Phenotypic Mutation 'Whistles'

• Allele: Whistles
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 78,481,936 bp (GRCm38)
• Base Change: T ⇒ A (forward strand)
• Gene: Il2rb
• Gene Name: interleukin 2 receptor, beta chain
• Synonym(s): IL-15 receptor beta chain, CD122, IL-15Rbeta, IL15Rbeta, IL-2/15Rbeta, Il-2Rbeta
• Chromosomal Location: 78,479,256-78,495,271 bp (-)
• MGI Phenotype: FUNCTION: The interleukin 2 receptor is composed of alpha and beta subunits. The beta subunit encoded by this gene is very homologous to the human beta subunit and also shows structural similarity to other cytokine receptors. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous activation of T cells and differentiation of B cells, elevated immunoglobulins including autoantibodies causing hemolytic anemia, granulocytopoiesis, and death after 3 months of age. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Phenylalanine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000086820] [ENSMUSP00000127006]
• AlphaFold: P16297
• SMART Domains: Protein: ENSMUSP00000086820; Gene: ENSMUSG00000068227; AA Change: Y387F

Domain	Start	End	E-Value	Type
low complexity region	6	19	N/A	INTRINSIC
FN3	133	219	9.48e-3	SMART
transmembrane domain	246	268	N/A	INTRINSIC
low complexity region	307	321	N/A	INTRINSIC

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
  (Using ENSMUST00000089398)
• SMART Domains: Protein: ENSMUSP00000127006; Gene: ENSMUSG00000068227; AA Change: Y387F

Domain	Start	End	E-Value	Type
low complexity region	6	19	N/A	INTRINSIC
FN3	133	219	9.48e-3	SMART
transmembrane domain	246	268	N/A	INTRINSIC
low complexity region	307	321	N/A	INTRINSIC

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
  (Using ENSMUST00000163494)
• Meta Mutation Damage Score: 0.5033
• Is this an essential gene?: Probably nonessential (E-score: 0.080)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-10-23 1:57 PM by Diantha La Vine
• Record Created: 2019-01-22 11:48 AM by Bruce Beutler
• Record Posted: 2019-02-08
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Tau Yue, Takuma Misawa, Jeff SoRelle, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_008368; MGI:96550

Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (ENU)(1) Chemically induced (other)(1) Radiation induced(2) Targeted(8) Transgenic(4)

Phenotypic Description

Figure 1. Whistles mice exhibited increased total IgE levels in the serum. IgE levels were determined by ELISA. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The whistles phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0581, some of which showed increased total IgE levels in the serum (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased IgE levels in the serum using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 41 mutations (X-axis) identified in the G1 male of pedigree R0581. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 41 mutations. The increased IgE phenotype was linked by continuous variable mapping to a mutation in Il2rb: an A to T transversion at base pair 78,481,936 (v38) on chromosome 15, or base pair 29,686 in the GenBank genomic region NC_000081 encoding Il2rb. Linkage was found with a recessive model of inheritance, wherein two variant homozygotes departed phenotypically from seven homozygous reference mice and 23 heterozygous mice with a P value of 0.000117 (Figure 2).   

 

The mutation corresponds to residue 1,309 in the mRNA sequence NM_008368 within exon 10 of 10 total exons.

1293 CAGGTGTACTTCACCTATGACCCCTGTGTGGAA 382  -Q--V--Y--F--T--Y--D--P--C--V--E-

 

The mutated nucleotide is indicated in red. The mutation results in a tyrosine to phenylalanine substitution at position 387 (Y387F) in the CD122 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.721).

Protein Prediction

Figure 3. Domain organization of CD122. The whistles mutation results in a tyrosine to phenylalanine substitution at position 387 (Y387F). Abbreviations: SP, signal peptide; FN3, fibronectin type-III; TM, transmembrane domain; SS, sorting signal. This image is interactive. Other mutations found in CD122 are noted in red. Click on each muation for more information.

Il2rb encodes CD122 (alternatively, IL2Rβ), the beta chain of the IL-2 receptor (1). The IL-2 receptor has three subunits: α, β (CD122), and γ_c. The receptors for IL-2, 4, 7, 9, and 15 have a common γ chain, and the receptors for IL-2 and IL-15 share the β chain (2). The β and γ_c subunits together form an intermediate affinity receptor (3). Upon co-expression of the α subunit, the receptor is converted to a high affinity receptor [PDB:2B5I; (4;5)].  

 

CD122 is a single-pass transmembrane protein, with an extracellular N-terminus and a cytoplasmic C-terminus (Figure 3). Amino acids 1 to 26 are a signal peptide. IL2RB has a single fibronectin type-III domain (FN3; amino acids 135 to 235), a WSXWS motif (amino acids 221 to 225), and a box 1 motif (amino acids 281 to 289). CD122 is cleaved, which generates a 37-kDa fragment (termed 37βic) containing the C-terminal tail and transmembrane domains (6). The CD122 fragment is functional and associates with STAT5 to promote cell proliferation.

 

The whistles mutation results in a tyrosine to phenylalanine substitution at position 387 (Y387F); Tyr387 is within an undefined region in the cytoplasmic C-terminal tail.

 

Please see the record flybase for more information about Il2rb.

