Phenotypic Mutation 'well-upholstered' (pdf version)
List |< first << previous [record 73 of 132] next >> last >|
Allelewell-upholstered
Mutation Type nonsense
Chromosome4
Coordinate101,772,959 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Lepr
Gene Name leptin receptor
Synonym(s) obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
Chromosomal Location 101,717,404-101,815,352 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_146146, NM_010704; MGI: 104993

Mapped Yes 
Amino Acid Change Tryptophan changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
W623* in Ensembl: ENSMUSP00000037385 (fasta)
W623* in Ensembl: ENSMUSP00000099838 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 1.5e-23 PFAM
Blast:IG_like 429 498 N/A BLAST
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Phenotypic Category
Phenotypequestion? Literature verified References
adipose tissue
behavior/neurological
Body Weight - increased
growth/size
homeostasis/metabolism
reproductive system
Penetrance 100% 
Alleles Listed at MGI
All alleles(36) : Targeted, knock-out(3) Targeted, other(12) Transgenic(1) Spontaneous(13) Chemically induced(7)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.77
IGL01324:Lepr APN 4 101768068 missense probably benign 0.23
IGL01372:Lepr APN 4 101735577 missense possibly damaging 0.67
IGL01626:Lepr APN 4 101733534 missense probably benign 0.10
IGL01733:Lepr APN 4 101765082 missense probably benign 0.00
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.49
IGL01899:Lepr APN 4 101779987 missense possibly damaging 0.86
IGL02138:Lepr APN 4 101768067 missense probably damaging 0.98
IGL02161:Lepr APN 4 101745678 missense probably damaging 0.97
IGL02653:Lepr APN 4 101764944 missense probably benign 0.44
IGL02735:Lepr APN 4 101782638 missense probably damaging 1.00
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
business_class UTSW 4 101764872 nonsense
cherub UTSW 4 101768063 nonsense
fluffy UTSW 4 101792023 missense probably damaging 1.00
giant UTSW 4 101765152 critical splice donor site probably null
odd UTSW 4 101728075 splice donor site
paleo UTSW 4 101745645 missense possibly damaging 0.94
R0140:Lepr UTSW 4 101768067 missense probably damaging 1.00
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1398:Lepr UTSW 4 101792019 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1602:Lepr UTSW 4 101745645 missense possibly damaging 0.94
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 splice site probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4343:Lepr UTSW 4 101765152 critical splice donor site probably null
R4345:Lepr UTSW 4 101765152 critical splice donor site probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4724:Lepr UTSW 4 101765365 nonsense probably null
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R4939:Lepr UTSW 4 101733438 missense possibly damaging 0.78
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 intron probably benign
R6092:Lepr UTSW 4 101792023 missense probably damaging 1.00
R6130:Lepr UTSW 4 101765372 missense probably damaging 0.99
R6168:Lepr UTSW 4 101735592 missense probably damaging 0.99
R6232:Lepr UTSW 4 101814391 intron probably null
R6380:Lepr UTSW 4 101764954 nonsense probably null
R6427:Lepr UTSW 4 101774257 missense possibly damaging 0.47
R6428:Lepr UTSW 4 101780098 missense probably damaging 1.00
R6641:Lepr UTSW 4 101765305 missense probably damaging 0.97
R6650:Lepr UTSW 4 101815201 missense probably damaging 1.00
R6859:Lepr UTSW 4 101765290 splice site probably null
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm
Repository

none

Last Updated 2018-04-06 5:01 PM by Diantha La Vine
Record Created unknown
Record Posted 2008-11-13
Phenotypic Description

The Well-upholstered mutation was identified in ENU-mutagenized G3 mice, and is characterized by massive obesity and infertility in homozygous animals.  The candidate genes leptin (Lep), leptin receptor (Lepr; see Business class and Cherub) and melanocortin 4 receptor (Mc4r; see Southbeach) were directly sequenced, and a mutation in the Lepr gene was found. 

Nature of Mutation
The Well-upholstered mutation corresponds to a G to A transition at position 2421 (record for variant 1; NM_146146) of the Lepr transcript, in exon 12 of 18 total exons. 
 
2404 GGATATTGGAGTAATTGGAGCAGTCCAGCCTAT
618  -G--Y--W--S--N--W--S--S--P--A--Y-
 
The mutated nucleotide is indicated in red lettering and results in the conversion of tryptophan 623 to a stop codon.  This removes the C-terminal 539 amino acids of the leptin receptor (LEPR) protein.  
Protein Prediction
Figure 1. Domain of OB-Rb and structure of mouse leptin receptor isoforms. OB-Rb contains the longest intracellular domain, which is crucial for leptin signaling. OB-Ra, OB-Rc and OB-Rd have varying short cytoplasmic domains. All isoforms contain the Box 1 motif known to bind JAK kinases. OB-Re is a secreted isoform of the leptin receptor. Cytokine receptor homology module (CRH)2 is the main binding site for leptin. The immunoglobin-like (IG-like) and fibronectin type III (FNIII) domains are involved in OB-R activation. The role of CRH1 remains to be determined. Both CRH domains also contain a FNIII fold (see text). The Well-upholstered mutation causes a conversion of tryptophan 623 to a stop codon. This image is interactive. Other mutations found in the Lepr gene are noted in red. Click on the mutations for more specific information. 
The well-upholstered mutation results in protein truncation at amino acid 623.  This deletes a significant portion of the protein including the C-terminal intracellular signaling domain, the membrane spanning region, and much of the extracellular region including a small portion of the ligand-binding region (Figure 1).  It is unlikely that this truncated protein would have any function.
 
Please see the record for Business class for more information on Lepr.
Primers Primers cannot be located by automatic search.
Genotyping
Well-upholstered genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Well(F): 5’-AGGGGTGAGACAGTGTTTGGAACT -3’
Well(R): 5’-TCAGGCCCTCTCATAGGAACTGAAAA -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Well_seq(F): 5’-ACAGTGTTTGGAACTGACCTTG -3’
Well_seq(R): 5’-TCTTCAGTCACGCTTGAAGC -3’
 
The following sequence of 1613 nucleotides (from Genbank genomic region NC_000070 for linear DNA sequence of Lepr) is amplified:
 
55169                               ag gggtgagaca gtgtttggaa ctgaccttgc
55201 aagggcagtg agttcacaag ggaatgagcc aaggtgggag gcagcgttcc gatgattagc
55261 caaactttgt gatttctgaa gtgggaaaag acaacatctc tgggtcttaa gtttggaatg
55321 gtgttatggt ttaaaatgaa agcacatttc aggactcaca ggaggcaagt atgttaacaa
55381 tgtgacttcc tttacagaca catgaggtat tcgatgcaaa gtcaaagtct gccagcctgc
55441 tggtgtcaga cctctgtgca gtctatgtgg tccaggttcg ctgccggcgg ttggatggac
55501 taggatattg gagtaattgg agcagtccag cctatacgct tgtcatggat gtaaaaggtc
55561 tgtgagcatt tgttaaactt tcttgagtat gcagaagcga gtgcttcaag cgtgactgaa
55621 gacctttctt ttttcttttt ttttttatta ttaggtattt tcctcattta catttccaat
55681 gctatcccaa aagtccccca taccctccct caccactccc ctacccacct actcccactt
55741 ggccctggca ttcccctgta ctggggcata taaagtttgc aagtccaata ggcctctctt
55801 tccggtgatg gccgactagg ccatcttttg atgcatatgc agctagagtc aagagctccg
55861 gggtactggt tagttcataa tgttgttcca cctatagggt tgcagttccc tttagctcct
55921 tgggtacttt ctctagctcc tccattgggg ggccctgtga tccatccaat agctgactgt
55981 gagcatccac ttctgtgttt gctaggccct ggcatagtct cacaagagag agctctatct
56041 gggtcctttc agcaaaatct tgctagtgtg tgcaatggtg tcagagtttg gaagctgatt
56101 atgggatgga tccccggata tggcagtctc tagatggtcc atcctttcgt cacagctcca
56161 aactttgtct ctgtaactcc ttccacgggt gttttgttcc caattctaag aaggatcaaa
56221 gtgtccacac tttggtcttc gttcttcttg agtttcatgt gtttagcaaa ttgtatctta
56281 tatcttgggt atcctaggtt ttgggctaat atccacttat cagtgagtac atattgtgtg
56341 agttcctttg tgaatgtgtt acctcactca ggatgatgcc ctccaggtcc atccatttgc
56401 ctaggaattt cataaattca ttctttttaa tagttgagta gtactccatt gtgtaaatgt
56461 accacatttt ctgtatccat tcctctgttg aggggcatct gggttctttc cagctcctgg
56521 ctattataaa taaggctgct atgaacatag tggagcatgt gtccttctta ccggttggga
56581 catcttctgg atatatgccc aggagaggta ttgctggatc ctccggtagt actatgtcca
56641 attttctgag gaaccgccag actgaggaac catagatgcg agcatcagca acagaataca
56701 agagactgaa gacatttctc tcgagaacat gtgtctgact caggcttctt attgtttttc
56761 agttcctatg agagggcctg a 
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsOwen M. Siggs, Christine Domingo, Bruce Beutler
List |< first << previous [record 73 of 132] next >> last >|
Edit History
2011-07-06 3:45 PM (current)
2011-01-07 9:59 AM
2010-12-08 3:38 PM
2010-08-26 2:11 PM
2010-08-26 2:11 PM
2010-02-03 10:52 AM