Phenotypic Mutation 'Memorial' (pdf version)
AlleleMemorial
Mutation Type missense
Chromosome7
Coordinate19,812,484 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Bcl3
Gene Name B cell leukemia/lymphoma 3
Synonym(s) Bcl-3
Chromosomal Location 19,808,462-19,822,770 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking functional copies of this gene exhibit defects of the immune system including disruption of the humoral immune response and abnormal spleen and Peyer's patch organogenesis. Mutant mice show increased susceptibility to pathogens. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_033601; MGI:88140

Mapped Yes 
Amino Acid Change Asparagine changed to Isoleucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000113851] [ENSMUSP00000117754]
SMART Domains Protein: ENSMUSP00000113851
Gene: ENSMUSG00000053175
AA Change: N142I

DomainStartEndE-ValueType
ANK 129 162 4.01e0 SMART
ANK 166 195 4.43e-2 SMART
ANK 199 230 8.99e-3 SMART
ANK 236 265 3.23e-4 SMART
ANK 270 299 5.79e-6 SMART
ANK 303 332 1.4e1 SMART
low complexity region 377 402 N/A INTRINSIC
low complexity region 425 447 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000120537)
SMART Domains Protein: ENSMUSP00000117754
Gene: ENSMUSG00000053175

DomainStartEndE-ValueType
Pfam:Ank_5 1 52 7.2e-7 PFAM
low complexity region 85 94 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000116129
Gene: ENSMUSG00000053175

DomainStartEndE-ValueType
ANK 66 99 4.01e0 SMART
ANK 103 132 4.43e-2 SMART
Predicted Effect noncoding transcript
Meta Mutation Damage Score 0.3889 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS central memory CD8 T cells in CD8 T cells - increased
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.521; ML prob: 0.506; human score: 2
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(51) : Chemically induced (ENU)(2) Gene trapped(38) Targeted(11)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Bcl3 APN 7 19809614 missense probably damaging 1.00
IGL01669:Bcl3 APN 7 19812491 nonsense probably null
IGL03024:Bcl3 APN 7 19809134 splice site probably benign
sunrise UTSW 7 19811580 nonsense probably null
sunrise2 UTSW 7 19809634 nonsense probably null
R0124:Bcl3 UTSW 7 19809651 missense probably damaging 1.00
R0136:Bcl3 UTSW 7 19809569 missense probably damaging 1.00
R0554:Bcl3 UTSW 7 19820066 missense probably benign 0.26
R1845:Bcl3 UTSW 7 19809627 missense probably damaging 0.98
R2571:Bcl3 UTSW 7 19809527 missense probably damaging 1.00
R4355:Bcl3 UTSW 7 19811580 nonsense probably null
R4597:Bcl3 UTSW 7 19812503 missense probably damaging 0.97
R4993:Bcl3 UTSW 7 19820177 missense probably benign 0.00
R5587:Bcl3 UTSW 7 19809634 nonsense probably null
R6232:Bcl3 UTSW 7 19812484 missense probably damaging 1.00
R7439:Bcl3 UTSW 7 19822611 missense probably benign
R7565:Bcl3 UTSW 7 19812494 missense probably damaging 1.00
R8443:Bcl3 UTSW 7 19820157 missense probably benign 0.01
RF022:Bcl3 UTSW 7 19809041 missense probably damaging 0.99
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2020-07-29 6:45 PM by External Program
Record Created 2019-01-22 7:37 AM by Bruce Beutler
Record Posted 2019-04-03
Phenotypic Description

Figure 1. Memorial mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The memorial phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R6232, some of which showed increased frequencies of central memory CD8 T cells in CD8 T cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased central memory CD8 T cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 73 mutations (X-axis) identified in the G1 male of pedigree R6232. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 73 mutations. The increased central memory CD8 T cell frequency phenotype was linked by continuous variable mapping to a mutation in Bcl3:  an A to T transversion at base pair 19,812,484 (v38) on chromosome 7, or base pair 10,284 in the GenBank genomic region NC_000073. Linkage was found with an additive model of inheritance, wherein five variant homozygotes and 14 heterozygous mice departed phenotypically from nine homozygous reference mice with a P value of 0.000635  (Figure 2).  

 

The mutation corresponds to residue 503 in the mRNA sequence NM_033601 within exon 3 of 9 total exons.

 

487 GCTGTGGTCCAGAATAACATAGCCGCTGTCTAC

137 -A--V--V--Q--N--N--I--A--A--V--Y-

 

The mutated nucleotide is indicated in red. The mutation results in an asparagine to isoleucine substitution at position 142 (N142I) in the BCL3 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 1. Domain organization of Bcl-3. Bcl-3 has seven ankyrin repeats, a proline-rich N-terminal domain and a serine/proline-rich C-terminal domain. The memorial mutation results in substitution of asparagine 142 for isoleucine. Other mutations found in Bcl-3 are noted in red. Click on the mutations to view more information.