Putative Mechanism

IL-2/IL-15 receptor-associated signaling functions in antigen-driven T cell-expansion, and maintains peripheral T cell homeostasis as well as promotes the differentiation and function of NK cells and B cells. Stimulation of the IL-2 receptor (containing a γ_c subunit) results in activation of JAK3. Activated JAK3 phosphorylates the receptor cytoplasmic domains, creating phosphotyrosine ligands for the SH2 domains of STAT5. Once recruited to the receptor, STAT5 is also tyrosine phosphorylated by JAK3. Phosphorylated, activated STAT5 enters the nucleus and accumulates there to promote transcription.

 

Il2rb-deficient (Il2rb^-/-) mice exhibited reduced numbers of regulatory T cells in the thymus and lymph nodes, enlarged spleens, increased sizes of spleen periarteriolar lymphoid sheaths, aberrant T cell responses to inflammatory cytokines, increased percentages of CD4 and CD8 T cells that express high levels of activation markers, reduced T cell proliferation, enlarged lymph nodes, increased levels of anti-DNA antibodies, and increased susceptibility to autoimmune hemolytic anemia (7;8). In addition, Il2rb^-/- mice showed reduced numbers of double-positive T cells, B cells, and memory T cells; increased numbers of plasma cells, CD4+ T cells and CD8+ T cells in the thymus, erythroid progenitors in the blood, and neutrophils in the lymph nodes, and increased levels of IgE and IgG1 in the sera (8). Il2rb^-/- mice also showed premature death, weight loss, slow movements, fuzzy hair, and poorly developed genitalia (8).

 

The increased IgE phenotype in the whistles mice mimics that of Il2rb^-/- mice indicating loss of CD122-associated function.

Primers

PCR Primer
Whistles_pcr_F: CTCTGTCCTGATCTTGCCCATGAAG
Whistles_pcr_R: TCTCTGGCAGAAATGGCTCTCCTC

Sequencing Primer
Whistles_seq_F: TGTAAGCCCATCAGGTCACG
Whistles_seq_R: ATCTCTCCGCTGGAAGTGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 632 nucleotides is amplified (chromosome 15, - strand):

1   tctctggcag aaatggctct cctcgcctgt ccccttgtcc ttcttcagcc ccagtggccc
61  tgcccctgag atctctccgc tggaagtgct cgacggagat tccaaggccg tgcagctgct
121 cctgttacag aaggactctg cccctttacc ctcgcccagc ggccactcac aggccagctg
181 cttcaccaac cagggctact tcttcttcca tctgcccaat gccttggaga tcgaatcctg
241 ccaggtgtac ttcacctatg acccctgtgt ggaagaggag gtggaggagg atgggtcaag
301 gctgcccgag ggatctcccc acccacctct gctgcctctg gctggagaac aggatgacta
361 ctgtgccttc ccgcccaggg atgacctgct gctcttctcc ccgagcctca gcacccccaa
421 cactgcctat gggggcagca gagcccctga agaaagatct ccactctccc tgcatgaggg
481 acttccctcc ctagcatccc gtgacctgat gggcttacag cgccctctgg agcggatgcc
541 ggaaggtgat ggagaggggc tgtctgccaa tagctctggg gagcaggcca gtgtcccaga
601 aggcaacctt catgggcaag atcaggacag ag

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Gnarra, J. R., Otani, H., Wang, M. G., McBride, O. W., Sharon, M., and Leonard, W. J. (1990) Human Interleukin 2 Receptor Beta-Chain Gene: Chromosomal Localization and Identification of 5' Regulatory Sequences. Proc Natl Acad Sci U S A. 87, 3440-3444.

  2. Giri, J. G., Ahdieh, M., Eisenman, J., Shanebeck, K., Grabstein, K., Kumaki, S., Namen, A., Park, L. S., Cosman, D., and Anderson, D. (1994) Utilization of the Beta and Gamma Chains of the IL-2 Receptor by the Novel Cytokine IL-15. EMBO J. 13, 2822-2830.

  3. Takeshita, T., Ohtani, K., Asao, H., Kumaki, S., Nakamura, M., and Sugamura, K. (1992) An Associated Molecule, p64, with IL-2 Receptor Beta Chain. its Possible Involvement in the Formation of the Functional Intermediate-Affinity IL-2 Receptor Complex. J Immunol. 148, 2154-2158.

  4. Wang, X., Rickert, M., and Garcia, K. C. (2005) Structure of the Quaternary Complex of Interleukin-2 with its Alpha, Beta, and Gammac Receptors. Science. 310, 1159-1163.

  5. Arima, N., Kamio, M., Okuma, M., Ju, G., and Uchiyama, T. (1991) The IL-2 Receptor Alpha-Chain Alters the Binding of IL-2 to the Beta-Chain. J Immunol. 147, 3396-3401.

  6. Montes de Oca, P., Malarde, V., Proust, R., Dautry-Varsat, A., and Gesbert, F. (2010) Ectodomain Shedding of Interleukin-2 Receptor Beta and Generation of an Intracellular Functional Fragment. J Biol Chem. 285, 22050-22058.

  7. Malek, T. R., Yu, A., Vincek, V., Scibelli, P., and Kong, L. (2002) CD4 Regulatory T Cells Prevent Lethal Autoimmunity in IL-2Rbeta-Deficient Mice. Implications for the Nonredundant Function of IL-2. Immunity. 17, 167-178.

  8. Suzuki, H., Kundig, T. M., Furlonger, C., Wakeham, A., Timms, E., Matsuyama, T., Schmits, R., Simard, J. J., Ohashi, P. S., and Griesser, H. (1995) Deregulated T Cell Activation and Autoimmunity in Mice Lacking Interleukin-2 Receptor Beta. Science. 268, 1472-1476.