Phenotypic Mutation 'Amun-ra'

• Allele: Amun-ra
• Mutation Type: nonsense
• Chromosome: 11
• Coordinate: 23,707,026 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Rel
• Gene Name: reticuloendotheliosis oncogene
• Synonym(s): c-Rel
• Chromosomal Location: 23,686,847-23,720,969 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rel homology domain/immunoglobulin-like fold, plexin, transcription factor (RHD/IPT) family. Members of this family regulate genes involved in apoptosis, inflammation, the immune response, and oncogenic processes. This proto-oncogene plays a role in the survival and proliferation of B lymphocytes. Mutation or amplification of this gene is associated with B-cell lymphomas, including Hodgkin's lymphoma. Single nucleotide polymorphisms in this gene are associated with susceptibility to ulcerative colitis and rheumatoid arthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014] ; PHENOTYPE: Homozygous inactivation of this gene causes defects in lymphocyte proliferation, humoral immunity and cytokine production, and may lead to impaired Th1 responses and resistance to autoimmune disease. Mice lacking only the COOH-terminal region show severehemopoietic defects and lymphoid hyperplasia. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glycine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000099928]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000099928; Gene: ENSMUSG00000020275; AA Change: G59*

Domain	Start	End	E-Value	Type
Pfam:RHD_DNA_bind	10	178	8.1e-78	PFAM
IPT	185	280	7.64e-24	SMART
low complexity region	512	530	N/A	INTRINSIC

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:31 PM by Bruce Beutler
• Record Created: 2019-01-17 11:55 AM by Bruce Beutler
• Record Posted: 2019-02-08
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_009044; MGI:97897

Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (ENU)(1)  Chemically induced (other)(1) Targeted(6)

Phenotypic Description

Figure 1. Amun-ra mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Amun-ra mice exhibit decreased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Amun-ra mice exhibit decreased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Amun-ra mice exhibit decreased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Amun-ra mice exhibit decreased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Amun-ra mice exhibit reduced CD44 expression on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Amun-ra mice exhibit reduced CD44 expression on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Amun-ra phenotype was identified among G3 mice of the pedigree R6562, some of which showed reduced frequencies of B1 cells (Figure 1), central memory CD4 T cells in CD4 T cells (Figure 2), effector memory CD4 T cells in CD4 T cells (Figure 3), CD44+ T cells (Figure 4), and CD44+ CD4 T cells (Figure 5). Expression of CD44 was reduced on peripheral blood T cells (Figure 6) and CD4+ T cells (Figure 7).

Nature of Mutation

Figure 8. Linkage mapping of the reduced CD44+ CD4 mean fluorescence intensity (MFI) using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 60 mutations (X-axis) identified in the G1 male of pedigree R6562. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 60 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 11: Cnrip1 and Rel. The mutation in Rel is presumed causative as the immune phenotypes observed in Amun-ra mice mimic those of other Rel mutant mouse models. The Rel mutation is a G to T transversion at base pair 23,757,026 (v38) on chromosome 11, or base pair 13,945 in the GenBank genomic region NC_000077.  The strongest association was found with an additive model of inheritance to the normalized CD44+ CD4 mean fluorescence intensity (MFI), wherein eight variant homozygotes and 19 heterozygous mice departed phenotypically from 12 homozygous reference mice with a P value of 2.755 x 10^-9 (Figure 8).  

The mutation corresponds to residue 456 in the mRNA sequence NM_009044 within exon 3 of 10 total exons.

441 AACTACTATGGAAAAGGAAAAATAAGAATTACA 54  -N--Y--Y--G--K--G--K--I--R--I--T-

The mutated nucleotide is indicated in red. The mutation results in substitution of glycine 59 for a premature stop codon (G59*) in the c-Rel protein.

