Phenotypic Mutation 'Normandy' (pdf version)
AlleleNormandy
Mutation Type splice site
Chromosome11
Coordinate54,493,181 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Fnip1
Gene Name folliculin interacting protein 1
Synonym(s) A730024A03Rik
Chromosomal Location 54,438,199-54,518,235 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_173753; MGI:105128

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000049026] [ENSMUSP00000121399]
SMART Domains Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992

DomainStartEndE-ValueType
Pfam:FNIP_N 41 159 1.7e-29 PFAM
Pfam:FNIP_M 316 549 9.9e-92 PFAM
Pfam:FNIP_C 975 1161 7.6e-73 PFAM
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992

DomainStartEndE-ValueType
Pfam:FNIP_N 17 139 3.9e-36 PFAM
Pfam:FNIP_M 288 526 5.1e-87 PFAM
Predicted Effect probably benign
Meta Mutation Damage Score 0.0898 question?
Is this an essential gene? Possibly essential (E-score: 0.738) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B220 MFI - decreased
Candidate Explorer Status CE: potential candidate; Verification probability: 0.081; ML prob: 0.12; human score: 1.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (ENU)(3) Chemically induced (other)(1) Gene trapped(2) Targeted(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fnip1 APN 11 54499508 missense probably damaging 1.00
IGL01590:Fnip1 APN 11 54493300 missense probably damaging 1.00
IGL01959:Fnip1 APN 11 54490912 missense possibly damaging 0.95
IGL02157:Fnip1 APN 11 54487763 missense probably damaging 1.00
IGL02197:Fnip1 APN 11 54493374 missense probably damaging 1.00
IGL02476:Fnip1 APN 11 54499567 splice site probably benign
IGL02639:Fnip1 APN 11 54475640 nonsense probably null
IGL02742:Fnip1 APN 11 54493351 missense probably damaging 1.00
hamel UTSW 11 54480685 critical splice donor site probably benign
hamel2 UTSW 11 54502271 missense probably damaging 1.00
H8562:Fnip1 UTSW 11 54480297 missense probably damaging 0.98
P0043:Fnip1 UTSW 11 54503225 missense probably benign 0.00
R0114:Fnip1 UTSW 11 54487801 splice site probably benign
R0278:Fnip1 UTSW 11 54489343 splice site probably null
R0409:Fnip1 UTSW 11 54480354 splice site probably null
R0840:Fnip1 UTSW 11 54493181 splice site probably benign
R1131:Fnip1 UTSW 11 54493303 missense possibly damaging 0.82
R1205:Fnip1 UTSW 11 54502306 missense possibly damaging 0.91
R1271:Fnip1 UTSW 11 54503297 missense probably benign
R1817:Fnip1 UTSW 11 54502453 missense probably benign 0.30
R1826:Fnip1 UTSW 11 54466164 missense probably damaging 1.00
R1872:Fnip1 UTSW 11 54487735 missense probably damaging 1.00
R1883:Fnip1 UTSW 11 54515547 missense probably damaging 1.00
R1917:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1918:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1919:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R2010:Fnip1 UTSW 11 54482503 missense probably damaging 1.00
R2117:Fnip1 UTSW 11 54500624 missense probably damaging 1.00
R2329:Fnip1 UTSW 11 54466107 missense probably damaging 0.98
R2337:Fnip1 UTSW 11 54475737 missense probably damaging 0.98
R2850:Fnip1 UTSW 11 54502677 missense probably benign 0.32
R2863:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2864:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2865:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R3936:Fnip1 UTSW 11 54480239 splice site probably null
R4017:Fnip1 UTSW 11 54509987 missense probably benign 0.14
R4033:Fnip1 UTSW 11 54502471 missense probably benign 0.02
R4668:Fnip1 UTSW 11 54503559 missense probably damaging 1.00
R4695:Fnip1 UTSW 11 54499419 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54466171 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54499526 missense probably benign 0.01
R4777:Fnip1 UTSW 11 54500556 missense probably damaging 1.00
R4863:Fnip1 UTSW 11 54515556 missense possibly damaging 0.52
R5369:Fnip1 UTSW 11 54502589 missense probably benign
R5481:Fnip1 UTSW 11 54502644 missense probably benign 0.01
R5562:Fnip1 UTSW 11 54489342 critical splice donor site probably null
R5563:Fnip1 UTSW 11 54504862 missense probably benign 0.05
R5628:Fnip1 UTSW 11 54503633 missense probably benign 0.08
R5689:Fnip1 UTSW 11 54502289 missense probably damaging 1.00
R6009:Fnip1 UTSW 11 54502271 missense probably damaging 1.00
R6120:Fnip1 UTSW 11 54510000 missense probably benign 0.23
R6429:Fnip1 UTSW 11 54515567 missense probably damaging 1.00
R6546:Fnip1 UTSW 11 54502611 missense probably benign 0.03
R6600:Fnip1 UTSW 11 54503099 missense probably benign
R6882:Fnip1 UTSW 11 54509898 missense probably damaging 1.00
R6966:Fnip1 UTSW 11 54482559 missense probably benign 0.00
R7009:Fnip1 UTSW 11 54502935 missense probably damaging 1.00
R7664:Fnip1 UTSW 11 54466125 missense probably damaging 1.00
R7706:Fnip1 UTSW 11 54515499 missense probably benign 0.41
R7866:Fnip1 UTSW 11 54465402 start gained probably benign
R7939:Fnip1 UTSW 11 54502267 missense probably damaging 1.00
R7943:Fnip1 UTSW 11 54502388 missense probably damaging 1.00
R8429:Fnip1 UTSW 11 54475696 missense possibly damaging 0.94
R8546:Fnip1 UTSW 11 54510000 missense probably benign 0.23
R8753:Fnip1 UTSW 11 54510041 missense probably damaging 0.99
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:31 PM by Anne Murray
Record Created 2019-01-22 11:22 AM by Bruce Beutler
Record Posted 2019-02-08
Phenotypic Description