Bcl-3 (B cell leukemia-3) is a member of the atypical subfamily of the IκB family. The atypical IκB molecules are not degraded following NF-κB pathway activation and are localized primarily in the nucleus where they interact with NF-κB dimers to regulate transcription. IκB family members share a common feature: multiple ankyrin repeats. Bcl-3 has seven ankyrin repeats, a proline-rich N-terminal domain and a serine/proline-rich C-terminal domain (1). The ankyrin repeats mediate the interaction with the NF-κB subunit, p50 (2;3).

 

The memorial mutation results in an asparagine to isoleucine substitution at position 142 (N142I); residue 142 is within the first ankyrin repeat.

 

Please see the record sunrise for more information about Bcl3.

Putative Mechanism

The NF-κB family of transcription factors consists of the evolutionary conserved proteins p65/RelA, c-Rel, RelB, p50 and p52 (derived from the p100 precursor; see the record for xander). In the resting cell, NF-κB dimers are kept inactive in the cytoplasm through their association with IκB inhibitory molecules, including p105 and p100. Degradation of IκBs allows the NF-κB dimers to translocate into the nucleus, where they are able to activate the transcription of target genes, including pro-inflammatory cytokines (e.g., TNFα (see the record for PanR1), IL-1, and IL-6), chemokines [e.g., MIP-1α (macrophage inflammatory protein-1α) and RANTES (regulated upon activation, normal T-cell expressed and secreted)], cell adhesion molecules [e.g., E-selectin and VCAM-1 (vascular cell adhesion molecule-1)], effector molecules [e.g., defensins], enzymes [e.g., inducible nitric oxide synthase], and growth factors to regulate the recruitment of immune cells to the site of infection [(4;5); reviewed in (6;7)]. Bcl-3 regulates both classical and non-canonical NF-κB signaling by selectively interacting with p50 and p52 homodimers, but not inhibiting DNA binding (8-11). Bcl-3-mediated suppression of the classical NF-κB signaling pathway is context- and/or stimulus-dependent. In noncanonical NF-κB signaling, Bcl-3 putatively acts as an adaptor that recruits nuclear coactivator and corepressors complexes to the p50/p52 homodimers (12). Bcl-3 enhances p50 homodimer binding to target DNA in thymocytes (13). In bone marrow-derived macrophages, Bcl-3 stabilizes DNA-bound p50 homodimers by inhibiting p50 ubiquitination and degradation (14). During Toll-like receptor and TNF receptor signaling, Bcl-3-stabilized p50 homodimers can block NF-κB target sites in the DNA, subsequently preventing the binding of active dimers to the DNA and gene transcription (14). Please see the records xander and Finlay for additional details about NF-κB signaling.

 

Bcl3−/− mice are overtly normal and were born at the expected Mendelian frequency (15). The Bcl3−/− mice exhibited a reduced B to T cell ratio in the spleen, blood, and lymph nodes (15). The Bcl3−/− mice lacked germinal centers with the B cell follicular areas before and after challenge with influenza virus and with the parasite T. gondii. However, after exposure to TNP–keyhole limpet hemocyanin (TNP-KLH) antigen absorbed in alum, the Bcl3−/− mice showed some PNA-stained cell clusters indicative of germinal center B cells, albeit at lower numbers then that in wild-type littermates. After infection with the T-dependent antigen, influenza, the Bcl3−/− mice exhibited a reduced IgG2a antibody response, and other antibody isotypes were not significantly generated. The microarchitecture of the B cell follicular zones in the Bcl3−/− mice were less well organized, although the T cell zones of the spleen were normal. In the marginal zone of the spleen, the number of marginal metallophilic macrophages and marginal zone macrophages were reduced in the Bcl3−/− mice compared to that in wild-type littermates. Expression of cell surface markers CD4, CD8, B220, IgM, Igκ, Igλ, TCRαβ, TCRγδ, IL-2Rα, HAS, CD43, BP1, Mac1, and Gr1 were comparable between Bcl3−/− and wild-type mice indicating that B and T cell subsets in the Bcl3−/− mice were normal (16). Similar to Bcl3−/− mice, the memorial mice exhibited immune defects indicative of diminished Bcl-3-associated function.

Primers PCR Primer
Memorial_pcr_F: TGCCCTCTTGTCCCAGGATG
Memorial_pcr_R: TGATGTGACAGTCTGACAGGG

Sequencing Primer
Memorial_seq_F: ATGTGGATGCTGGCTCCC
Memorial_seq_R: TGTGACAGTCTGACAGGGCAAATAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 404 nucleotides is amplified (chromosome 7, - strand):


1   tgatgtgaca gtctgacagg gcaaatagaa gccagagagc tcaggggctg ggaggcagga
61  gttggggggc tgtaattaat gtccaagaaa gcgaatttgg gctgttccca ggtggttaaa
121 aatgaccaaa agcaccccac catgactttc aacaatccag tgaccagccc ctaatcccag
181 cgactgtccc atcgtcccct caggcctctc cacatcgctg tggtccagaa taacatagcc
241 gctgtctacc gaatactcag ccttttcaag cttgggagcc gcgaagtaga cgtccataac
301 aacctgcggc aggtgaggtg gccgggagtt gggcaccgcg aaggaggggt ccccagagga
361 aggatgcagg ggagccagca tccacatcct gggacaagag ggca


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler