Phenotypic Mutation 'apparition' (pdf version)
Alleleapparition
Mutation Type splice site (4 bp from exon)
Chromosome7
Coordinate128,112,286 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Itgam
Gene Name integrin alpha M
Synonym(s) Mac-1a, CD11b/CD18, Mac-1, F730045J24Rik, Mac-1 alpha, complement receptor type 3, Cd11b, complement component receptor 3 alpha, Ly-40, CD11B (p170), CR3
Chromosomal Location 128,062,640-128,118,491 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001082960 (variant 1), NM_008401; MGI:96607

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000068468 ] [ENSMUSP00000101847 ] [ENSMUSP00000101849 ] [ENSMUSP00000113957 ]   † probably from a misspliced transcript
SMART Domains Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
Pfam:Integrin_alpha 1130 1144 2.1e-7 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 462 516 3.67e-3 SMART
low complexity region 732 738 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-9 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 8.4e-8 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
low complexity region 1141 1150 N/A INTRINSIC
Predicted Effect probably null
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Probably nonessential (E-score: 0.120) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD11b+ DCs (gated in CD11c+ cells) - decreased
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.76; ML prob: 0.704; human score: 2.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (ENU)(1) Gene trapped(1) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Itgam APN 7 128085661 missense probably damaging 1.00
IGL00983:Itgam APN 7 128068667 missense probably damaging 0.97
IGL01102:Itgam APN 7 128080273 missense possibly damaging 0.94
IGL01615:Itgam APN 7 128116767 missense possibly damaging 0.80
IGL01845:Itgam APN 7 128112472 missense probably damaging 1.00
IGL01860:Itgam APN 7 128070943 missense probably benign 0.03
IGL01874:Itgam APN 7 128115166 missense probably damaging 0.97
IGL01910:Itgam APN 7 128083776 missense probably damaging 1.00
IGL01994:Itgam APN 7 128101727 missense probably damaging 0.97
IGL02332:Itgam APN 7 128085674 critical splice donor site probably null
IGL02348:Itgam APN 7 128116300 missense possibly damaging 0.52
IGL02394:Itgam APN 7 128084942 missense probably benign 0.01
IGL02491:Itgam APN 7 128116018 missense possibly damaging 0.71
IGL02695:Itgam APN 7 128085941 missense possibly damaging 0.81
IGL02821:Itgam APN 7 128076109 missense probably damaging 0.99
IGL02970:Itgam APN 7 128086043 missense probably benign 0.00
IGL03145:Itgam APN 7 128113019 missense probably benign 0.12
adhesion UTSW 7 128101537 missense probably damaging 0.99
attachment UTSW 7 128113033 missense probably damaging 1.00
Follower UTSW 7 128080264 missense probably damaging 1.00
invisible UTSW 7 128070703 splice site probably null
obscured UTSW 7 128081634 missense probably damaging 1.00
R0184:Itgam UTSW 7 128086058 missense probably damaging 0.96
R0389:Itgam UTSW 7 128081634 missense probably damaging 1.00
R0443:Itgam UTSW 7 128081634 missense probably damaging 1.00
R0454:Itgam UTSW 7 128107980 missense probably benign 0.01
R0674:Itgam UTSW 7 128116218 missense possibly damaging 0.67
R0828:Itgam UTSW 7 128116505 critical splice donor site probably null
R0925:Itgam UTSW 7 128112238 missense probably benign 0.00
R1086:Itgam UTSW 7 128080264 missense probably damaging 1.00
R1655:Itgam UTSW 7 128115163 missense probably benign 0.00
R1809:Itgam UTSW 7 128070937 missense possibly damaging 0.62
R1823:Itgam UTSW 7 128064732 missense probably benign 0.04
R2105:Itgam UTSW 7 128081712 missense probably damaging 1.00
R2154:Itgam UTSW 7 128085577 missense probably damaging 0.99
R2656:Itgam UTSW 7 128116815 missense probably null 1.00
R2913:Itgam UTSW 7 128112406 missense probably damaging 1.00
R3116:Itgam UTSW 7 128116029 missense probably damaging 1.00
R3404:Itgam UTSW 7 128070703 splice site probably null
R3821:Itgam UTSW 7 128112286 splice site probably null
R3822:Itgam UTSW 7 128112286 splice site probably null
R3960:Itgam UTSW 7 128115175 missense probably benign 0.02
R3968:Itgam UTSW 7 128113033 missense probably damaging 1.00
R4192:Itgam UTSW 7 128064732 missense probably benign 0.21
R4400:Itgam UTSW 7 128081658 missense probably damaging 1.00
R4708:Itgam UTSW 7 128101537 missense probably damaging 0.99
R4709:Itgam UTSW 7 128101537 missense probably damaging 0.99
R4742:Itgam UTSW 7 128113073 missense probably damaging 1.00
R4790:Itgam UTSW 7 128116273 missense probably benign 0.01
R4960:Itgam UTSW 7 128115840 missense possibly damaging 0.93
R5109:Itgam UTSW 7 128113218 missense probably benign 0.06
R5190:Itgam UTSW 7 128116317 splice site probably null
R5379:Itgam UTSW 7 128112388 missense probably damaging 1.00
R5386:Itgam UTSW 7 128107980 missense probably benign 0.00
R6104:Itgam UTSW 7 128116302 missense possibly damaging 0.85
R6122:Itgam UTSW 7 128085652 missense probably damaging 0.99
R6189:Itgam UTSW 7 128112504 missense probably benign 0.04
R6282:Itgam UTSW 7 128084942 missense probably benign 0.01
R6545:Itgam UTSW 7 128107872 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:31 PM by Anne Murray
Record Created 2019-01-22 11:59 AM by Bruce Beutler
Record Posted 2019-02-01
Phenotypic Description

Figure 1. Apparition mice exhibit decreased frequencies of peripheral CD11b+ dendritic cells (DCs) gated in CD11c+ DCs. Flow cytometric analysis of peripheral blood was utilized to determine DC frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The apparition phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3822, some of which showed a reduced frequency of CD11b+ dendritic cells (DCs) gated in CD11c+ cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced frequency of peripheral blood CD11b+ DCs using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R3822. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The CD11b+ DC phenotype was linked by continuous variable mapping to a mutation in Itgam: an A to G transition at base pair 128,112,286 (v38) on chromosome 7, or base pair 49,647 in the GenBank genomic region NC_000073 within the splice donor site of intron 17 (4-base pairs from exon 17 [out of 30 total exons]. Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from 19 homozygous reference mice and 13 heterozygous mice with a P value of 0.000102 (Figure 2).

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of a cryptic site in intron 17. The resulting transcript would have a 62-base pair insertion of intron 17, which would cause a frame-shifted protein product beginning after amino acid 720 of the protein (normally 1,154 amino acids in length) and termination after the inclusion of 18 aberrant amino acids.

 

          <--exon 16     <--exon 17 intron 17-->                      exon 18-->
2096 ……CGTCTGCGCGAAG ……CTAATTTTACCG gtgagatggcaa……ttaggaaactgaagaag…… GACTGCGTGGAC……

665  ……-R--L--R--E-- ……-L--I--L--P- -V--R--W--E-……-L--G--N--*-        -------------

               correct                     inserted/aberrant             deleted

 

The donor splice site of intron 17, which is destroyed by the apparition mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Domain organization of CD11b. The apparition mutation destroys the donor splice site of intron 17. The locations of the β-propeller domain repeats and I domain are indicated. Abbreviations: SP, signal peptide; TM, transmembrane domain. This image is interactive. Other mutations found in CD11b are noted in red. Click on each mutation for more information.