Figure 1. Normandy mice exhibit reduced B220 expression on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Normandy phenotype was identified among G3 mice of the pedigree R0840, some of which showed reduced B200 expression on peripheral blood B cells (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced B220 MFI using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 51 mutations (X-axis) identified in the G1 male of pedigree R0840. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 51 mutations. The reduced B220 MFI phenotype was linked by continuous variable mapping to mutations in two genes: Pisd (chromosome 5) and Fnip1 (chromosome 11). The mutation in Fnip1 was presumed causative as the B220 MFI phenotype in the Normandy mice mimics that of mice expressing another mutant Fnip1 allele (see hamel2). The Fnip1 mutation is a T to A transversion at base pair 54,493,181 (v38) on chromosome 11, or base pair 55,037 in the GenBank genomic region NC_000077 within intron 9, 12-base pairs from exon 10 (out of 18 total exons). Linkage was found with a dominant model of inheritance, wherein one variant homozygote and five heterozygous mice departed phenotypically from four homozygous reference mice with a P value of 0.000832 (Figure 2).

 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to not affect splicing. In case the mutation does affect splicing, the most likely aberrant splicing would result in skipping of the 202-base pair exon 10. The mutation would cause a frame-shifted protein product beginning after amino acid 305 of the protein, which is normally 1,165 amino acids in length, and termination after the inclusion of one aberrant amino acid.

 

         <--exon 9             <--intron 9 exon 10-->      exon 11-->
1022 ……TTTCCTAGATG ……acaaaaacatttatttttaag GTCTGTAGAAGAA…… GCAATGAAAATG……
302  ……-F--P--R--W                         --S--V--E--E-…… --E--*-

         correct                              deleted      aberrant

 

The acceptor splice site of intron 9 indicated in blue lettering and the mutated nucleotide is indicated in red.

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Alignment of the five conserved domains of FNIP1.  There are five blocks of conserved amino acid sequence with at least 35% similarity between FNIP1 orthologs in Homo sapiensXenopus tropicalisDanio rerioDrosophila melanogaster, and Caenorhabditis elegans.  The mouse sequences within the conserved regions are homologous to the human sequence with the exception that the mouse FNIP1 is one amino acid shorter (1165 aa) than the human (1166 aa). The Normandy mutation is within intron 9, 12-base pairs from exon 10. Other mutations found in FNIP1 are noted. Click on each mutation for more information.

Fnip1 encodes the 1,165 amino acid folliculin (FLCN)-interacting protein 1 (FNIP1) protein. BLAST and SMART analysis revealed no known functional domains in FNIP1; however, there are five blocks of conserved amino acid sequence with at least 35% similarity between FNIP1 orthologs in Homo sapiens, Xenopus tropicalis, Danio rerio, Drosophila melanogaster, and Caenorhabditis elegans (Figure 3). Amino acids 300 to 1166 of FNIP1 (containing all but the first conserved block) are essential for binding to the C-terminus of FLCN; full-length FNIP1 is required for maximum binding (1). In addition to FLCN [and putatively FNIP2 (2;3)], FNIP1 interacts with HSP90, as well as with the alpha, beta, and gamma subunits of 5’-AMP-activated protein kinase (AMPK) (1).

