Phenotypic Mutation 'Whistles' (pdf version)
AlleleWhistles
Mutation Type missense
Chromosome15
Coordinate78,481,936 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Il2rb
Gene Name interleukin 2 receptor, beta chain
Synonym(s) IL-15 receptor beta chain, CD122, IL-15Rbeta, IL15Rbeta, IL-2/15Rbeta, Il-2Rbeta
Chromosomal Location 78,479,256-78,495,271 bp (-)
MGI Phenotype FUNCTION: The interleukin 2 receptor is composed of alpha and beta subunits. The beta subunit encoded by this gene is very homologous to the human beta subunit and also shows structural similarity to other cytokine receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous activation of T cells and differentiation of B cells, elevated immunoglobulins including autoantibodies causing hemolytic anemia, granulocytopoiesis, and death after 3 months of age. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008368; MGI:96550

Mapped Yes 
Amino Acid Change Tyrosine changed to Phenylalanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000086820] [ENSMUSP00000127006]
SMART Domains Protein: ENSMUSP00000086820
Gene: ENSMUSG00000068227
AA Change: Y387F

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Predicted Effect possibly damaging

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
(Using ENSMUST00000089398)
SMART Domains Protein: ENSMUSP00000127006
Gene: ENSMUSG00000068227
AA Change: Y387F

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Predicted Effect possibly damaging

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
(Using ENSMUST00000163494)
Meta Mutation Damage Score 0.5033 question?
Is this an essential gene? Probably nonessential (E-score: 0.094) question?
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 10
TLR signaling defect: hyposensitivity to LPS
TLR signaling defect: hyposensitivity to PAM3CSK4
TLR signaling defect: hyposensitivity to R848
TLR signaling defect: TNF production by macrophages
total IgE level - increased 7770771
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.557; ML prob: 0.534; human score: 0.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (ENU)(1) Chemically induced (other)(1) Radiation induced(2) Targeted(8) Transgenic(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Il2rb APN 15 78481697 missense probably benign 0.00
Bonnerhall UTSW 15 78485004 missense probably benign
diptera UTSW 15 78485806 missense probably damaging 1.00
flybase UTSW 15 78491848 start codon destroyed probably null 0.66
Moonpie UTSW 15 78481834 frame shift probably null
R0581:Il2rb UTSW 15 78481936 missense possibly damaging 0.72
R1795:Il2rb UTSW 15 78483987 missense probably damaging 1.00
R1932:Il2rb UTSW 15 78491777 missense possibly damaging 0.93
R2924:Il2rb UTSW 15 78491849 start codon destroyed probably null 0.27
R4706:Il2rb UTSW 15 78486400 missense possibly damaging 0.81
R5713:Il2rb UTSW 15 78491848 start codon destroyed probably null 0.66
R5953:Il2rb UTSW 15 78484982 nonsense probably null
R6018:Il2rb UTSW 15 78482066 missense possibly damaging 0.54
R6279:Il2rb UTSW 15 78481538 missense possibly damaging 0.72
R6666:Il2rb UTSW 15 78481834 frame shift probably null
R6961:Il2rb UTSW 15 78485824 missense probably damaging 1.00
R8020:Il2rb UTSW 15 78485004 missense probably benign
R8477:Il2rb UTSW 15 78485806 missense probably damaging 1.00
X0018:Il2rb UTSW 15 78485765 missense probably damaging 1.00
X0066:Il2rb UTSW 15 78484956 missense probably benign 0.04
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-10-23 1:57 PM by Diantha La Vine
Record Created 2019-01-22 11:48 AM by Bruce Beutler
Record Posted 2019-02-08
Phenotypic Description

Figure 1. Whistles mice exhibited increased total IgE levels in the serum. IgE levels were determined by ELISA. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The whistles phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0581, some of which showed increased total IgE levels in the serum (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased IgE levels in the serum using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 41 mutations (X-axis) identified in the G1 male of pedigree R0581. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 41 mutations. The increased IgE phenotype was linked by continuous variable mapping to a mutation in Il2rb: an A to T transversion at base pair 78,481,936 (v38) on chromosome 15, or base pair 29,686 in the GenBank genomic region NC_000081 encoding Il2rb. Linkage was found with a recessive model of inheritance, wherein two variant homozygotes departed phenotypically from seven homozygous reference mice and 23 heterozygous mice with a P value of 0.000117 (Figure 2).   

 

The mutation corresponds to residue 1,309 in the mRNA sequence NM_008368 within exon 10 of 10 total exons.

 

1293 CAGGTGTACTTCACCTATGACCCCTGTGTGGAA

382  -Q--V--Y--F--T--Y--D--P--C--V--E-

 

The mutated nucleotide is indicated in red. The mutation results in a tyrosine to phenylalanine substitution at position 387 (Y387F) in the CD122 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.721).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Domain organization of CD122. The whistles mutation results in a tyrosine to phenylalanine substitution at position 387 (Y387F). Abbreviations: SP, signal peptide; FN3, fibronectin type-III; TM, transmembrane domain; SS, sorting signal. This image is interactive. Other mutations found in CD122 are noted in red. Click on each muation for more information.

Il2rb encodes CD122 (alternatively, IL2Rβ), the beta chain of the IL-2 receptor (1). The IL-2 receptor has three subunits: α, β (CD122), and γc. The receptors for IL-2, 4, 7, 9, and 15 have a common γ chain, and the receptors for IL-2 and IL-15 share the β chain (2). The β and γc subunits together form an intermediate affinity receptor (3). Upon co-expression of the α subunit, the receptor is converted to a high affinity receptor [PDB:2B5I; (4;5)].  

 

CD122 is a single-pass transmembrane protein, with an extracellular N-terminus and a cytoplasmic C-terminus (Figure 3). Amino acids 1 to 26 are a signal peptide. IL2RB has a single fibronectin type-III domain (FN3; amino acids 135 to 235), a WSXWS motif (amino acids 221 to 225), and a box 1 motif (amino acids 281 to 289). CD122 is cleaved, which generates a 37-kDa fragment (termed 37βic) containing the C-terminal tail and transmembrane domains (6). The CD122 fragment is functional and associates with STAT5 to promote cell proliferation.

 

The whistles mutation results in a tyrosine to phenylalanine substitution at position 387 (Y387F); Tyr387 is within an undefined region in the cytoplasmic C-terminal tail.

 

Please see the record flybase for more information about Il2rb.

Putative Mechanism

IL-2/IL-15 receptor-associated signaling functions in antigen-driven T cell-expansion, and maintains peripheral T cell homeostasis as well as promotes the differentiation and function of NK cells and B cells. Stimulation of the IL-2 receptor (containing a γc subunit) results in activation of JAK3. Activated JAK3 phosphorylates the receptor cytoplasmic domains, creating phosphotyrosine ligands for the SH2 domains of STAT5. Once recruited to the receptor, STAT5 is also tyrosine phosphorylated by JAK3. Phosphorylated, activated STAT5 enters the nucleus and accumulates there to promote transcription.

 

Il2rb-deficient (Il2rb-/-) mice exhibited reduced numbers of regulatory T cells in the thymus and lymph nodes, enlarged spleens, increased sizes of spleen periarteriolar lymphoid sheaths, aberrant T cell responses to inflammatory cytokines, increased percentages of CD4 and CD8 T cells that express high levels of activation markers, reduced T cell proliferation, enlarged lymph nodes, increased levels of anti-DNA antibodies, and increased susceptibility to autoimmune hemolytic anemia (7;8). In addition, Il2rb-/- mice showed reduced numbers of double-positive T cells, B cells, and memory T cells; increased numbers of plasma cells, CD4+ T cells and CD8+ T cells in the thymus, erythroid progenitors in the blood, and neutrophils in the lymph nodes, and increased levels of IgE and IgG1 in the sera (8). Il2rb-/- mice also showed premature death, weight loss, slow movements, fuzzy hair, and poorly developed genitalia (8).

 

The increased IgE phenotype in the whistles mice mimics that of Il2rb-/- mice indicating loss of CD122-associated function.

Primers PCR Primer
Whistles_pcr_F: CTCTGTCCTGATCTTGCCCATGAAG
Whistles_pcr_R: TCTCTGGCAGAAATGGCTCTCCTC

Sequencing Primer
Whistles_seq_F: TGTAAGCCCATCAGGTCACG
Whistles_seq_R: ATCTCTCCGCTGGAAGTGC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 632 nucleotides is amplified (chromosome 15, - strand):


1   tctctggcag aaatggctct cctcgcctgt ccccttgtcc ttcttcagcc ccagtggccc
61  tgcccctgag atctctccgc tggaagtgct cgacggagat tccaaggccg tgcagctgct
121 cctgttacag aaggactctg cccctttacc ctcgcccagc ggccactcac aggccagctg
181 cttcaccaac cagggctact tcttcttcca tctgcccaat gccttggaga tcgaatcctg
241 ccaggtgtac ttcacctatg acccctgtgt ggaagaggag gtggaggagg atgggtcaag
301 gctgcccgag ggatctcccc acccacctct gctgcctctg gctggagaac aggatgacta
361 ctgtgccttc ccgcccaggg atgacctgct gctcttctcc ccgagcctca gcacccccaa
421 cactgcctat gggggcagca gagcccctga agaaagatct ccactctccc tgcatgaggg
481 acttccctcc ctagcatccc gtgacctgat gggcttacag cgccctctgg agcggatgcc
541 ggaaggtgat ggagaggggc tgtctgccaa tagctctggg gagcaggcca gtgtcccaga
601 aggcaacctt catgggcaag atcaggacag ag


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsTau Yue, Takuma Misawa, Jeff SoRelle, and Bruce Beutler