Protein Prediction

Figure 9. The domain organization of c-Rel. The location of the Amun-ra mutation is indicated. c-Rel has a Rel-homology domain (RHD), which includes a DNA binding domain and a dimerization domain (DimD). The nuclear localization sequence (NLS) is indicated. The transactivation domain (TAD) has two subdomains: I and II. This image is interactive; click on the other mutations to view additional information.

Rel encodes c-Rel, a member of the NF-κB family of transcription factors, which also includes RelA (p65), RelB, NF-κB1 (p105/p50; see the record for Finlay), and NF-κB2 (p100/p52; see the record for xander). The NF-κB protein family members are characterized by the presence of an N-terminal Rel homology domain (RHD) (Figure 9). The RHD (amino acids 8-297, UniProt) is comprised of the N-terminal domain, the dimerization domain (DimD), and a nuclear localization sequence (amino acids 291-296) that mediate sequence-specific DNA binding, nuclear localization, interaction with IκB, and homo- and heterodimerization [reviewed in (1)]. RelA, RelB, and c-Rel have a transactivation domain (TAD) that allows for direct control of transcription (2). Within the TAD are two subdomains: subdomains I and II at amino acids 424-490 and 518-587, respectively. A Rel inhibitory domain (RID) acts as a hinge between the RHD and TAD.

The Amun-ra mutation results in substitution of glycine 59 for a premature stop codon (G59*) in the c-Rel protein.

Please see the record horus for more information about Rel.

Putative Mechanism

NF-κB controls the proliferation, differentiation and survival of B and T cells. In the nucleus, NF-κB acts as a transcription factor that regulates the expression of genes encoding a variety of immune response genes including pro-inflammatory cytokines (e.g., TNFα (see the record for PanR1), IL-1, and IL-6), chemokines [e.g., MIP-1α (macrophage inflammatory protein-1α), and RANTES (regulated upon activation, normal T-cell expressed and secreted)], cell adhesion molecules [e.g., E-selectin and VCAM-1 (vascular cell adhesion molecule-1)], effector molecules [e.g., defensins], enzymes [e.g., inducible nitric oxide synthase], and growth factors to regulate the recruitment of immune cells to the site of infection [(3;4); reviewed in (5)]. Inhibition of NF-κB leads to apoptosis [through the misregulation of anti-apoptotic proteins (e.g., c-IAP-1/2, AI, Bcl-2 and Bcl-XL)], delayed cell growth, reduced cell proliferation [through negative regulation of cell cycle regulator cyclin D1 (6)] and incorrect immune cell development [reviewed in (7-9)].

c-Rel is essential for normal B and T cell activation and proliferation. In addition, c-Rel is essential for the prevention of autoimmunity. Outside of the immune system, c-Rel maintains organ homeostasis and the cell cycle under conditions of stress or damage. In addition, it is essential for long-term memory consolidation and promotes neuronal survival upon hypoxic stress.

c-Rel is required for BCR-mediated proliferation and cell cycle progression (10). c-Rel is essential for germinal center and memory B cell differentiation as well as for anti-IgM- and LPS-induced survival and cell cycle progression (11). c-Rel mediates the proliferation, differentiation, and cytokine production of stimulated T cells (12). c-Rel is required for antigen-induced activation of mature T cells (13). However, c-Rel is not required for positive selection during T cell development or for apoptosis of T lymphocytes. c-Rel maintains the balance between Th1, Th17, and Treg cells to regulate innate immune responses (14-17).

Rel deficient (Rel^-/-) mice are overtly normal and have a structurally normal immune system (11;12). However, the Rel^-/- mice exhibited immunological defects including reduced lymphocyte proliferation and activation (18). Rel^-/- mice did not exhibit defects in the maturation of hematopoietic precursors, including B and T lymphocytes, macrophages, and neutrophils (18). The frequency of monocytes was normal (19). Rel^-/- mice display reduced expression of IL-2, IL-3, IL-6, IL-10, IL-13, IL-15, IL-21, IFNγ, MIP1α, and GM-CSF (12;19). C-Rel is required for optimal development of humoral immunity (20). After influenza virus infection, Rel^-/- mice exhibited normal levels of virus-specific cytotoxic T cells. However, they exhibited reduced T cell proliferative responses to the virus as well as diminished local and systemic influenza virus-specific antibody responses. Vaccinated mice were unable to acquire antibody-dependent protective immunity to reinfection.

Rel^-/- mice exhibit normal early lymphocyte development, but have fewer memory (IgM / IgD⁻) B cells (11). B cells from the Rel^-/- mice exhibited impaired proliferation in response to antigen receptor cross-linking and mitogenic activation (e.g., lipopolysaccharide (LPS), anti-IgM, antigen, or CD40) (18;20;21). Although the Rel^-/- B cells exhibited normal CD40-associated cell survival, the Rel^-/- B cells were unable to receive anti-IgM- or LPS-generated survival signals (11). B cells from the Rel^-/- mice were more susceptible to apoptotic stimuli (11;22;23).  In resting Rel^-/- B cells, BCR stimulation did not induce proper cyclin D3 and cyclin E expression, subsequently negatively regulating G1 cyclin-dependent kinase activity. The Rel^-/- B cells were able to exit the G0 phase and enter the G1 phase phases after stimulation with anti-IgM or LPS, but transition from the G1 to S phase was impaired (11;24). In addition, the proliferation defects in the Rel^-/- B cells were attributed to a loss of c-Rel binding to the pro-proliferative protein IRF-4 (25). C-Rel was also found to control the expression of the anti-apoptotic protein, Bcl-2, and of A1, a homolog of Bcl-2, leading to increased rates of apoptosis in the Rel^-/- B cells (22;24).  Rel^-/- mice have irregular germinal centers (GCs) and a reduced frequency of marginal zone B cells (26;27). The Rel^-/- mice establish fewer B cells with a germinal center (PNA^hi) phenotype after immunization (11).

The phenotypes observed in the Amun-ra mice indicate loss of c-Rel-associated function in B and T cells.

Primers

PCR Primer
Amun-ra_pcr_F: TCTACTAACTATCATGTGCGTACC
Amun-ra_pcr_R: CCCAGCTGATATATTCTCTGAAAAC

Sequencing Primer
Amun-ra_seq_F: GAGTTTAATCCTCAGGGTCCACG
Amun-ra_seq_R: TCTCAAGTAAACTGCTGACTATTTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 780 nucleotides is amplified (chromosome 11, - strand):

1   cccagctgat atattctctg aaaactttaa tctcaagtaa actgctgact atttgaattt
61  tattgcatgc tgactacatt atataaattg aacttaaatt aatggatcaa ttctttttat
121 ttgtttgctt tttaaaaggg gcattattgt aggtagccct ggctggcctt gaacttgtgc
181 tgatcctgct cagccttcca aatgctgggg ctataggcat atgctacaat acctacctat
241 tgttaacaag atatacatac agactgtata tttaatttcc cttttcagat tatgaactac
301 tatggaaaag gaaaaataag aattacatta gtaacaaaga atgatccata taagcctcat
361 cctcatgatt tagttggaaa agattgcaga gatggatact atgaagcaga atttggacca
421 gaacgcagac ctttgttgta agtatacagt gacagaaacc ttcagcaata ggacaaagat
481 ataattttag tttatagcaa aataattctg tatttaactt actgtaacat gtacattaca
541 ttttaattac actttgttac ctgtggggag gacacacgtg cttggggtgc atgtggaggt
601 cagagttggc tcagctggtg gagtcggttc tcttctccac cacgtggacc ctgaggatta
661 aactcaggtt gccagacacc tttacccact gagccatctc accaacctga tattaaaatt
721 tttgttctta ccacttgcat tcatccttta ttaataggta cgcacatgat agttagtaga 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Pereira, S. G., and Oakley, F. (2008) Nuclear Factor-kappaB1: Regulation and Function. Int J Biochem Cell Biol. 40, 1425-1430.

  2. Bull, P., Morley, K. L., Hoekstra, M. F., Hunter, T., and Verma, I. M. (1990) The Mouse c-Rel Protein has an N-Terminal Regulatory Domain and a C-Terminal Transcriptional Transactivation Domain. Mol Cell Biol. 10, 5473-5485.

  3. Chen, F., Castranova, V., Shi, X., and Demers, L. M. (1999) New Insights into the Role of Nuclear Factor-kappaB, a Ubiquitous Transcription Factor in the Initiation of Diseases. Clin Chem. 45, 7-17.

  4. Zhang, G., and Ghosh, S. (2001) Toll-Like Receptor-Mediated NF-kappaB Activation: A Phylogenetically Conserved Paradigm in Innate Immunity. J Clin Invest. 107, 13-19.

  5. Beinke, S., and Ley, S. C. (2004) Functions of NF-kappaB1 and NF-kappaB2 in Immune Cell Biology. Biochem J. 382, 393-409.

  6. Nakamura, Y., Grumont, R. J., and Gerondakis, S. (2002) NF-kappaB1 can Inhibit v-Abl-Induced Lymphoid Transformation by Functioning as a Negative Regulator of Cyclin D1 Expression. Mol Cell Biol. 22, 5563-5574.

  7. Karin, M., and Lin, A. (2002) NF-kappaB at the Crossroads of Life and Death. Nat Immunol. 3, 221-227.

  8. Barnes, P. J. (1997) Nuclear Factor-Kappa B. Int J Biochem Cell Biol. 29, 867-870.

  9. Barnes, P. J., and Karin, M. (1997) Nuclear Factor-kappaB: A Pivotal Transcription Factor in Chronic Inflammatory Diseases. N Engl J Med. 336, 1066-1071.

  10. Hsia, C. Y., Cheng, S., Owyang, A. M., Dowdy, S. F., and Liou, H. C. (2002) C-Rel Regulation of the Cell Cycle in Primary Mouse B Lymphocytes. Int Immunol. 14, 905-916.

  11. Tumang, J. R., Owyang, A., Andjelic, S., Jin, Z., Hardy, R. R., Liou, M. L., and Liou, H. C. (1998) C-Rel is Essential for B Lymphocyte Survival and Cell Cycle Progression. Eur J Immunol. 28, 4299-4312.

  12. Liou, H. C., Jin, Z., Tumang, J., Andjelic, S., Smith, K. A., and Liou, M. L. (1999) C-Rel is Crucial for Lymphocyte Proliferation but Dispensable for T Cell Effector Function. Int Immunol. 11, 361-371.

  13. Strasser, A., Grumont, R. J., Stanley, M. L., and Gerondakis, S. (1999) The Transcriptional Regulator Rel is Essential for Antigen Receptor-Mediated Stimulation of Mature T Cells but Dispensable for Positive and Negative Selection of Thymocytes and T Cell Apoptosis. Eur J Immunol. 29, 928-935.

  14. Grigoriadis, G., Vasanthakumar, A., Banerjee, A., Grumont, R., Overall, S., Gleeson, P., Shannon, F., and Gerondakis, S. (2011) C-Rel Controls Multiple Discrete Steps in the Thymic Development of Foxp3+ CD4 Regulatory T Cells. PLoS One. 6, e26851.

  15. Visekruna, A., Huber, M., Hellhund, A., Bothur, E., Reinhard, K., Bollig, N., Schmidt, N., Joeris, T., Lohoff, M., and Steinhoff, U. (2010) C-Rel is Crucial for the Induction of Foxp3(+) Regulatory CD4(+) T Cells but Not T(H)17 Cells. Eur J Immunol. 40, 671-676.

  16. Deenick, E. K., Elford, A. R., Pellegrini, M., Hall, H., Mak, T. W., and Ohashi, P. S. (2010) C-Rel but Not NF-kappaB1 is Important for T Regulatory Cell Development. Eur J Immunol. 40, 677-681.