 

The Normandy mutation may result in a frame-shifted protein product beginning after amino acid 305 of the protein and termination after the inclusion of one aberrant amino acid.

 

Please see the record hamel for more information about Fnip1.

Putative Mechanism

The FLCN/FNIP complex negatively regulates AMPK, subsequently leading to alterations in AMPK-mTOR signaling (4). Modulation of the interaction between FLCN and FNIP1 by rapamycin and nutrient load suggests that FLCN and FNIP1 proteins are both involved in energy and/or nutrient sensing through AMPK and mTOR signaling pathways (1). mTOR signaling regulates the differentiation, activation, and function of several immune cell types including mast cells, neutrophils, natural killer cells, γδ T cells, macrophages, dendritic cells (DCs), T cells and B cells [(5-8); reviewed in (9)].

 

Fnip1 knockout (KO) mice are viable and fertile, but they display a marked reduction in spleen size as well as an almost complete lack of conventional splenic CD19+ cells, B220lowCD19high peritoneal B1 cells, and B cells in the bone marrow with a concomitant accumulation of B220lowCD43+CD25−pro-B cells (10). Thymus size, thymocyte numbers, and peripheral T cells as well as bone marrow monocyte, granulocyte, and erythrocyte lineages were normal in the Fnip1 KO animals. The reduced cell numbers were due to increased cell death of peripheral pro-B and pre-B cells in the KO; overexpression of antiapoptoic protein Bcl2 in the B cell compartment led to increased B220+IgM+ B cells in the bone marrow. Taken together, these results show that FNIP1 is essential for the survival of B-cells in the bone marrow. The defect in pro-B cell development was not caused by changes in V(D)J recombination or the failure to express a functional B cell receptor.

 

An ENU-induced Fnip1 mutant with a 32 bp deletion in exon 9, which resulted in coding of a premature stop codon at amino acid 293 exhibited changes in skeletal muscle, hypertrophic cardiomyopathy, and increased liver glycogen content (11). The Fnip1 mutant mice also showed a block at the pre-B cell stage in the bone marrow. Mature B cells were not detected in the bone marrow or the spleen and B1 B lymphocytes were not found in the peritoneal and pleural cavities. This study determined that FNIP1 mediates B cell development at the large pre-B to small pre-B cell transition; no changes to the signals from the pre-BCR and IL-7 receptor were detected in the Fnip1 mutant animals. Reduced Fnip1 expression also led to metabolic imbalance, which triggered apoptosis in response to pre-BCR stimulation, nutrient deprivation, or oncogene activation. FNIP1 was proposed to act as a molecular switch that permits pre-B cell differentiation and survival and FNIP1 ensures that maturing B cells have adequate metabolic capacity to finish maturing (11).

 

The phenotype observed in the Normandy mice indicates loss of FNIP1-associated function.

Primers PCR Primer
Normandy_pcr_F: TTTTCATGACTCAGGCTGGGCAG
Normandy_pcr_R: GCAGCTCCTGGAGCAGATTGTAAAG

Sequencing Primer
Normandy_seq_F: GGTTCAGAAACTTCATGTTTCCG
Normandy_seq_R: TCATGTGGCTTTCAAAGAGAGG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 734 nucleotides is amplified (chromosome 11, + strand):


1   ttttcatgac tcaggctggg cagcttgctc agcctcaaga ttttcttcct ttagcttttg
61  ctaaagtaca gctgtaggtt cagaaacttc atgtttccgc gtttatttca cttgttctct
121 tttatcttaa aattcagata tttttagctt attttttgaa ttggagttat ctgcttcttt
181 aagacttcta gtaagaagca agattcaacc atttccaact tgattctagt aaagtttctt
241 caaaaaaaaa aagaaaaata gatttcttag aaaggtagcc attataacat tgtaaattta
301 tatttaattt cataaaacaa cagaagagct tttattcacc tacattgaat tagcaaggaa
361 ataaactatt gatgttttaa acaaaaacat ttatttttaa ggtctgtaga agaaagcttt
421 aatctgtcag atgaaagttg tggccctaat ccaggaattg tgaggaaaaa gaagattgca
481 attggggtaa tcttttcatt atccaaagat gaagatgaaa ataacaaatt caatgaattc
541 tttttttcac attttcctct ctttgaaagc cacatgaaca aattaaaaag tgcaatagaa
601 caggtaagtg tagtactttg tattttattt ttatctttta ctttgcattc tttttaataa
661 gaattgtgtt tattcatttg gcaaaaattt ggtaggtgtc ttgaacttac tttacaatct
721 gctccaggag ctgc


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Xue Zhong, and Bruce Beutler