Beutler
Record Posted 2019-01-18
Phenotypic Description

Figure 1. Pintail mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Pintail phenotype was identified among G3 mice of the pedigree R6515, some of which showed reduced frequencies of B1 cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced B1 cell frequency using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 44 mutations (X-axis) identified in the G1 male of pedigree R6515. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 44 mutations. The diminished B1 cell frequency phenotype was linked to a mutation in Pik3ap1: a T to C transition at base pair 41,376,146 (v38) on chromosome 19, or base pair 8,925 in the GenBank genomic region NC_000085 encoding Pik3ap1. Linkage was found with a dominant model of inheritance, wherein eight variant homozygotes and 36 heterozygous mice departed phenotypically from 35 homozygous reference mice with a P value of 4.565 x 10-12 (Figure 2).

 

The mutation corresponds to residue 303 in the NM_031376 mRNA sequence in exon 2 of 17 total exons. 

 
288 CAGAAGACGCAGACATACCGGCTGGTCCCGGAT

40  -Q--K--T--Q--T--Y--R--L--V--P--D-

 

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine to histidine substitution at position 45 (Y45H) in the B cell adaptor protein (BCAP) protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.003).

Protein Prediction

Figure 3. The domain structure of BCAP.  BCAP has a Dof/BCAP/BANK (DBB) domain (aa 182-318), an ankyrin repeat-like sequence (aa 333-401), a coiled-coil sequence (aa 636-669), and proline-rich sequences (aa 530-552, 760-808). Tyrosines within YxNx (Y387), YxxV (Y513) and YxxM (Y264, Y420, Y445 and Y460) sequences are phosphorylated upon B-cell receptor activation and facilitate the binding of BCAP to Grb2, SHP-2 and BTK/Syk, respectively. The Pintail mutation results in a tyrosine to histidine substitution at position 45 (Y45H). This image is interactive. Other mutations found in BCAP are noted in red. Click on each mutation for more information.

BCAP shares several structural features with other adaptor proteins including BANK (B-cell scaffold protein with ankyrin repeats), an adaptor for CD40, a protein present on antigen presenting cells (see walla, a mutation in CD40 ligand) and with the Drosophila protein Dof (Downstream of FGF receptor), an adaptor that is essential in FGF-mediated signaling (1;2). The domains of BCAP include:  an ankyrin repeat-like sequence (aa 333-401), a predicted coiled-coil forming sequence (aa 636-669), proline-rich sequences (3 in mouse; aa 530-552, 760-808) and a region designated the Dof/BCAP/BANK (DBB) domain (aa 182-318) (3-6) (Figure 3). The proline-rich region at the C-terminus of BCAP facilitates interaction between BCAP and the N-terminal SH3 domains of Src protein tyrosine kinases (PTKs), PLC-γ, and Grb2 (7). Tyrosine motifs (YxNx, YxxV, and YxxM) facilitate the binding of BCAP to Grb2, SHP-2 and BTK/Syk, respectively.  Following B cell activation, BCAP is phosphorylated at four tyrosine residues (Y264, Y420, Y445 and Y460) within 4 respective YxxM motifs by BTK and Syk activation (3;8;9)

 

The Pintail mutation results in a tyrosine to histidine substitution at position 45 (Y45H) in the BCAP protein; Tyr45 is within an undefined region of BCAP.

 

For more information about Pik3ap1, please see the record for sothe.

Putative Mechanism

In B cell receptor (BCR)-mediated signaling, either transmembrane (i.e. CD19) or cytosolic adaptors (i.e. TC21, Cbl, Gab, B-cell linker (BLNK (see busy) or SLP-65), and BCAP are tyrosine phosphorylated on their YxxM motifs by protein tyrosine kinases (i.e. Btk, Syk and/or Lyn) and subsequently associate with PI3K to amplify and integrate several signaling pathways (6;7;10-13).  Upon activation of BCR-mediated signaling, Syk initiates BCAP phosphorylation, while Btk sustains it.  Lyn negatively regulates BCAP phosphorylation by initiating the phosphorylation of immunoreceptor tyrosine-based inhibition motifs (ITIMS) on inhibitory receptor proteins CD22 and PIRB (7;14).  BCAP and CD19 have a complementary role in P13K activation:  upon BCAP binding to PI3K, there is an upregulation in PI3K activity and PI3K translocates to CD19-bearing lipid rafts rich in PI(4,5)P2 (15;16).  Upon an induction of BCR-mediated signaling, there is a concomitant stimulation of growth arrest and apoptosis in immature B cells with a promotion of survival and proliferation of mature B cells (13). Phosphorylated PI3K-associated adaptor proteins, including BCAP, recruit enzymes such as phospholipase C-gamma 2 (PLC-γ2) (see queen) and PI3K to facilitate B-cell proliferation, differentiation and activation via the PI3K pathway (6;7;12;17). It has been proposed that BCAP can mediate PI3K activation in two ways:  (i) PI3K-BCAP binding upregulates PI3K enzymatic activity, or (ii) BCAP is associated with a CD19-mediated translocation of PI3K (9).  This study also suggested that there is another unidentified molecule that can assist in the translocation of PI3K upon BCR activation (9). BCAP deficient mature splenic B cells undergo activation-induced apoptosis more readily than cells that express BCAP (5;9;10;13).  After B cell receptor engagement in the BCAP deficient B cells, expression of cell survival molecules (i.e. Bcl-xL) was not induced (5).  Furthermore, maturation and/or survival of a B cell subset (peritoneal B1) was not promoted; marginal zone (MZ) B cell numbers were similar to wild-type (6).

 

The phenotype observed in the Pintail mice indicates loss of BCAP-associated function in B cell survival.

Primers PCR Primer
Pintail_pcr_F: GAAAGAAGGCCTGGAAGTCCTC
Pintail_pcr_R: TTTCAGAGAGCCTCCTAGAAGG

Sequencing Primer
Pintail_seq_F: TGGAAGTCCTCGTCGCCTG
Pintail_seq_R: CATCTTCTACAGCCCAGA
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 402 nucleotides is amplified (chromosome 19, - strand):


1   tttcagagag cctcctagaa ggagcaggca ttaatgagct tttttttttc tgtgtctctc
61  atgcagggtg gggccgggga tgcgacatcc tcatcttcta cagcccagat gcggaggaat
121 ggtgtcagta cctacaggat cttttcgtgt cctgccggca ggttcgtagc cagaagacgc
181 agacataccg gctggtcccg gatgcctctt tctctgccca ggacctgtgg gtcttcaggg
241 atgcgcgatg cgtgctggtg ctactgtcgg cggggctggt aggatgcttc ggccagccag
301 gactgctgcc aatgctgcag cgtgcctgcc atccgccgca gcgtgtggtg cggctgttgt
361 gtggagtgca gccaggcgac gaggacttcc aggccttctt tc


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Xue Zhong, and Bruce Beutler