Itgam encodes CD11b, a surface marker on myeloid dendritic cells that regulates leukocyte adhesion and migration as well as phagocytosis and cytotoxicity. CD11b is an integrin α protein that forms a noncovalently linked dimer with the integrin β2 protein (also called CD18; see the record for Joker) to form functional integrin receptors. The extracellular domain of CD11b corresponds to amino acids 17-1105, while the transmembrane domain is at amino acids 1106-1129, and the cytoplasmic domain is at amino acids 1130-1153 (Figure 3) (1). Amino acids 1-16 constitute a signal peptide. The extracellular domain of CD11b has several subdomains, including seven β-propeller repeats that form a β-propeller fold. The extracellular domain also contains a Von Willebrand factor (VWFA; alternatively integrin I-domain) domain. The I-domain is a binding site for several of the CD11b ligands (2) (see invisible for more information about CD11b/CD18 ligands). There is a large interface between the β-propeller domain of the α subunit (containing the I domain) and the I-like domain of the β subunit (3), and evidence suggests that the I-like domain regulates the conformation of the I domain when both are present in the integrin (4).

 

The apparition mutation is predicted to result in a frame-shifted protein product beginning after amino acid 720 of the protein and termination after the inclusion of 18 aberrant amino acids.

 

Please see the record invisible for more information about Itgam.

Putative Mechanism

Integrins are adhesion molecules that mediate cell-cell, cell-extracellular matrix, and cell-pathogen interactions. They regulate cell migration and morphogenesis by coordinating regulatory signals from inside and outside the cell, with the physical machinery for cell movement. Most integrins, including β2-integrins, link to and regulate the actin cytoskeleton. There are 24 distinct integrins formed by a combination of α and β subunits, and those containing the β2 subunit are leukocyte-specific [reviewed in (5)].

 

The β2-containing integrins are inactive when leukocytes are in a resting state, and must be rapidly activated during infection to mediate leukocyte adhesion to various cell types such as endothelial cells of vessel walls and antigen-presenting cells. Integrins transmit signals bidirectionally across the plasma membrane. “Outside-in” signaling occurs when ligands bind to integrins, and serves to mediate adhesion and to initiate downstream signaling. Ligand binding induces the clustering of integrins on the cell surface and enables the recruitment of signaling molecules to the cytoplasmic face of the receptor. “Inside-out” signaling primes integrins for ligand binding.

 

CD11b/CD18 inhibits DC maturation and function as well as DC-induced T cell activation (6;7). See the record for invisible for more CD11b/CD18-associated functions and a list of CD11b/CD18 ligands.

 

Neutrophils from Itgam-deficient (Itgam-/-) mice exhibit defective adherence to fibronogen, iC3b-mediated phagocytosis, and homotypic aggregation as well as reduced degranulation (8;9). Neutrophil accumulation in the peritoneal cavity of thioglycolate challenged Itgam-/- mice was normal (9). Blood leukocyte and PBN counts in the Itgam-/- mice were comparable to that in wild-type mice (8). Similar to Itgam-/- mice, the apparition mice did not exhibit overt changes in peripheral blood leukocyte counts. The reduced frequency of CD11b+ DCs is consistent with loss of Itgam expression.

Primers PCR Primer
apparition_pcr_F: TTGCAGCAAAGTCGTAGCCAC
apparition_pcr_R: GGTTCCCAAAGGACCTCAAG

Sequencing Primer
apparition_seq_F: GCAAAGTCGTAGCCACAGATCTC
apparition_seq_R: AAGGACCTCAAGGGCTCC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 400 nucleotides is amplified (chromosome 7, + strand):


1   ttgcagcaaa gtcgtagcca cagatctctg tccacctggt tcctaatcac tgtgctctct
61  cctttcagga gatatccaga gcactgtcac ttatgacctg gctttagacc ctggccgctc
121 acgtatccgt gccttctttg atgagacaaa gaacaacaca cgcaggcgca cccaggtctt
181 tggattgatg cagaaatgtg aaacactgaa gctaatttta ccggtgagat ggcaaatggc
241 agatctcctg actgagggtg gggaggtctt aggaaactga agaaggtagg tccttctatc
301 cctaccatct cttaggactg cgtggacgac tcagtgagcc ccatcatcct gcgcctcaat
361 tatacactgg ttggggagcc cttgaggtcc tttgggaacc 


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler