Phenotypic Mutation 'Old_friend'

• Allele: Old_friend
• Mutation Type: missense
• Chromosome: 12
• Coordinate: 76,385,891 bp (GRCm38)
• Base Change: C ⇒ T (forward strand)
• Gene: Zbtb1
• Gene Name: zinc finger and BTB domain containing 1
• Synonym(s): C430003J21Rik
• Chromosomal Location: 76,370,266-76,396,950 bp (+)
• MGI Phenotype: PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit abnormal thymus, B cell, and T cell differentiation, and reduced numbers of T, B, and NK cells in the spleen. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Threonine changed to Isoleucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000041955]
• SMART Domains: Protein: ENSMUSP00000041955; Gene: ENSMUSG00000033454; AA Change: T217I

Domain	Start	End	E-Value	Type
BTB	24	121	1.01e-16	SMART
ZnF_C2H2	216	242	2.17e1	SMART
low complexity region	359	368	N/A	INTRINSIC
ZnF_C2H2	421	443	3.38e1	SMART
ZnF_C2H2	534	554	1.4e1	SMART
ZnF_C2H2	578	600	2.02e-1	SMART
ZnF_C2H2	606	628	6.23e-2	SMART
ZnF_C2H2	634	656	1.62e0	SMART
ZnF_C2H2	662	684	1.08e-1	SMART
ZnF_C2H2	686	709	1.36e-2	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
  (Using ENSMUST00000042779)
• Meta Mutation Damage Score: 0.2207
• Is this an essential gene?: Possibly essential (E-score: 0.742)
• Candidate Explorer Status: CE: potential candidate; Verification probability: 0.07; ML prob: 0.104; human score: 1
• Mode of Inheritance: Unknown
• Last Updated: 2019-10-23 1:57 PM by Anne Murray
• Record Created: 2019-01-21 7:50 AM by Bruce Beutler
• Record Posted: 2019-02-14
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_178744, NM_001364323; MGI: 2442326

Alleles Listed at MGI

All Mutations and Alleles(144) : Chemically induced (ENU)(1) Chemically induced (other)(1) Gene trapped(137) Targeted(5)

Phenotypic Description

Figure 1. Old_friend mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Old_friend mice exhibit increased CD44 expression on peripheral CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 mean fluorescence intensity. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The old_friend phenotype was identified among G3 mice of the pedigree R6484, some of which showed increased frequencies of central memory CD8 T cells in CD8 T cells in the peripheral blood (Figure 1) and increased CD44 expression on peripheral blood CD8+ T cells (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the increased central memory CD8 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 59 mutations (X-axis) identified in the G1 male of pedigree R6484. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 59 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Zbtb1:  a C to T transition at base pair 76,385,891 (v38) on chromosome 12, or base pair 15,700 in the GenBank genomic region NC_000078. The strongest association was found with an additive of inheritance to the normalized CD44 MFI on CD8 T cells, wherein six variant homozygotes and 15 heterozygous mice departed phenotypically from 11 homozygous reference mice with a P value of 3.039 x 10^-6 (Figure 3). A substantial semidominant effect was also observed in both of the assays, but the central memory CD8 T cell phenotype is linked more strongly using a recessive model of inheritance. 

 

The mutation corresponds to residue 877 in the mRNA sequence NM_178666 within exon 2 of 2 total exons.

 

861 TTTGGACGGAGCTTTACCTGTGATAGTTGTGGA 212 -F--G--R--S--F--T--C--D--S--C--G-

 

The mutated nucleotide is indicated in red. The mutation results in an threonine to isoleucine substitution at position 217 (T217I) in the ZBTB1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.965).

Protein Prediction

Figure 4. Domain structures of selected BTB-ZF proteins displaying N-terminal BTB domains and a variable number of C₂H₂ zinc fingers. The shaded proteins have roles in T cell development and function. The structure of LRF is very similar to that of Th-POK, while the BTB domain of ZBTB1 most closely resembles that of MIZ-1. MAZR also contains two AT hooks (not shown). Sequence numbering is for murine proteins. The amino acid altered by the old_friend mutation results in an threonine to isoleucine substitution at position 217. This image is interactive; click on an allele to view more information about other Zbtb1 mutations.

The ZBTB1 protein contains 713 amino acids and is a member of the POK (POZ and Krüppel) or BTB-ZF family of transcription factors (1). BTB-ZF family members contain a combination of two domains: an N-terminal BTB (Broad complex, Tramtrack, and Bric à brac) or POZ (Poxviruses and Zinc-finger) domain, and the C₂H₂ Krüppel -type zinc finger motif named for its resemblance to the Drosophila melanogaster segmentation protein Krüppel (Figure 4). The BTB/POZ domain contains a dimerization interface, a possible oligomerization surface, and surfaces for interactions with other factors, such as nuclear corepressors and histone deacetylases (HDACs) (2;3). Based on its protein-protein interaction abilities, a variety of functional roles have been identified for the domain, including transcriptional repression, cytoskeleton regulation, tetramerization and gating of ion channels, and protein ubiquitination/degradation (2). BTB-ZF proteins generally interact with DNA via C₂H₂-type zinc finger motifs, the most common DNA-binding motifs found in eukaryotes (4).  ZBTB1 contains eight to nine predicted C₂H₂-type zinc finger motifs according to Uniprot (Q91VL9) and analysis using SMART (Simple Modular Architecture Research Tool). In most BTB-ZF proteins, the zinc fingers are located near the C-terminus and are connected to the BTB domain by an unstructured, flexible linker domain. 