  17. Isomura, I., Palmer, S., Grumont, R. J., Bunting, K., Hoyne, G., Wilkinson, N., Banerjee, A., Proietto, A., Gugasyan, R., Wu, L., McNally, A., Steptoe, R. J., Thomas, R., Shannon, M. F., and Gerondakis, S. (2009) C-Rel is Required for the Development of Thymic Foxp3+ CD4 Regulatory T Cells. J Exp Med. 206, 3001-3014.

  18. Kontgen, F., Grumont, R. J., Strasser, A., Metcalf, D., Li, R., Tarlinton, D., and Gerondakis, S. (1995) Mice Lacking the c-Rel Proto-Oncogene Exhibit Defects in Lymphocyte Proliferation, Humoral Immunity, and Interleukin-2 Expression. Genes Dev. 9, 1965-1977.

  19. Grigoriadis, G., Zhan, Y., Grumont, R. J., Metcalf, D., Handman, E., Cheers, C., and Gerondakis, S. (1996) The Rel Subunit of NF-kappaB-Like Transcription Factors is a Positive and Negative Regulator of Macrophage Gene Expression: Distinct Roles for Rel in Different Macrophage Populations. EMBO J. 15, 7099-7107.

  20. Harling-McNabb, L., Deliyannis, G., Jackson, D. C., Gerondakis, S., Grigoriadis, G., and Brown, L. E. (1999) Mice Lacking the Transcription Factor Subunit Rel can Clear an Influenza Infection and have Functional Anti-Viral Cytotoxic T Cells but do Not Develop an Optimal Antibody Response. Int Immunol. 11, 1431-1439.

  21. Tumang, J. R., Hsia, C. Y., Tian, W., Bromberg, J. F., and Liou, H. C. (2002) IL-6 Rescues the Hyporesponsiveness of c-Rel Deficient B Cells Independent of Bcl-xL, Mcl-1, and Bcl-2. Cell Immunol. 217, 47-57.

  22. Grumont, R. J., Rourke, I. J., and Gerondakis, S. (1999) Rel-Dependent Induction of A1 Transcription is Required to Protect B Cells from Antigen Receptor Ligation-Induced Apoptosis. Genes Dev. 13, 400-411.

  23. Gerondakis, S., Strasser, A., Metcalf, D., Grigoriadis, G., Scheerlinck, J. Y., and Grumont, R. J. (1996) Rel-Deficient T Cells Exhibit Defects in Production of Interleukin 3 and Granulocyte-Macrophage Colony-Stimulating Factor. Proc Natl Acad Sci U S A. 93, 3405-3409.

  24. Grumont, R. J., Rourke, I. J., O'Reilly, L. A., Strasser, A., Miyake, K., Sha, W., and Gerondakis, S. (1998) B Lymphocytes Differentially use the Rel and Nuclear Factor kappaB1 (NF-kappaB1) Transcription Factors to Regulate Cell Cycle Progression and Apoptosis in Quiescent and Mitogen-Activated Cells. J Exp Med. 187, 663-674.

  25. Gugasyan, R., Grumont, R., Grossmann, M., Nakamura, Y., Pohl, T., Nesic, D., and Gerondakis, S. (2000) Rel/NF-kappaB Transcription Factors: Key Mediators of B-Cell Activation. Immunol Rev. 176, 134-140.

  26. Cariappa, A., Liou, H. C., Horwitz, B. H., and Pillai, S. (2000) Nuclear Factor Kappa B is Required for the Development of Marginal Zone B Lymphocytes. J Exp Med. 192, 1175-1182.

  27. Heise, N., De Silva, N. S., Silva, K., Carette, A., Simonetti, G., Pasparakis, M., and Klein, U. (2014) Germinal Center B Cell Maintenance and Differentiation are Controlled by Distinct NF-kappaB Transcription Factor Subunits. J Exp Med. 211, 2103-2118.