 

The old_friend mutation results in an threonine to isoleucine substitution at position 217 (T217I) within the first zinc finger motif. It is unknown if the affected protein is expressed and localized normally.

 

Please see the record scanT for more information about Zbtb1.

Putative Mechanism

The founding invertebrate BTB-ZF members are all transcriptional repressors, each regulating different Drosophila developmental processes. Most BTB-ZF proteins appear to modulate transcription by recruiting transcriptional corepressors such as SIN3A, SMRT and NCoR1 (nuclear receptor corepressor 1), which in turn recruit HDACs resulting in histone deacetylation and transcriptional repression.

 

ZBTB1 is essential during lymphoid development (5). There are several steps where ZBTB1 function may be critical. ZBTB1 may be necessary to promote Notch signaling at the ELP/CLP stage that is necessary for the commitment of these cells to the T cell lineage, and thus may play an opposing role to the one displayed by LRF (leukemia/lymphoa-related factor). Because BTB-ZF proteins are typically involved in transcriptional repression, the mechanism by which ZBTB1 may promote Notch signaling could involve repression of Notch inhibitors such as Fringe, Deltex1 or Nrarp. As Notch receptors are typically rapidly degraded by E3-ubiquitin ligases (including Fbw7 in T cells) (6), it is also possible that ZBTB1 may somehow repress this activity to extend Notch signaling in early T cells. If ZBTB1 is involved in mediating Notch signals in T cell progenitors, it may also act at subsequent stages of T cell development as Notch signaling continues to be critical for commitment to the T cell lineage in the thymus. Alternatively, ZBTB1 may be necessary to upregulate the expression of homing signals on T cell progenitor cells such as CCR7, CCR9 or PSGL1, thus allowing their migration to the thymus. In addition, ZBTB1 may be necessary to promote the migration of early T cell progenitors in the thymus. 

 

The T cell phenotype observed in old_friend animals suggests loss of ZBTB1-associated function.

Primers

PCR Primer
Old_friend_pcr_F: ACACGGTGGCTAGAAATGGC
Old_friend_pcr_R: CCGGCTGTGCAGAAAATGTTTTAG

Sequencing Primer
Old_friend_seq_F: CCAACAGGTGGTGTGCG
Old_friend_seq_R: GAAGAATCCTTTTCAGCAAGTTCAGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 408 nucleotides is amplified (chromosome 12, + strand):

1   acacggtggc tagaaatggc aatgaagcca acaggtggtg tgcggagccc agttcaacgg
61  tgaatacgcc gcatcacaga gaacctgagg aagagtcttt gcagttggcc aacttccccg
121 agccgctgtt tgatgtgtgt aaaaaaagtt ctgtgtccaa attatctact ccaaaagaac
181 gtgtgtctcg acgctttgga cggagcttta cctgtgatag ttgtggattt ggcttcagct
241 gtgaaaagtt actagacgaa catgtgctga cctgtaccaa cagacactca taccaaaaca
301 cgacaagagc ttaccaccga atagtagata ttagagatgg aaaagatagt aacatcaaag
361 ctgaacttgc tgaaaaggat tcttctaaaa cattttctgc acagccgg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Costoya, J. A. (2007) Functional Analysis of the Role of POK Transcriptional Repressors. Brief Funct. Genomic Proteomic. 6, 8-18.

  2. Stogios, P. J., Downs, G. S., Jauhal, J. J., Nandra, S. K., and Prive, G. G. (2005) Sequence and Structural Analysis of BTB Domain Proteins. Genome Biol.. 6, R82.

  3. Stogios, P. J., Chen, L., and Prive, G. G. (2007) Crystal Structure of the BTB Domain from the LRF/ZBTB7 Transcriptional Regulator. Protein Sci.. 16, 336-342.

  4. Brayer, K. J., and Segal, D. J. (2008) Keep Your Fingers Off My DNA: Protein-Protein Interactions Mediated by C2H2 Zinc Finger Domains. Cell Biochem. Biophys.. 50, 111-131.

  5. Siggs, O. M., Li, X., and Beutler, B. (2011) ZBTB1 is a Determinant of Lymphoid Development. JEM. .

  6. Thompson, B. J., Buonamici, S., Sulis, M. L., Palomero, T., Vilimas, T., Basso, G., Ferrando, A., and Aifantis, I. (2007) The SCFFBW7 Ubiquitin Ligase Complex as a Tumor Suppressor in T Cell Leukemia. J. Exp. Med.. 204, 1825-1835.